Previous Article | Next Article ![]()
Journal of Bacteriology, February 2006, p. 1351-1363, Vol. 188, No. 4
0021-9193/06/$08.00+0 doi:10.1128/JB.188.4.1351-1363.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois 60611
Received 27 September 2005/ Accepted 20 November 2005
|
|
|---|
|
|
|---|
Iron has long been recognized as a key requirement for L. pneumophila replication, intracellular infection, and virulence (6, 13, 28, 34, 37, 45, 61). For many years, it was believed that L. pneumophila does not make siderophores, a conclusion based upon results obtained by Arnow and Csáky assays, which identify catecholate and hydroxamate structures, as well as the chrome azurol S (CAS) assay, which detects iron chelators independently of structure (36, 40, 62). The story of Legionella siderophores changed when we showed that L. pneumophila could produce a high-affinity iron chelator (39). When grown at 37°C in a low-iron chemically defined medium (CDM), L. pneumophila secretes a low-molecular-weight substance that is reactive in the CAS assay. The siderophore-like activity is iron repressed and is only observed when the CDM is inoculated with legionellae that had been grown to log or early stationary phase (39). Inocula from the late stationary phase, despite growing in the CDM, fail to result in CAS reactivity. CAS reactivity was seen with serogroup 1 strains 130b and Philadelphia-1, as well as isolates representing nine other L. pneumophila serogroups (39). We designated the iron-chelating activity in L. pneumophila supernatants as legiobactin (39), and later observed siderophore activity in the supernatants of 18 other Legionella species (75).
The first gene to be examined as a possible promoter of legiobactin production was frgA, a Fur-regulated gene whose predicted product had initially been shown to be homologous with IucA and IucC, two enzymes involved in aerobactin biosynthesis in Escherichia and Shigella species (35). Current BlastP results indicate that FrgA also shares homology with siderophore biosynthetic genes of Bordetella bronchiseptica, Erwinia chrysanthemi, Sinorhizobium meliloti, Staphylococcus aureus, and Vibrio parahaemolyticus (17, 26, 29, 43, 80). Although FrgA is homologous with hydroxamate synthetases and frgA promotes growth within the iron-limited intracellular niche in macrophages (35), frgA mutants proved not to be defective for CAS reactivity when grown in low-iron CDM (39). We also observed that the cytochrome c maturation operon, which promotes L. pneumophila growth in low-iron media as well as siderophore expression in several other types of bacteria, is not required for legiobactin production (47, 82). In another recent study, the feoB ferrous iron transporter showed no role in the generation of L. pneumophila CAS reactivity (63). Thus, the genetic basis of legiobactin production has remained unknown and served as the goal for the present study.
Here, we optimized conditions for legiobactin expression and developed a bioassay for the siderophore. Then, we identified two L. pneumophila genes, lbtA and lbtB, which are highly related to hydroxamate synthetases and permeases, respectively, of the major facilitator superfamily (MFS) class of proton motive force-dependent membrane efflux pumps. Mutational analysis revealed that lbtA and lbtB are required for optimal legiobactin production and as such represent our first insight into the genetics of Legionella siderophore expression.
|
|
|---|
and DH5
pir were used as hosts for recombinant plasmids (Invitrogen, Carlsbad, Calif.). |
View this table: [in a new window] |
TABLE 1. lbtA, frgA, CAS reactivity, and feoB bioassay activity in Legionella strainsa
|
In order to assess siderophore production, legionellae were typically grown in CDM that lacked its iron component (39). The iron-deplete CDM was made using water that had been deferrated by passage through a Chelex-100 (Bio-Rad, Laboratories, Hercules, Calif.) column (15). The deferration of media was confirmed by the ferrozine assay (data not shown) (78). To further control the amount of iron in media, acid-washed glassware was used (15). To monitor the general extracellular growth capacity of L. pneumophila strains, bacteria grown on BCYE agar were inoculated into BYE broth, and the optical density of the resulting cultures was determined at 660 nm (OD660) (35, 63, 81). To assess extracellular growth under iron-limiting conditions, L. pneumophila was inoculated into either BYE broth that lacked its iron supplement, Chelex-treated BYE broth, deferrated CDM, or deferrated CDM with 10 µM to 2 mM citrate, 5 to 30 µM deferoxamine mesylate (DFX) or 5 to 30 µM ethylenediamine di(o-hydroxyphenylacetic acid) (EDDA) and then the OD660 of the cultures was monitored (63, 82). To examine growth and survival on iron-limited solid media, legionellae were tested for their ability to form colonies on BCYE agar that lacked its iron supplement (63). In addition, we tested L. pneumophila strains for their capacity to form colonies within nonsupplemented BCYE agar that had been made even more iron limited by the inclusion of 100 to 400 µM 2,2'-dipyridyl (DIP).
Siderophore assays. Legionella culture supernatants were tested for siderophore activity using the CAS assay as previously described (39, 56, 75). Supernatants were also tested for catecholate and hydroxamate structures by the Arnow and Csáky assays (3, 16, 39, 56, 70). DFX was the standard for the CAS and Csáky assays, while 2,3-dihydroxybenzoic acid served that role for the Arnow procedure (39, 56). Low-molecular-weight fractions were obtained by passage of supernatants through Centricon filters (Millipore, Bedford, Mass.) having a 3-kDa size limit. The heat and protease susceptibility of the Legionella CAS reactivity were determined by either boiling for 5 min or incubation with proteinase K at 1 mg/ml for 3 h at 37°C (39).
