This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Wamel, W. J. B.
Right arrow Articles by van Strijp, J. A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Wamel, W. J. B.
Right arrow Articles by van Strijp, J. A. G.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2006, p. 1310-1315, Vol. 188, No. 4
0021-9193/06/$08.00+0     doi:10.1128/JB.188.4.1310-1315.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

The Innate Immune Modulators Staphylococcal Complement Inhibitor and Chemotaxis Inhibitory Protein of Staphylococcus aureus Are Located on ß-Hemolysin-Converting Bacteriophages

Willem J. B. van Wamel,* Suzan H. M. Rooijakkers, Maartje Ruyken, Kok P. M. van Kessel, and Jos A. G. van Strijp

Eijkman-Winkler Institute, UMC Utrecht, The Netherlands

Received 1 July 2005/ Accepted 1 November 2005


arrow
ABSTRACT
 
Two newly discovered immune modulators, chemotaxis inhibitory protein of Staphylococcus aureus (CHIPS) and staphylococcal complement inhibitor (SCIN), cluster on the conserved 3' end of ß-hemolysin (hlb)-converting bacteriophages (ßC-{phi}s). Since these ßC-{phi}s also carry the genes for the immune evasion molecules staphylokinase (sak) and enterotoxin A (sea), this 8-kb region at the 3' end of ßC-{phi} represents an innate immune evasion cluster (IEC). By PCR and Southern analyses of 85 clinical Staphylococcus aureus strains and 5 classical laboratory strains, we show that 90% of S. aureus strains carry a ßC-{phi} with an IEC. Seven IEC variants were discovered, carrying different combinations of chp, sak, or sea (or sep), always in the same 5'-to-3' orientation and on the 3' end of a ßC-{phi}. From most IEC variants we could isolate active bacteriophages by mitomycin C treatment, of which lysogens were generated in S. aureus R5 (broad phage host). All IEC-carrying bacteriophages integrated into hlb, as was measured by Southern blotting of R5 lysogens. Large quantities of the different bacteriophages were obtained by mitomycin C treatment of the lysogens, and bacteriophages were collected and used to reinfect all lysogenic R5 strains. In total, five lytic families were found. Furthermore, phage DNA was isolated and digested with EcoR1, revealing that one IEC variant can be found on different ßI-{phi}s. In conclusion, the four human-specific innate immune modulators SCIN, CHIPS, SAK, and SEA form an IEC that is easily transferred among S. aureus strains by a diverse group of ß-hemolysin-converting bacteriophages.


arrow
INTRODUCTION
 
Recently, we described two new innate immune modulators of Staphylococcus aureus: staphylococcal complement inhibitor (SCIN) and chemotaxis inhibitory protein of S. aureus (CHIPS). SCIN is a C3 convertase inhibitor, blocking the formation of C3b on the surface of the bacterium and the ability of human neutrophils to phagocytose S. aureus (25). CHIPS is a bacterial chemokine receptor modulator that specifically binds two chemokine receptors. CHIPS attenuates the response of the C5a receptor (C5aR) as well as the formylated peptide receptor of human neutrophils. This results in inhibition of neutrophil chemotaxis and activation in response to C5a and formylated peptides (6, 10, 20, 21). Both SCIN and CHIPS are important virulence factors that protect S. aureus from innate immune defense systems.

The SCIN (scn) and CHIPS (chp) genes are found in 6/7 and 3/7 sequenced S. aureus strains, respectively. Analyses of these sequenced genomes showed that both scn and chp are carried by ß-hemolysin (hlb)-converting bacteriophages (ßC-{phi}s), formerly known as double- and triple-converting phages. Double-converting bacteriophages were earlier described to negatively convert ß-hemolysin expression but simultaneously introduce the staphylokinase (SAK) gene. Triple conversion leads to ß-hemolysin-negative and SAK- and staphylococcal enterotoxin A (SEA)-positive strains. {phi}13 and {phi}42 are examples of, respectively, double- and triple-converting bacteriophages. Both {phi}13 and {phi}42 incorporate in the S. aureus genome via an orientation- and site-specific recombination by targeting a 14-bp core sequence present in the ß-hemolysin gene (attB) and the phage genome (attP) (2-5). Besides SCIN and CHIPS, the two other molecules that are encoded adjacent to the CHIPS gene are also involved in opposing the innate immune system. SEA is a superantigen but also has the capability to modulate the function of chemokine receptors like CCR1, CCR2, and CCR5 (23). SAK has recently been described as a modulator of different parts of the innate immune system: Tarkowski's group showed that SAK directly destroys defensins (14), and we described that SAK has antiopsonic activities (24). Interestingly, all four immune evasion molecules on ßC-{phi}s display an extreme human specificity.