Bioassays for L. pneumophila siderophores. CAS-positive supernatants were tested for their ability to promote the growth of either wild-type 130b in non-iron-supplemented BCYE agar containing 100 to 600 µM of the iron chelator DIP or feoB mutant bacteria on non-iron-supplemented BCYE agar. To obtain the CAS-positive samples, strain 130b was grown in BYE to log phase (i.e., OD660 of 1.0), washed, and then inoculated into 20 ml of deferrated CDM to an OD660 of 0.25. After 20 h of incubation, a period of time sufficient to yield significant CAS reactivity (39), the culture was centrifuged at 3,000 rpm in a Beckman J2-21 for 10 min, and the supernatants were collected and passed through a 0.2-µm filter (Millipore, Bedford, Mass.).
To obtain a low-molecular-weight fraction, 2 ml of the sterile supernatant was passed through a 3-kDa-cutoff Centricon filter. To finally assess growth-stimulating activity, 50 µl of the sample was placed into a well cut out of the center of either the DIP-containing BCYE seeded with 104 CFU per ml of wild type or the non-iron-supplemented BCYE agar unto which had been spread 105 CFU of the feoB mutant. As a positive control, we tested the stimulatory activity of 50 µl of 10 mM FeCl3 (in water). For negative controls, we monitored growth around wells containing 50 µl of either deferrated CDM or a <3-kDa fraction obtained from a CAS-negative supernatant of strain 130b.
To obtain the CAS-negative fraction, 130b bacteria were grown in BYE to stationary phase (OD660 of 2.1), inoculated into deferrated CDM to an OD660 of 0.25, and then incubated for 20 h (39). The growth of the wild-type bacteria was observed upon incubation at room temperature, whereas the feoB mutant plates were examined at 37°C. To assess the direct growth-stimulating ability of L. pneumophila strains and other Legionella species, legionellae were grown on non-iron-supplemented BCYE agar at 37°C for 2 to 3 days and spotted with a sterile stick onto non-iron-supplemented BCYE agar with or without 2 mM isopropylthiogalactopyranoside (IPTG) onto which had been spread 105 CFU of the feoB mutant. The plates were then incubated and examined.
DNA isolation and sequencing analysis. DNA was isolated from L. pneumophila as described previously (12). DNA sequencing was done by the Northwestern Biotech Laboratory. Primers were obtained from Integrated DNA Technologies (Coralville, IA). Nucleotide sequences were analyzed with Seqman (DNAStar; Madison, WI), and BLAST homology searches were conducted through GenBank at the National Center for Biotechnology Information. Protein alignments were performed by the BCM Search Launcher: Multiple Sequence Alignments (http://searchlauncher.bcm.tmc.edu/multi align/multi-align.html); and Boxshade 3.21 (http://www.ch.embnet.org/software/BOX_form.html). DNA motifs and structural analyses were conducted using the Prosite prediction model (http://us.expasy.org/prosite) and SOSUI program (http://sosui.proteome.bio.tuat.ac.jp).
RT-PCR analysis of L. pneumophila gene expression. Reverse transcription (RT)-PCR was performed as before (42, 82). Legionella RNA was isolated from CDM-cultured bacteria or L. pneumophila-infected macrophages using RNA STAT-60 (TEL-TEST B, Inc, Friendswood, TX). Primers MIP1-F (5'-AAAGGCATGCAAGACGCTAA) and MIP1-R (5'-GTATCCGATTTTCCGGGTTT) were used to amplify a 260-bp internal fragment of mip (11) and LBTA-F (5'CATTTGATCGATGGCCTCTT) and LBTA-R (5'-GCGCGGAAATTAGGATGATA) were used to amplify a 226-bp fragment of lbtA. Control experiments in which the reverse transcriptase enzyme was omitted from the reaction were performed to rule out contributions of contaminating DNA in the DNase-treated RNA samples. These controls were performed with lbtA primers described above.
Mutation and complementation analysis. To obtain a mutated lbtA gene with a kanamycin resistance (Kmr) or gentamicin resistance (Gmr) marker, an internal fragment of the L. pneumophila strain 130b lbtA gene was amplified by PCR using primers LBTA9-F (5'-ATACTGCCATAGCATCGGG) and LBTA8-R (5'-TTTTCAAAAACTGACCTGA). The resultant 2-kb DNA fragment was then cloned into pGemTeasy (Promega, Madison, WI), to give plasmid pVK120. The cloned L. pneumophila lbtA was mutated by deletion of a 51-bp fragment at the two MfeI sites, the first located 563 bp from the lbtA start site of pVK120 and following Klenow treatment, the insertion of either a 1.1-kb Kmr gene isolated from pMB2190 upon HincII digestion (31) to yield pVK121 or a Gmr gene isolated from pX1918G after HincII and PvuII digestion (69) to give pKA7.
The mutated Kmr lbtA gene was then cloned on a 3.3-kb SacI-SphI fragment from pVK121 into the counterselectable pBOC20, to yield pVK122. The chloramphenicol-resistant (Cmr) pBOC20 is a ColE1 replicon that facilitates allelic exchange in L. pneumophila by virtue of its sacB gene (49). The mutated Gmr lbtA gene was also cloned on a 3.3-kb SacI-SphI fragment into the counterselectable pRE112, to give pKA11. The pRE112 suicide vector has a conditional R6K ori that requires the
protein to replicate (21).
In addition, an unmarked, nonpolar lbtA deletion mutant was constructed. In this case, the lbtA gene was cloned on a 2.1-kb KpnI-XbaI fragment from pVK120 into pBluescriptII KS(+) (Stratagene, La Jolla, Calif.), to give plasmid pKA2. The cloned lbtA gene was mutated by removal of a 626-bp MfeI-BglII fragment, 563 bp from the lbtA start site, blunted by T4 polymerase and religated to give plasmid pKA16. The mutated lbtA gene was then cloned on a 1.4-kb KpnI-XbaI fragment into the counterselectable pRE112, to yield pKA17.
To obtain a mutated lbtB gene with a Gmr marker, an internal fragment of the L. pneumophila strain 130b with the lbtBC genes was amplified by PCR using primers LBTA7-F (5'-GCCACGAATTGAGTGATCT) and LBTC1-R (GACTGGAGGTGATACGGAAT). The resultant 2-kb DNA fragment was then cloned into pGemTeasy to give plasmid pKA4. The cloned L. pneumophila lbtB was mutated by insertion of a 1.1-kb Gmr gene on a HincII-PvuII fragment from PX1918G at the T4 polymerase-treated HindIII site of pKA4, 440 bp from the start site, resulting in pKA8. Mutated lbtB was then cloned on a 4.4-kb SacI-SphI fragment into pRE112, to yield pKA12. The mutated lbtC gene was obtained by inserting the same Gmr gene at the T4 polymerase-treated KpnI site of pKA4, 739 bp from the gene's start site, resulting in pKA9.
Multiple lbtC mutants were obtained through natural transformation of 130b with pKA9. Plasmid pKA11 was also used to construct lbtA frgA and lbtA pvcA double mutants. The lbtA frgA double mutant was constructed by introducing the lbtA::Gmr on pKA11 into the previously described Kmr NU229. Attempts to make an lbtA feoB double mutant were carried out by introducing pKA11 into the Kmr NU269 in the presence or absence of legiobactin-containing supernatant. To obtain a mutated pvcA and pvcB, a fragment containing pvcA and pvcB was amplified by PCR from 130b with primers PVCA9-F (5'-CGATAGTGACTCTGCTATGG) and PVCB6-R (5'-GGCAAGAGTCGTAAGACATC). The resultant 2.3-kb DNA fragment was then cloned into pGemTeasy to give plasmid pJSA1.
The cloned pvcA was mutated by the insertion of a Kmr gene PCR amplified from pVK3 (81) using primers USKanBam2 (5'-CGCGGATCCAAGCCACGTTGTGTCTCA) and DSKanBam2 (5'-CGCGGATCCAGAAGGTGTTGCTGACTCAT) at the first BglII-digested site of pJSA1 after a 34-bp deletion, to give pJS5. A mutated pvcB gene was generated by insertion of the PCR-amplified Kmr gene after BamHI digestion of pJSA1, to give plasmid pJA6. Multiple pvcA and pvcB mutants were obtained by natural transformation of 130b with pJS5 and pJS6, respectively (25, 77). The lbtA pvcA double mutant was constructed in the Kmr pvcA background by introducing pKA11 with lbtA::Gmr.
Production of competent 130b, NU229, lbtA, lbtB, and pvcA mutant cells and electroporation of pVK122, pKA17, pKA12, and pKA11 into L. pneumophila were achieved as previously described (12, 63). Potential mutants were selected based on Cm sensitivity, sucrose resistance, Km resistance (pVK122), and Gm resistance (pKA11 and pKA12) indicative of the introduction of the mutated gene into the 130b, NU229, or pvcA mutant chromosome by homologous recombination. Verification of the Kmr lbtA mutant genotype was carried out by PCR and Southern hybridization, using the same primers and DNA probe used to identify pVK122 (LBTA9-F and LBTA8-R). The lbtA deletion and double mutant phenotypes were verified by PCR using the same primers to identify lbtA on pVK122, pKA11, and pKA17. The lbtB and lbtC mutant phenotypes were verified by PCR with primers LBTA7-F and LBTB1-R (5'-ACTAATGATGGCAAGGCTGG) (lbtB) and LBTA7-F and LBTC1-R (lbtC). The pvcA and pvcB mutants were verified by PCR and Southern hybridization with the same primers used to identify pJSA1.
To facilitate complementation, a 2.1-kb KpnI-XbaI-digested fragment containing only the lbtA gene with its endogenous promoter was obtained from pKA2 and cloned under control of the tac promoter in pMMB2002 (65) to yield plbtA. For complementation of the lbtB mutants, a 1.6-kb fragment containing only the lbtB gene was amplified by PCR from L. pneumophila 130b DNA using primers LBTA7-F and LBTB1-R and cloned into pGemTeasy (Promega; Madison, WI) to yield pKA14. Finally, the wild-type lbtB gene was cloned on a 1.7-kb SacI-SphI fragment from pKA14 into pMMB2002 under the control of the tac promoter to yield plbtB. Complementation with plbtB was obtained when lbtB was under the control of the tac promoter and induced with 2 mM IPTG (68). Plasmids were electroporated into L. pneumophila strains as previously described (41).