In this paper we describe that the SCIN and CHIPS genes are located on an 8-kb region at the conserved 3' end of ß-hemolysin-converting bacteriophages. This 8-kb region at the conserved 3' end also encodes the genes for SAK, SEA, or SEP, thereby forming an immune evasion cluster (IEC). Since IECs are bacteriophage encoded, we investigated the distribution and diversity among clinical S. aureus isolates.


arrow
MATERIALS AND METHODS
 
Bacterial strains. In this study, the classical laboratory strains COL, Smith diffuse, Wood 46, Cowan, and Newman were used, next to 85 clinical S. aureus strains. Of these 85 strains, 18 methicillin-resistant Staphylococcus aureus isolates, 10 blood isolates, 10 continuous ambulatory peritoneal dialysis isolates, 5 liquor isolates, 4 pulmonary fluid isolates, 1 pericardial venal isolate, and 3 joint isolates were obtained within the UMC Utrecht. Furthermore, 15 wound isolates were obtained from the Diakonesse Hospital Utrecht, 10 blood isolates came from the Wilhelmina Children's Hospital Utrecht, and 9 blood isolates came from the RIVM (National Institute for Public Health and the Environment, Bilthoven, The Neverlands). S. aureus R5, known for its susceptibility to a broad range of S. aureus bacteriophages, was kindly provided by the RIVM for transduction experiments. This study used sequence data of MRSA-252 (11), MSSA-476 (11), N315 (16), Mu50 (16), MW2 (1), NCTC 8325 (NC002954), {phi}13 (12), and {phi}42e (17).

DNA extraction. Bacteria were cultured overnight (ON) at 37°C on blood agar (Becton Dickinson, Sparks, MD). Chromosomal DNA was isolated using the High Pure PCR template preparation kit (Roche) according to the manufacturer's protocol, with the exception that bacteria were lysed using 50 µg/µl lysostaphin (Sigma).

PCR analyses. Primers were designed specific for chp, sak, sea, sep, scn, and hlb (Chp-1, TTTACTTTTGAACCGTTTCCTAC; Chp-2, CGTCCTGAATTCTTAGTATGCATATTCATTAG; Sak-1, AAGGCGATGACGCGAGTTAT; Sak-2, GCGCTTGGATCTAATTCAAC; Sea-1, AGATCATTCGTGGTATAACG; Sea-2, TTAACCGAAGGTTCTGTAGA; Sep-1, AATCATAACCAACCGAATCA; Sep-2, TCATAATGGAAGTGCTATAA; Scn-1, AGCACAAGCTTGCCAACATCG; Scn-2, TTAATATTTACTTTTTAGTGC; Hlb-1, GTTGGTGCTCTTACTGACAA; and Hlb-2, TGTGTACCGATAACGTGAAC).

Amplification was carried out on a PE 9600 thermocycler (Perkin-Elmer Corp., Norwalk, Conn.) under the following conditions: 30 cycles of 30-s denaturation at 94°C, 30-s annealing at 50°C, and elongation at 72°C depending on the fragment length (1 kb/min). Amplification products were electrophoresed on a 1% agarose gel containing ethidium bromide and visualized by transillumination under UV.

Molecular characterization. Southern blot analyses of the conserved 3' ends were performed on EcoRI/XhoI-digested chromosomal DNA using digoxigenin-labeled specific probes for chp, sak, sea, and sep as described previously (27). Pulsed-field gel electrophoresis (PFGE) typing by SmaI macrorestriction was performed as described by Struelens et al. (26). For identification of agr alleles, an agr group-specific multiplex PCR was performed on chromosomal S. aureus DNA according to the methods described in reference 9. Amplification products were electrophoresed on a 1.5% agarose gel containing ethidium bromide and visualized by transillumination under UV.

Bacteriophage induction and DNA isolation. Bacteriophages were induced and isolated according to the methods described by Kaneko et al. (15). In short, bacteria were grown to exponential growth phase and treated with 1 µg/ml mitomycin C (Sigma) for 3 h at 30°C. Lysates were centrifuged twice at 15,000 x g for 20 min. After addition of polyethylene glycol 6000 (10%) and NaCl (0.7 M), mixtures were incubated for 12 h at 4°C. Finally, bacteriophages were isolated by centrifugation at 3,000 x g and suspended in phosphate-buffered saline. Chromosomal bacteriophage DNA was isolated with the High Pure PCR template preparation kit (Roche) using the manufacturer's instructions on isolation of nucleic acids from bacteria/yeast.

Lysogen generation. Bacteriophages obtained from the clinical S. aureus strains were serially diluted and mixed with S. aureus R5 and soft LB agar (LBA). Mixtures were plated on LBA containing 0.5 mM CaCl2 (LBA-Ca) and incubated ON at 37°C. Loose plaques were picked and used to inoculate fresh S. aureus R5 in LB. After ON incubation at 37°C, bacteria were plated on LBA and single colonies were tested for lysogeny using PCR specific for conserved 3' ends and Southern blotting.