Infection assays. To examine the ability of L. pneumophila to grow intracellularly, Hartmannella vermiformis amoebae and human U937 cells were infected as previously described (2, 12, 63, 65). Infection of iron-depleted macrophages and amoebae was accomplished by the addition of 10 to 40 µM DIP or 10 to 160 µM DFX to the medium for 24 h prior to infection with L. pneumophila and/or during the incubation period (7, 28, 59, 63, 81, 82). We observed that as much as 160 µM DFX and 35 µM DIP in H. vermiformis cocultures and 5 µM DFX and 20 µM DIP in U937 macrophages had no effect on the growth of 130b (data not shown). To assess the virulence of bacteria, competition assays were done following intratracheal inoculation of A/J mice, as described previously (63-65).
Southern hybridization analysis.
Southern blots were carried out using EcoRI-restricted DNA from strains representing several L. pneumophila serogroups and a variety of Legionella spp. A digoxigenin nonradioactive labeling and detection system was used (Roche Molecular Biochemicals, Indianapolis, IN). The lbtA probe was produced by PCR incorporation according to the manufacturer's recommendations using primers LBTA1-F (5'-GCAGCACTTCGTGAAGGAT) and LBTA4-R (TAGGTACAGCAAGGCTTGC) and 130b DNA as a template. The frgA probe was generated by restriction digest of plasmid pEH44 and labeling as previously described (35). High-stringency washes (0 to 10% base pair mismatch) were employed for hybridization to L. pneumophila DNAs and low-stringency washes (
30% base pair mismatch) were used for hybridization to genomic DNA from other Legionella spp (35).
Nucleotide sequence accession number. The NCBI and GenBank accession number for the L. pneumophila lbtA gene is DQ118422.
|
|
|---|
900 µM net DFX equivalents, with the highest values approaching 1,500 µM equivalents. The ability of strain 130b to elaborate CAS reactivity that was <3 kDa and heat- and protease-resistant still required the use of log-phase inocula. The increased level of siderophore activity observed in deferrated cultures was not associated with the expression of an Arnow- or Csáky-reactive material, suggesting that it is not due to turn-on of a "typical" catecholate or hydroxamate siderophore.
Mixtures of supernatants with siderophores DFX and DHB retained positivity in the structural assays, indicating L. pneumophila is not elaborating a substance that interferes with siderophore recognition. Since cysteine is reactive in the CAS assay (40), we optimized the detection of legiobactin by replacing the cysteine in deferrated CDM with cystine, a substance that is not CAS reactive (40). Supernatants obtained from cystine-containing cultures consistently displayed
900 µM DFX equivalents while having no background reactivity (data not shown). Thus, all subsequent legiobactin determinations were made using cystine-containing deferrated CDM and are presented as net DFX equivalents.
To better understand the kinetics of legiobactin production, we examined strain 130b cultures for CAS reactivity at multiple early time points (Fig. 1). Legiobactin expression was detectable as early as mid-log phase, and the level of siderophore increased within the culture until stationary phase was established and then it declined. The decline in CAS reactivity appeared to be due to the action of the bacteria; i.e., filter-sterilized supernatants obtained at 24 h of incubation maintained full CAS reactivity even when stored 37°C (data not shown). This suggests that stationary-phase L. pneumophila may degrade and/or not recycle legiobactin. Given the clear coincidence of CAS reactivity with the most active stage of bacterial growth, legiobactin is likely an enhancer of L. pneumophila replication in low-iron conditions.
![]() View larger version (13K): [in a new window] |
FIG. 1. Kinetics of siderophore production by L. pneumophila. Strain 130b bacteria were grown in BYE to an OD660 of 1.0, washed, and then inoculated into deferrated CDM to an OD660 of 0.2. Over the next day, the growth of the cultures was monitored spectrophotometrically (left y axis), and the CAS reactivity of culture supernatants, reported as net DFX equivalents, was examined (right y axis). The values presented are the means and standard deviations from triplicate cultures. The CAS reactivity of the cultures was significantly above the medium control at all times of incubation (P < 0.05; Student's t test). The results are characteristic of three independent experiments.
|
![]() View larger version (14K): [in a new window] |
FIG. 2. Effect of temperature on L. pneumophila siderophore expression. Strain 130b bacteria were grown at 37°C in BYE to an OD660 of 1.0, washed, and then inoculated into deferrated CDM to an OD660 of 0.2. Over the next 3 days, one set of cultures was incubated at room temperature ( ), and another set at 37°C ( ). At various time points, the growth of the cultures was monitored spectrophotometrically (top), and the CAS reactivity of culture supernatants was examined (bottom). The values presented represent the means and standard deviations from duplicate cultures. The CAS reactivity of the room temperature cultures was significantly different from that of the 37°C cultures at all times of incubation, except at 40 h (P < 0.05; Student's t test). The results presented are representative of four independent experiments.
|
100 µM (Fig. 3A). As expected, bacteria did grow in the DIP-containing medium, if a solution of 10 mM ferric chloride was placed into a well cut out of the agar (Fig. 3A).
![]() View larger version (44K): [in a new window] |
FIG. 3. Biological activities associated with legiobactin. (A) 104 CFU of wild-type strain 130b were inoculated into non-iron-supplemented BCYE agar (leftmost plate) or non-iron-supplemented BCYE agar containing 600 µM DIP (four rightmost plates), and a center well was filled, as indicated, with 50 µl of either deferrated CDM, 10 mM FeCl3, or the <3-kDa fraction from a CAS-negative (i.e., 194 µM DFX equivalents) or CAS-positive (i.e., 1,100 µM DFX equivalents) supernatant of strain 130b. After 21 days of incubation at room temperature, the growth of the bacteria was recorded. (B) We plated 105 CFU of feoB mutant bacteria onto the surface of standard (i.e., iron-supplemented) BCYE agar (leftmost plate) or non-iron-supplemented BCYE agar (four rightmost plates), and a center well was filled, as indicated above, with either deferrated CDM, FeCl3, or a CAS-negative or CAS-positive supernatant fraction. After 5 days of incubation at 37°C, the growth of the bacteria was recorded. The results presented for each type of bioassay are representative of at least three independent experiments.
|
Identification of an L. pneumophila gene, lbtA, that is required for legiobactin production. Since our frgA and ira mutants (59) continued to display wild-type levels of growth and CAS reactivity when cultured in deferrated, cystine-containing CDM (data not shown), it appeared that previously unrecognized genes encode legiobactin. While performing inverse PCR (42, 82) to characterize the nature of the mini-Tn10 insertions in the ira mutants, a primer (i.e., 5'-GGCTCACGATGGCACTTG-3') that had been designed to facilitate the analysis of strain NU223 amplified, without the assistance of a second primer, a 1.5-kb fragment from 130b DNA. Sequence analysis of the PCR fragment identified an incomplete open reading frame whose predicted product appeared to have homology with the carboxyl end of FrgA.
Subsequent examination of what was, at the time, the unfinished genome database of L. pneumophila revealed the presence of a similar open reading frame within strain Philadelphia-1. Using PCR primers based upon sequences in the database, a
2-kb DNA fragment, predicted to contain the entire open reading frame, was amplified from strain 130b. Complete sequence analysis of the amplified fragment confirmed the existence of an L. pneumophila 1.74-kb gene, whose 63.8-kDa predicted product was 36% identical and 51% similar to the 63.3-kDa FrgA. On the basis of mutational analysis that is to be discussed below, we named this gene lbtA, for legiobactin gene A.
In addition to FrgA, the LbtA protein was related to several siderophore synthetases; e.g., it showed 23% identity and 40% similarity to IucA and 26% identity and 44% similarity to IucC (19). The significance of the homology between LbtA and other siderophore biosynthetic enzymes is similar to the 21% identity and 47% similarity between IucA and IucC (44). In addition, the 580-amino-acid LbtA aligned with and was comparable in size to the hydroxamate synthetases; e.g., it was predicted to have the same number of amino acids as IucC. The only known proteins to which the Legionella protein had significant homology were the enzymes involved in siderophore production. Further computer program analysis of the predicted protein showed an absence of transmembrane domains and secretion signals, suggesting that it is a cytosolic protein.
Given that L. pneumophila controls iron-regulated genes through Fur (34, 35), we looked for Fur boxes in the promoter region of lbtA. Two overlapping Fur boxes (5'-GCAAATGATAATCATTATC and 5'-GATAATCATTATCATTTAT) were identified that had only two mismatches to the L. pneumophila frgA Fur boxes (35). These data suggest that lbtA, like frgA and legiobactin, is subject to iron repression. Indeed, using RT-PCR, we saw that lbtA mRNA levels appeared greater in L. pneumophila 130b grown in deferrated CDM than in bacteria grown in iron-supplemented CDM (Fig. 4A).
![]() View larger version (34K): [in a new window] |
FIG. 4. Extra- and intracellular expression of L. pneumophila lbtA. (A) Wild-type 130b was grown on non-iron-supplemented BCYE agar for 3 days, subcultured into BYE lacking the iron supplement, and grown to an OD660 of 1.0. Bacteria were then inoculated into deferrated CDM (CDM-Fe) or CDM supplemented with 20 µM FeCl3 (CDM+Fe) at an OD660 of 0.3 and incubated at 37°C. Bacteria were harvested at mid-log phase and the RNA was isolated. RT-PCR was performed to detect mip (M) and lbtA (L) transcripts. Lanes N, negative controls for DNA contamination performed without reverse transcriptase. (B) Bacteria were grown as in A in BYE-Fe to an OD660 of 1.0. U937 cells were infected with log-phase bacteria and RNA was isolated from infected cells at 24, 48, and 72 h postinoculation. Between 0 and 24 h postinoculation, the numbers of legionellae increased 1,000-fold, and then between 24 and 72 h postinoculation, the numbers increased another 10-fold. Lane denotation is the same as in A. lbtA was also expressed intracellularly when a stationary-phase inoculum was used (data not shown). The results presented are representative of at least two independent experiments. RT-PCR products were electrophoresed through 1.5% agarose and stained with ethidium bromide.