Lytic assay. Serial dilutions of bacteriophages were spotted on lysogenic strains plated on LBA-Ca and incubated ON at 37°C. A lysogenic strain was designated resistant when, compared to S. aureus R5, an over-fourfold amount of bacteriophage was needed to induce lysis.

CHIPS capture enzyme-linked immunosorbent assay. S. aureus lysogenic strains were cultured on blood agar for 18 h. One CFU was used to inoculate 3 ml Todd-Hewitt medium and cultured overnight at 37°C under constant agitation. The optical density was measured at 650 nm, and bacteria were pelleted by centrifugation. Supernatants were stored at –20°C for analysis. CHIPS was quantified as described earlier (10).


arrow
RESULTS
 
scn and chp are part of a bacteriophage. Database analyses revealed that scn and chp are both located on ßC-{phi}s. From databases we obtained the DNA sequences of seven bacteriophages that were incorporated in the ß-hemolysin gene. One is published as an individual bacteriophage ({phi}13), whereas the others are part of the genomes of six different S. aureus strains: MRSA-252, MRSA-476, Mu50, MW2, N135, and NCTC 8325. Since the ßC-{phi} from NCTC 8325 is {phi}13, only {phi}13 was included in the analyses. The regions of ßC-{phi}s encoding phage packing, head, and tail proteins and modules for lysogeny are rather different. Despite these differences, all bacteriophages are (as can be expected) strictly homologous in the first 1,000 bp at the 5' end, encoding the integrase and attP. In addition, the 3' ends of ßC-{phi}s show an interesting similarity. In the prototype {phi}, MRSA-252, the genes encoding SEA, SAK, CHIPS, and SCIN are located at the final 8 kb of the 3' end. In almost all strains this region is strictly homologous except for a 1.8-kb sea cassette, which is missing in {phi}-N315 and {phi}13. Interestingly, in {phi}-N315 the 1.8-kb sea cassette was replaced by a 1.75-kb sep cassette. Furthermore, a 0.78-kb chp cassette could not be found in {phi}-Mu50, {phi}-MW2, and {phi}-MSSA-476 (Fig. 1). Since the 8-kb region at the 3' end of ßC-{phi}s encodes up to four different immune evasion molecules, we named this region an IEC.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Comparison of the genomic organization of the conserved 3' ends of four representative ßC-{phi}s obtained from S. aureus strains {phi}-MRSA-252, {phi}-N315, {phi}13, and {phi}-MSSA-476. White bars represent homologous nucleotide regions (>99%), hatched areas show a homology between 75% and 85%, black bars show no significant homology, and dashed lines indicate deletions in the corresponding sequence.

Distribution of ßC-bacteriophages and their immune evasion modulators. DNA was isolated from 85 randomly selected clinical strains and 5 classical lab strains to assess the frequency distribution of ßC-{phi}s. PCRs were performed using primer pairs specific for sea, sep, sak, chp, scn, and hlb in order to identify the presence of the genes. To obtain information on the organization of these genes, PCRs were performed using relevant combinations of the individual primers. In addition, Southern blot analyses were performed on EcoR1- or XhoI-digested chromosomal DNA of each strain using digoxigenin-labeled chp, sak, or sea probes. Figure 2 shows that ßC-{phi}s were found in 80 (88.9%) of the S. aureus strains, containing seven different IEC types named A through G. Type B (sak-chp-scn) showed the highest prevalence and was found in 24 (26.7%) strains. Concerning the virulence factors, CHIPS was present in 51 (56.6%) of these strains, SAK was in 69 (76.6%), and the superantigens SEA and SEP were in 25 (27.8%) and 7 (7.8%), respectively. Noteworthy is that SCIN was present in all ßC-{phi}-containing strains. All IEC types contained up to four virulence factors located in the same order, 5'-sea/sep-sak-chp-scn-3', and were always found at the 3' end of ßC-{phi}s.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2. Schematic representation of the different IEC types and their incidence found among 85 clinical S. aureus strains and 5 classical laboratory strains. Arrow boxes indicate the location and orientation of sea, sak, chp, and scn, and dashed lines represent the absence of one or more of these genes. Data are based on Southern and PCR analyses.