|
![]() View larger version (33K): [in a new window] |
FIG. 5. Siderophore production by L. pneumophila wild type and lbtA and lbtB mutants. (A) (Left panel) Wild-type130b with pMMB2002 ( ) or plbtA ( ) and lbtA deletion mutant NU302 with pMMB2002 ( ) or plbtA ( ) were grown in BYE to an OD660 of 1.0, inoculated into deferrated CDM to an OD660 of 0.3, and then incubated at 37°C. At various times, the growth of the cultures was monitored spectrophotometrically (data not shown), and the CAS reactivity of supernatants was examined. The CAS values presented represent the means and standard deviations from duplicate cultures. The CAS reactivity of the mutant was significantly different from that of the complemented mutant at all time points and wild-type cultures up to 22 h postinoculation (P < 0.05; Student's t test). The results presented are representative of at least three independent experiments. (Right panel) We plated 105 CFU of feoB mutant bacteria onto the surface of non-iron-supplemented BCYE agar and a center well was filled with either a <3-kDa supernatant fraction from the lbtA mutant NU302 or a <3-kDa supernatant fraction from the complemented mutant NU302(plbtA). After 5 days of incubation at 37°C, the growth of the bacteria was recorded. The results presented are representative of at least three independent experiments. (B) (Left panel) Wild-type130b with pMMB2002 ( ) or plbtB ( ) and lbtB mutant NU303 with pMMB2002 ( ) or plbtB ( ) were inoculated into deferrated CDM containing 2 mM IPTG and then assayed for CAS reactivity as described in (A). The CAS reactivity of the mutant's cultures was significantly different from that of the wild-type and complemented mutant cultures, until 44 h (P < 0.05; Student's t test). The results presented are representative of at least four independent experiments. (Right panel) A <3-kDa supernatant fraction from the lbtB mutant and the complemented mutant NU303(plbtB) were tested in the feoB bioassay as indicated in A, with the results being representative of three independent experiments.
|
Identification of a second gene, lbtB, involved in legiobactin expression. According to the completed genomes of L. pneumophila strains Philadelphia-1, Paris, and Lens (8, 9), lbtA is the first gene in a three-gene operon. The two genes downstream of lbtA are predicted to encode members of the MFS class of proton motive force-dependent membrane efflux pumps. The second gene in the operon, which we now designate lbtB, is a 1.2-kb gene that encodes a 44.4-kDa protein with 12 transmembrane (TMS) domains that is 23% identical and 44% similar to the E. coli bicyclomycin resistance protein Bcr and 21% identical and 39% similar to the E. coli tetracycline efflux pump TetA.
The homology between LbtB and these proteins is greatest in five of the amino acid motifs conserved among MFS transporters, i.e., motifs A, B, C, D, and G (Fig. 6). Recently, members of the MFS family have been shown to include transporters involved in the export of bacterial siderophores, such as the E. coli enterobactin exporter EntS (27). The last gene in the lbt operon, lbtC, encodes a 42.5-kDa protein with 12 predicted transmembrane domains that is related to LbtB and Bcr (data not shown). Given these data, we suspected that lbtB and lbtC are involved in legiobactin export.
![]() View larger version (82K): [in a new window] |
FIG. 6. Amino acid sequence alignments of L. pneumophila LbtB with E. coli Bcr and TetA. The consensus sequences for conserved motifs A, B, C, D, G are labeled above the boxed-in areas; x is any amino acid, upper case is a highly conserved amino acid, and lower case is a conserved, but variable amino acid. Motif A, conserved in both 12- and 14-TMS families, is located in the cytoplasmic loop between TMS 2 and TMS 3 and may be involved in substrate binding as well as opening and closing of the channel (54). Motif B, located in TMS 4, is predicted to be involved in proton transfer (55). Motif C, located in TMS 5, is implicated in the direction of transport and is only found in those transport proteins with efflux capacity (30, 55). The function of motif D, located in TMS 1 in 12- and 14- TMS families, has not been investigated. Motif G, located in TMS 11, is found only in 12-TMS families, although its function is unknown (55).
|
Providing lbtB in trans to the wild type results in an almost twofold reduction in the amount of CAS reactivity detected in CDM supernatants. This does not occur in the lbtB mutant; reintroducing lbtB in this background only restores siderophore expression to normal wild-type levels. Since the lbtB mutant bears an insertion that may have downstream effects on lbtC expression, "excess" LbtB in the presence of "normal levels" of LbtC may have deleterious effects on siderophore excretion. Overall, these data confirm that LbtB is required for legiobactin expression.
Next, a role for lbtC in legiobactin production was assessed by introducing a mutation into the gene. Two mutants, NU305 and NU306, containing a 1.1-kb Gmr insertion in lbtC were obtained (data not shown). Both mutants grew normally on standard BCYE agar and in standard BYE broth (data not shown), indicating that lbtC is not generally required for extracellular growth. However, the lbtC mutants produced wild-type levels of legiobactin (data not shown), ruling out a required role for lbtC in legiobactin expression.
Since supernatants from lbtA and lbtB mutants had similar reductions in CAS reactivity and bioactivity, we believe that both lbtA and lbtB are required for optimal siderophore production by strain 130b. However, phenotypic differences between lbtA mutant NU300 and lbtB mutant NU303 were seen when the bacteria, as opposed to supernatants, were assessed in the feoB mutant bioassay (Fig. 7). When spotted atop the feoB mutant, 130b bacteria containing either vector pMMB2002, plbtA, or plbtB supported the growth of the iron-starved mutant. In keeping with the results obtained with supernatants, the lbtA mutant NU300 only stimulated growth if it contained plbtA (Fig. 7). In contrast, NU303 retained an ability to promote growth of the mutant regardless of recombinant plasmid content, suggesting that, unlike the lbtA mutant, the lbtB mutant still produces legiobactin. Indeed, the homology of lbtB with MFS exporters implies a role for LbtB in legiobactin export and not biosynthesis. We suspect that when the lbtB mutant is grown on the low-iron agar media, some cellular lysis occurs and released legiobactin stimulates the feoB mutant to grow, and the inability of NU303 supernatants to likewise promote growth is likely due to a dilution and/or breakdown of siderophore in the broth.
![]() View larger version (20K): [in a new window] |
FIG. 7. Phenotypes of lbt mutant bacteria in the feoB bioassay. 105 CFU of feoB mutant bacteria were plated unto the surface of non-iron-supplemented BCYE agar containing 2 mM IPTG, and then 130b, lbtA mutant NU300, or lbtB mutant NU303 containing either vector pMMB2002, plbtA, or plbtB was spotted on top of the agar as indicated. After 5 days of incubation at 37°C, the growth of the bacteria was recorded. The results presented are representative of three independent experiments.
|
However, it remained possible that increases in CAS reactivity due to legiobactin could have been masking a loss of a siderophore activity associated with FrgA or PvcAB. Thus, we constructed and characterized lbtA frgA double mutants (NU311 and NU312) and lbtA pvcA double mutants (NU313 and NU314). Both types of double mutants were identical to the lbtA single mutants in the CAS assay and the feoB bioassay (data not shown), showing that frgA and pvcAB are not required for wild-type CAS reactivity or the residual CAS activity of lbtA mutants. Further BlastP searches of the L. pneumophila genome using known siderophore biosynthetic, transport, and receptor proteins, as well as an examination of the annotation of the L. pneumophila genome did not reveal any other candidate siderophore genes. Given these various data, we focused on determining the importance of lbtAB for L. pneumophila growth.
Role of lbtA in L. pneumophila extracellular growth. lbt mutants NU300, NU302, and NU303 grew in deferrated CDM as well as did the wild type (data not shown), suggesting that lbtA and lbtB, though necessary for full siderophore expression, may not be required for extracellular growth in iron-deplete conditions, even though lbtA is expressed in low-iron CDM. Mutant NU302 also grew normally in BYE broth or on BCYE agar that lacked their iron supplements, on unsupplemented BCYE agar that contained 100 to 400 µM DIP, and in deferrated CDM with 5 to 30 µM EDDA or DFX (data not shown). These data suggested that the affinity of legiobactin for iron might be less than 1031, as the stability constants (Ks) for DFX-iron(III) and EDDA-iron(III) are 1031and 1034, respectively (48, 72).
Therefore, to identify a requirement for legiobactin, we investigated bacterial growth in deferrated CDM containing citrate, a chelator with a notably lower affinity for iron(III), 1011 (72). Indeed, when grown in deferrated CDM supplemented with 1 mM citrate, NU302 showed modestly reduced growth at 8 to 44 h postinoculation, and this defect was fully complemented by reintroducing lbtA into the mutant on plbtA (Fig. 8A). When the lbtA mutant was grown in the presence of citrate, including chelator levels that were not inhibitory to bacterial growth, it produced increasing amounts of CAS reactivity, eventually achieving a degree of reactivity that rivaled the wild-type level (Fig. 8B). This could represent the upregulation of the residual CAS activity found in lbtA supernatants or the production of a new CAS reactive substance. However, the mutant supernatants continued to be inactive in the feoB bioassay and negative in the Csáky and Arnow assays, indicating that the heightened CAS reactivity was not due to the turning on of a typical hydroxamate or catecholate. In summary, L. pneumophila can replicate in a variety of low-iron conditions in the absence of lbtA, but legiobactin is beneficial for growth under conditions of severe iron limitation when residual iron is not sequestered by a chelator(s) of extraordinarily high affinity.
![]() View larger version (24K): [in a new window] |
FIG. 8. Growth of wild-type and lbtA mutant L. pneumophila in deferrated CDM containing citrate. (A) 130b with pMMB2002 () and NU302 with pMMB2002 ( ) or plbtA ( ) were grown in BYE to an OD660 of 1.0, inoculated into deferrated CDM with 1 mM citrate to an OD660 of 0.3, and then incubated at 37°C. At various times, the growth of the cultures was monitored spectrophotometrically. The growth of NU302 was different from that of the wild type and complemented mutant from 8 to 44 h (P < 0.05; Student's t test). (B) L. pneumophila strains were grown in deferrated CDM containing the indicated amounts of citrate, and then, at 44 h, the CAS reactivity of supernatants from 130b (black bars), NU302 (striped bars), and NU302(plbtA) (gray bars) was examined. The values represent the means and standard deviations from duplicate cultures. The CAS reactivity of NU302 was significantly different from that of the wild type and complemented mutant in 0 and 0.4 mM citrate-containing cultures (P < 0.05; Student's t test). When the citrate-associated CAS activity was normalized across cultures, more CAS reactivity was detected in citrate-containing NU302 supernatants than in non-citrate-containing NU302 supernatants (P < 0.05; Student's t test). The results presented in this figure are representative of two independent experiments.
|
However, RT-PCR experiments demonstrated that lbtA is expressed by L. pneumophila when growing within U937 cells (Fig. 4B). We were unable to obtain an lbtA feoB double mutant of strain 130b, whose isolation might have uncovered an intracellular role for a siderophore as it has in studies of Shigella (67). Next, a competition assay was performed in A/J mice (5, 63-65). However, the ratio of wild type to mutant in the mouse lung did not change significantly during the 3-day course of the experiment (data not shown), suggesting that lbtA and legiobactin are not required for L. pneumophila growth in the lungs of A/J mice.
Distribution of lbtA in L. pneumophila serogroups and in other Legionella species. The L. pneumophila species consists of 15 serogroups (24). Our analysis of strain 130b as well as the data contained within the Philadelphia-1, Paris, and Lens genomic databases indicates that lbtA is present within L. pneumophila serogroup 1. Southern hybridization analysis determined that lbtA is also in strains representing serogroups 2 to 5, 7, 8, 13, and 14 (Table 1). All strains that were found to contain lbtA produce CAS reactivity when grown in iron-deplete CDM (39), supporting a correlation between the presence of lbtA and legiobactin production in L. pneumophila.