Diversity of bacterial strains containing IEC types A to G. To analyze the diversity of the collected clinical strains, we performed PFGE on SmaI-digested chromosomal DNA of all 90 strains. The obtained patterns were analyzed using Gel Compare (BioNumerics 4.0; Applied Maths, Sint-Martens-Latem, Belgium), and data were correlated with the data on IEC types A to G. Using a 55% cutoff value, the 90 strains could be divided into six PFGE super groups: IEC type A was found in three of six PFGE supergroups, B was found in four, C was found in one, D was found in four, E was found in five, F was found in one, and G was found in one. Using a 65% cutoff value, the 90 strains could be divided into 20 groups. In this case, IEC type A was found in 3 of 20 PFGE groups, type B was in 9, type C was in 3, type D was in 7, type E was in 11, type F was in 2, and type G was in 2. In particular, IEC types B, D, and E were found in multiple different PFGE variants. Although PFGE patterns were rather diverse, one group of 15 identical PFGE type strains contained 8 (53.3%) IEC type A, 3 (20%) type B, 1 (6.7%) type D, 2 (13.3%) type E, and in 1 (6.7%) for which no variant was found (Fig. 3).


Figure 3
View larger version (161K):
[in this window]
[in a new window]
 
FIG. 3. Related S. aureus strains harbor different IEC types. The PFGE results of 15 very related S. aureus strains are shown in combination with their IEC types.

Finally, we also typed our 90 strains for the global regulation system agr. We found agr groups 1, 2, 3, and 4 in, respectively, 46 (51.1%), 25 (27.8%), 18 (20.0%), and 1 (1.1%) of the strains. In agr groups 1 and 2, all IEC variants were found, except type F was not found in agr group 1. In agr group 3, IEC variants A, B, D, and E were found. The only agr group 4-positive strains carried IEC variant E (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Distribution of IEC types among S. aureus agr types 1 to 4

In conclusion, ßC-{phi}s with the same IEC types can be found in different PFGE and agr groups. Moreover, related S. aureus strains can contain ßC-{phi}s with different IEC variants. These data strongly suggest that the ßC-{phi}s carrying IECs are mobile elements that move around in the population.

ßC-{phi}s are active prophages. First, we tested whether we could induce, isolate, and transfer ßC-{phi}s from clinical strains into S. aureus R5 (the broad phage acceptor strain); therefore, S. aureus strain C555, carrying a ßC-{phi} with IEC B, was treated with mitomycin C. Collected bacteriophages contained IEC with chp as shown by PCR analysis. Subsequent incubation of S. aureus R5 with these chp-carrying ßC-{phi}s resulted in lysogenic strains that carried chp-positive ßC-{phi}s. These strains also produced and excreted CHIPS as measured in the supernatants by enzyme-linked immunosorbent assay. Then, a subset of 46 S. aureus strains equally distributed among the IEC variants and representing the major PFGE groups were analyzed as well. A total of 33 (71.7%) strains contained mitomycin C-inducible phages, for plaques were found on S. aureus R5. Among these inducible bacteriophages, 17 were ßC-{phi}s and all IEC variants were found except for type C. These data clearly show that ßC-{phi}s carrying the different IEC variants are active prophages. On the other hand, in 29 (63.0%) of the S. aureus strains no mobile characteristics of the ßC-{phi}s could be detected. This may be explained by loss of phage mobility or R5 host restriction.

Finally, 14 R5 lysogens were obtained with stable integrated ßC-{phi}s which contained the IEC variant A, B, D, or E. To determine the ßC-{phi} incorporation site in these lysogens, we analyzed SmaI-digested chromosomal DNA by PFGE and Southern blotting using digoxigenin-labeled chp, sak, and sea probes (depending on the IEC type) and hlb probes. All IEC-containing bacteriophages were incorporated into hlb. All lysogens harbored one copy of the prophage, except for one where we found two copies (which was excluded from further analyses).

IECs are carried by different ßC-{phi}s. It is well known that lysogenic bacteria are resistant to infection with homologous bacteriophages. In addition, a recent study by Dempsey et al. (7) showed that {phi}42 introduces a restriction modification system into its lysogen, making the bacterium resistant to all international basic S. aureus typing phages. Using these properties we studied whether the IEC variants were carried by related or different ßC-{phi}s. Therefore, we took the 13 lysogens carrying one of the ßC-{phi}s with an IEC variant and induced bacteriophages from each individual strain using mitomycin C. All lysogens were assayed for lysis by reinfection with the whole set of IEC-containing bacteriophages. Lysis patterns indicated the presence of five lytic groups among IEC-containing ßC-{phi}s. Lysogens of one of the lytic groups showed resistance to all of the tested bacteriophages, which suggests that these ßC-{phi}s are {phi}42 or related bacteriophages. These data indicate that IECs can be carried by different ßC-{phi}s.

In addition, chromosomal DNA of all bacteriophages was isolated, digested with EcoR1, and analyzed on agarose. If ßC-{phi}s within one IEC group differed by three or more bands from each other, they were considered different. In the cases of IEC variants B and E, three different ßC-{phi}s were found and, in the case of variants A and D, only one was found (Fig. 4). This means that the same IEC variant can be located on different ßC-{phi}s.


Figure 4
View larger version (44K):
[in this window]
[in a new window]
 
FIG. 4. One IEC variant can be carried by different ßC-{phi}s. Chromosomal DNA of ßC-{phi}s containing IEC A and B were digested with EcoR1 and analyzed on 1% agarose.


arrow
DISCUSSION
 
Here we describe a staphylococcal IEC that is located on the 3' end of ß-hemolysin-converting bacteriophages, better known as double- and triple-converting bacteriophages. These phages were named for their capacity to delete the presence of ß-hemolysin and add either sak or sea to the genome of the infected staphylococcus. Now that we know that SCIN and CHIPS are also present on these phages, we could rename these into triple-, quadruple-, and quintuple-converting phages. Bacterial virulence factors are frequently found on the 3' ends of bacteriophages (28). Examples in S. aureus include Panton-Valentine leukocidin (PVL; LukF-PV/LukS-PV) of {phi}-PVL and {phi}-SLT (15, 19), a PVL variant [LukF-PV(P83)/LukM] of {phi}-PV83 (30), and exfoliative toxin A (ETA) of {phi}-ETA (8) and {phi}ZM-1 (29). Interestingly, these bacteriophages carry only one virulence factor at their 3' end. ßC-{phi}s are an exception, as these phages can encode four virulence factors clustered on their 3' end. Furthermore, so far we identified seven different variants of IEC to be carried by several different ßC-{phi}s.

In 90% of strains from a genetically diverse clinical S. aureus strain collection, a ßC-{phi} was found that carries one of the seven IEC variants. The high incidence of IEC-carrying ßC-{phi}s in human S. aureus strains is a unique feature among staphylococcal mobile elements carrying virulence factors. In a recent study (13) a collection of 198 clinical S. aureus strains was tested for a vast amount of virulence factors. eta, lukS-PV/lukF-PV, and lukM, which are all carried by bacteriophages, were found in only 18.7%, 18.2%, and 0.0% of the strains, respectively. In another study, PVL was found with an incidence of only 2% (22). Also, S. aureus pathogenicity island 1 encoding toxic shock syndrome toxin 1 can be mobilized by bacteriophages (18) and was found in only 19.7% of strains. All these data point in one direction: ßC-{phi}s carrying IECs are an exception. In comparison with other mobile virulence factors, IEC-encoding genes exhibit an exceptional high incidence among clinical S. aureus strains. One important reason for this is probably the fact that IEC can be carried by several different phages, allowing them to cover a huge host range. Furthermore, one can predict that diversity in the lysogenic module may facilitate the spread of ßC-{phi}s. If, for instance, a lysogenic strain (containing a ßC-{phi}) were infected by a ßC-{phi} with another lysogenic module, the lysogenic pathway would be blocked, while on the contrary the lytic pathway would not be. Lysogenic strains (containing a ßC-{phi}) can therefore be strongholds for other ßC-{phi}s and allow them to spread. In addition, superinfections presumably facilitate recombination events, thereby promoting the development of the different variants of IEC.

The most striking feature of the collection of virulence factors in IEC is that they all, in one way or another, seem to affect certain elements of the human innate immune system. Next to its role as a superantigen, SEA has been described to modulate the function of chemokine receptors like CCR1, CCR2, and CCR5 (23). CHIPS blocks two other G-protein-coupled receptors involved in chemotaxis and phagocyte activation, the C5a receptor and the formylated peptide receptor, by direct binding to these receptors (6, 20). SAK was recently described to inhibit human {alpha}-defensins (14). In our own group we recently described that SAK is antiopsonic by degradation of both immunoglobulin G as well as C3b/C3bi on the surface of staphylococci that is mediated via plasmin (24). SCIN is a highly specific antiopsonic molecule as well, aimed at the key component of the complement system, the C3 convertase (25). This large collection of human-specific anti-innate immunity factors is a likely explanation for the high incidence of ßC-{phi}s among human S. aureus isolates.

The large variety in both IECs and ßC-{phi}s carrying this cluster show that the IEC is a very dynamic DNA element. It has spread successfully through the S. aureus population and will continue to do so. This provides S. aureus with a unique mechanism to adapt to, and counteract, the human host.

Elucidation of the mechanisms involved in IEC generation, acquisition, and exchange and the role in virulence will enhance our understanding of the niche-dependent evolutionary potentials of S. aureus.


arrow
ACKNOWLEDGMENTS
 
We thank W. T. M. Jansen for critical reading of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Eijkman-Winkler Institute, Room G04-614, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht, The Netherlands. Phone: 31-30-2507637. Fax: 31-30-2541770. E-mail: w.j.b.vanwamel{at}azu.nl. Back


arrow
REFERENCES
 
    1
  1. Baba, T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi, Y. Nagai, N. Iwama, K. Asano, T. Naimi, H. Kuroda, L. Cui, K. Yamamoto, and K. Hiramatsu. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819-1827.[CrossRef][Medline]
  2. 2
  3. Carroll, J. D., M. T. Cafferkey, and D. C. Coleman. 1993. Serotype F double-converting and triple-converting phage insertionally inactivate the Staphylococcus aureus beta-toxin determinant by a common molecular mechanism. FEMS Microbiol. Lett. 106:147-155.[Medline]
  4. 3
  5. Coleman, D., J. Knights, R. Russell, D. Shanley, T. H. Birkbeck, G. Dougan, and I. Charles. 1991. Insertional inactivation of the Staphylococcus aureus beta-toxin by bacteriophage phi 13 occurs by site- and orientation-specific integration of the phi 13 genome. Mol. Microbiol. 5:933-939.[Medline]
  6. 4
  7. Coleman, D. C., J. P. Arbuthnott, H. M. Pomeroy, and T. H. Birkbeck. 1986. Cloning and expression in Escherichia coli and Staphylococcus aureus of the beta-lysin determinant from Staphylococcus aureus: evidence that bacteriophage conversion of beta-lysin activity is caused by insertional inactivation of the beta-lysin determinant. Microb. Pathog. 1:549-564.[CrossRef][Medline]
  8. 5
  9. Coleman, D. C., D. J. Sullivan, R. J. Russell, J. P. Arbuthnott, B. F. Carey, and H. M. Pomeroy. 1989. Staphylococcus aureus bacteriophages mediating the simultaneous lysogenic conversion of beta-lysin, staphylokinase and enterotoxin A: molecular mechanism of triple conversion. J. Gen. Microbiol. 135:1679-1697.[Abstract/Free Full Text]
  10. 6
  11. de Haas, C. J. C., K. E. Veldkamp, A. Peschel, F. Weerkamp, W. J. B. Van Wamel, E. C. J. M. Heezius, M. J. J. G. Poppelier, K. P. M. Van Kessel, and J. A. G. van Strijp. 2004. Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial antiinflammatory agent. J. Exp. Med. 199:687-695.[Abstract/Free Full Text]
  12. 7
  13. Dempsey, R. M., D. Carroll, H. Kong, L. Higgins, C. T. Keane, and D. C. Coleman. 2005. Sau42I, a BcgI-like restriction-modification system encoded by the Staphylococcus aureus quadruple-converting phage Phi42. Microbiology 151:1301-1311.[Abstract/Free Full Text]
  14. 8
  15. Endo, Y., T. Yamada, K. Matsunaga, Y. Hayakawa, T. Kaidoh, and S. Takeuchi. 2003. Phage conversion of exfoliative toxin A in Staphylococcus aureus isolated from cows with mastitis. Vet. Microbiol. 96:81-90.[CrossRef][Medline]
  16. 9
  17. Gilot, P., G. Lina, T. Cochard, and B. Poutrel. 2002. Analysis of the genetic variability of genes encoding the RNA III-activating components Agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis. J. Clin. Microbiol. 40:4060-4067.[Abstract/Free Full Text]
  18. 10
  19. Haas, P. J., C. J. C. de Haas, W. Kleibeuker, M. J. J. G. Poppelier, K. P. M. Van Kessel, J. A. W. Kruijtzer, R. M. J. Liskamp, and J. A. G. van Strijp. 2004. N-terminal residues of the chemotaxis inhibitory protein of Staphylococcus aureus are essential for blocking formylated peptide receptor but not C5a receptor. J. Immunol. 173:5704-5711.[Abstract/Free Full Text]
  20. 11
  21. Holden, M. T. G., E. J. Feil, J. A. Lindsay, S. J. Peacock, N. P. J. Day, M. C. Enright, T. J. Foster, C. E. Moore, L. Hurst, R. Atkin, A. Barron, N. Bason, S. D. Bentley, C. Chillingworth, T. Chillingworth, C. Churcher, L. Clark, C. Corton, A. Cronin, J. Doggett, L. Dowd, T. Feltwell, Z. Hance, B. Harris, H. Hauser, S. Holroyd, K. Jagels, K. D. James, N. Lennard, A. Line, R. Mayes, S. Moule, K. Mungall, D. Ormond, M. A. Quail, E. Rabbinowitsch, K. Rutherford, M. Sanders, S. Sharp, M. Simmonds, K. Stevens, S. Whitehead, B. G. Barrell, B. G. Spratt, and J. Parkhill. 2004. Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc. Natl. Acad. Sci. USA 101:9786-9791.[Abstract/Free Full Text]
  22. 12
  23. Iandolo, J. J., V. Worrell, K. H. Groicher, Y. D. Qian, R. Y. Tian, S. Kenton, A. Dorman, H. G. Ji, S. P. Lin, P. Loh, S. L. Qi, H. Zhu, and B. A. Roe. 2002. Comparative analysis of the genomes of the temperate bacteriophages phi 11, phi 12 and phi 13 of Staphylococcus aureus 8325. Gene 289:109-118.[CrossRef][Medline]
  24. 13
  25. Jarraud, S., C. Mougel, J. Thioulouse, G. Lina, H. Meugnier, F. Forey, X. Nesme, J. Etienne, and F. Vandenesch. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 70:631-641.[Abstract/Free Full Text]
  26. 14
  27. Jin, T., M. Bokarewa, T. Foster, J. Mitchell, J. Higgins, and A. Tarkowski. 2004. Staphylococcus aureus resists human defensins by production of staphylokinase, a novel bacterial evasion mechanism. J. Immunol. 172:1169-1176.[Abstract/Free Full Text]
  28. 15
  29. Kaneko, J., T. Kimura, S. Narita, T. Tomita, and Y. Kamio. 1998. Complete nucleotide sequence and molecular characterization of the temperate staphylococcal bacteriophage phi PVL carrying Panton-Valentine leukocidin genes. Gene 215:57-67.[CrossRef][Medline]
  30. 16
  31. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I. Kobayashi, L. Z. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Q. Lian, T. Ito, M. Kanamori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama, Y. Mizutani-Ui, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K. Sekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shiba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu. 2001. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225-1240.[CrossRef][Medline]
  32. 17
  33. Kwan, T., J. Liu, M. DuBow, P. Gros, and J. Pelletier. 2005. The complete genomes and proteomes of 27 Staphylococcus aureus bacteriophages. Proc. Natl. Acad. Sci. USA 102:5174-5179.[Abstract/Free Full Text]
  34. 18
  35. Lindsay, J. A., A. Ruzin, H. F. Ross, N. Kurepina, and R. P. Novick. 1998. The gene for toxic shock toxin is carried by a family of mobile pathogenicity islands in Staphylococcus aureus. Mol. Microbiol. 29:527-543.[CrossRef][Medline]
  36. 19
  37. Narita, S., J. Kaneko, J. Chiba, Y. Piemont, S. Jarraud, J. Etienne, and Y. Kamio. 2001. Phage conversion of Panton-Valentine leukocidin in Staphylococcus aureus: molecular analysis of a PVL-converting phage, phi SLT. Gene 268:195-206.[CrossRef][Medline]
  38. 20
  39. Postma, B., W. Kleibeuker, M. J. Poppelier, M. Boonstra, K. P. M. Van Kessel, J. A. G. van Strijp, and C. J. C. de Haas. 2005. Residues 10-18 within the C5a receptor N terminus compose a binding domain for chemotaxis inhibitory protein of Staphylococcus aureus. J. Biol. Chem. 280:2020-2027.[Abstract/Free Full Text]
  40. 21
  41. Postma, B., M. J. Poppelier, J. C. van Galen, E. R. Prossnitz, J. A. G. van Strijp, C. J. C. de Haas, and K. P. M. Van Kessel. 2004. Chemotaxis inhibitory protein of Staphylococcus aureus binds specifically to the C5a and formylated peptide receptor. J. Immunol. 172:6994-7001.[Abstract/Free Full Text]
  42. 22
  43. Prevost, G., P. Couppie, P. Prevost, S. Gayet, P. Petiau, B. Cribier, H. Monteil, and Y. Piemont. 1995. Epidemiologic data on Staphylococcus aureus strains producing synergohymenotropic toxins. J. Med. Microbiol. 42:237-245.[Abstract/Free Full Text]
  44. 23
  45. Rahimpour, R., G. Mitchell, M. H. Khandaker, C. Kong, B. Singh, L. L. Xu, A. Ochi, R. D. Feldman, J. G. Pickering, B. M. Gill, and D. J. Kelvin. 1999. Bacterial superantigens induce down-modulation of CC chemokine responsiveness in human monocytes via an alternative chemokine ligand-independent mechanism. J. Immunol. 162:2299-2307.[Abstract/Free Full Text]
  46. 24
  47. Rooijakkers, S. H., W. J. Van Wamel, M. Ruyken, K. P. Van Kessel, and J. A. van Strijp. 2005. Anti-opsonic properties of staphylokinase. Microbes Infect. 7:476-484.[CrossRef][Medline]
  48. 25
  49. Rooijakkers, S. H. M., M. Ruyken, A. Roos, H. R. Daha, J. S. Presanis, R. B. Sim, W. J. B. Van Wamel, K. P. M. Van Kessel, and J. A. G. van Strijp. 2005. Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat. Immunol. 6:920-927.[CrossRef][Medline]
  50. 26
  51. Struelens, M. J., A. Deplano, C. Godard, N. Maes, and E. Serruys. 1992. Epidemiologic typing and delineation of genetic relatedness of methicillin-resistant Staphylococcus aureus by macrorestriction analysis of genomic DNA by using pulsed-field gel electrophoresis. J. Clin. Microbiol. 30:2599-2605.[Abstract/Free Full Text]
  52. 27
  53. Van Wamel, W. J., J. Verhoef, C. M. Vandenbroucke Grauls, G. Rossum, and A. C. Fluit. 1998. Cloning and characterization of an accessory gene regulator (agr)-like locus from Staphylococcus epidermidis. FEMS Microbiol. Lett. 163:1-9.[Medline]
  54. 28
  55. Wagner, P. L., and M. K. Waldor. 2002. Bacteriophage control of bacterial virulence. Infect. Immun. 70:3985-3993.[Free Full Text]
  56. 29
  57. Yoshizawa, Y., J. Sakurada, S. Sakurai, K. Machida, I. Kondo, and S. Masuda. 2000. An exfoliative toxin A-converting phage isolated from Staphylococcus aureus strain ZM. Microbiol. Immunol. 44:189-191.[Medline]
  58. 30
  59. Zou, D., J. Kaneko, S. Narita, and Y. Kamio. 2000. Prophage, phi PV83-pro, carrying Panton-Valentine leukocidin genes, on the Staphylococcus aureus p83 chromosome: comparative analysis of the genome structures of phi PV83-pro, phi PVL, phi 11, and other phages. Biosci. Biotechnol. Biochem. 64:2631-2643.[CrossRef][Medline]


Journal of Bacteriology, February 2006, p. 1310-1315, Vol. 188, No. 4
0021-9193/06/$08.00+0     doi:10.1128/JB.188.4.1310-1315.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Goerke, C., Pantucek, R., Holtfreter, S., Schulte, B., Zink, M., Grumann, D., Broker, B. M., Doskar, J., Wolz, C. (2009). Diversity of Prophages in Dominant Staphylococcus aureus Clonal Lineages. J. Bacteriol. 191: 3462-3468 [Abstract] [Full Text]  
  • Collery, M. M., Smyth, D. S., Tumilty, J. J. G., Twohig, J. M., Smyth, C. J. (2009). Associations between enterotoxin gene cluster types egc1, egc2 and egc3, agr types, enterotoxin and enterotoxin-like gene profiles, and molecular typing characteristics of human nasal carriage and animal isolates of Staphylococcus aureus. J Med Microbiol 58: 13-25 [Abstract] [Full Text]  
  • Sotto, A., Lina, G., Richard, J.-L., Combescure, C., Bourg, G., Vidal, L., Jourdan, N., Etienne, J., Lavigne, J.-P. (2008). Virulence Potential of Staphylococcus aureus Strains Isolated From Diabetic Foot Ulcers: A new paradigm. Diabetes Care 31: 2318-2324 [Abstract] [Full Text]  
  • Dauwalder, O., Lina, G., Durand, G., Bes, M., Meugnier, H., Jarlier, V., Coignard, B., Vandenesch, F., Etienne, J., Laurent, F. (2008). Epidemiology of Invasive Methicillin-Resistant Staphylococcus aureus Clones Collected in France in 2006 and 2007. J. Clin. Microbiol. 46: 3454-3458 [Abstract] [Full Text]  
  • Sung, J. M.-L., Lloyd, D. H., Lindsay, J. A. (2008). Staphylococcus aureus host specificity: comparative genomics of human versus animal isolates by multi-strain microarray. Microbiology 154: 1949-1959 [Abstract] [Full Text]  
  • Baba, T., Bae, T., Schneewind, O., Takeuchi, F., Hiramatsu, K. (2008). Genome Sequence of Staphylococcus aureus Strain Newman and Comparative Analysis of Staphylococcal Genomes: Polymorphism and Evolution of Two Major Pathogenicity Islands. J. Bacteriol. 190: 300-310 [Abstract] [Full Text]  
  • Jongerius, I., Kohl, J., Pandey, M. K., Ruyken, M., van Kessel, K. P.M., van Strijp, J. A.G., Rooijakkers, S. H.M. (2007). Staphylococcal complement evasion by various convertase-blocking molecules. JEM 204: 2461-2471 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Wamel, W. J. B.
Right arrow Articles by van Strijp, J. A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Wamel, W. J. B.
Right arrow Articles by van Strijp, J. A. G.