The Legionella genus contains 49 species, in addition to L. pneumophila (24, 53). DNAs from most (i.e., 20 out of 27) species tested hybridized with the lbtA probe (Table 1). In agreement with the results of our earlier study (35), frgA was nearly absent from Legionella species other than L. pneumophila (Table 1). Thus, lbtA, unlike frgA, appears to be present within most species of Legionella, including strains isolated from clinical and environmental sources. Most Legionella species tested secrete a siderophore-like activity (75) (Table 1). Fifteen of these 18 CAS-positive species contained lbtA, suggesting that they may produce legiobactin or a related siderophore (Table 1). However, only L. adelaidensis, L. anisa, L. erythra, L. feeleii, L. moravica, L. rubrilucens, and L. santicrusis stimulated L. pneumophila feoB mutant growth when tested in the bioassay, suggesting that they, more so than the others, express legiobactin.
Among the CAS-positive species, L. birminghamensis, L. londiniensis, and L. quinlivanii did not contain lbtA and were negative in the feoB bioassay (Table 1), indicating that lbtA-dependent legiobactin is not the only Legionella siderophore. Although not previously believed to have a siderophore activity (75), L. oakridgensis rescued feoB mutant growth in the bioassay (Table 1).
In summary, lbtA sequences were broadly distributed within the L. pneumophila genus. In all L. pneumophila strains and most other Legionella species tested, the presence of lbtA correlated with CAS reactivity. However, there were examples of both siderophore activity in the absence of lbtA and lack of siderophore expression despite the presence of lbtA.
|
|
|---|
1020 (60).
Formally, the reduction in CAS reactivity displayed by the lbtA mutants could be due to alterations in siderophore biosynthesis or secretion. However, since LbtA is related to biosynthetic enzymes and does not contain any transmembrane domains or secretion signals, we suspect that LbtA is involved in the biosynthesis of legiobactin rather than siderophore export. The reactions catalyzed by the LbtA-related enzymes can give clues to the possible LbtA-mediated reaction. In E. coli, IucA catalyzes the addition of N'-acetyl-N'-hydroxylysine to citrate by formation of an amide bond to yield the intermediate N
-citryl-'-acetyl-N'-hydroxylysine, and subsequently, IucC adds another N'-acetyl-N'-hydroxylysine moiety to the intermediate to form aerobactin (19).
In S. meliloti, it is believed that RhbC catalyzes the addition of N4-acetyl-N4-hydroxy-1-aminopropane to citrate to yield an intermediate to which RhbF then adds N4-acetyl-N4-hydroxy-1-aminopropane to form the immediate precursor to rhizobactin 1021 (43). Although these enzymes catalyze the formation of hydroxamate siderophores, and L. pneumophila is negative in the Csáky assay that detects hydroxamates, recent work in bacteria that produce polyhydroxycarboxylate siderophores has elucidated biosynthesis genes homologous with aerobactin iuc genes (18, 80). For example, although the structure of staphylobactin is unknown, the SbeE protein, like LbtA, is essential for siderophore production and is homologous with IucA (17). Similarly, vibrioferrin proteins PvsB and PvsD are homologous with IucC and IucA; these enzymes catalyze the formation of the two amide bonds contained in vibrioferrin (80). Given the relatedness of LbtA with synthetases of diverse siderophores, a simplest hypothesis is that legiobactin assembly involves an LbtA-catalyzed amide bond formation between precursors.
Despite the extensive understanding of siderophore import, only recently have determinants of siderophore export been identified (4, 26, 27, 38, 50, 58, 85). For example, ExiT, an ATP-binding cassette-like transporter, has been found in Mycobacterium smegmatis, and in Pseudomonas aeruginosa the RND efflux pump, OprM, is implicated in siderophore export (38, 58, 85). However, most of the identified exporters are members of the MFS family, a group of proteins historically viewed as transporting small solutes, such as antibiotics (51). The known MFS members involved in siderophore export include proteins that are required for export of enterobactin in E. coli (EntS), protochelin in Azotobacter vinelandii (CbsX), achromabactin in E. chrysanthemi (YhcA), and alcaligin in Bordetella species (AlcS) (4, 26, 27, 50). These siderophore export proteins constitute the inner membrane channels that facilitate export of the siderophore out of the cytoplasm and into the periplasm. Following the example of antibiotic export in gram-negative bacteria (84), it is likely that the MFS siderophore exporters recruit outer membrane protein channels to excrete the siderophore out of the cell (4, 26, 27, 50). Due to the relatedness of LbtB with MFS permeases, its predicted inner membrane localization, and the partial growth-promoting ability of lbtB mutants, we suspect LbtB to be the latest MFS protein involved in siderophore export.
While many bacteria organize their siderophore-encoding genes into large operons containing multiple biosynthetic genes and often a ferrisiderophore receptor gene, the lbt system may encode only three genes, and perhaps only one required biosynthetic and one required transport gene. The wild-type phenotype of the L. pneumophila mutants lacking lbtC, the last gene in the lbt operon, is similar to that of Yersinia pestis ybtX mutants that secrete siderophore despite their loss of a gene encoding an MFS family member (23). Given that we have thus far not identified other candidate legiobactin genes linked or unlinked to lbtABC, the biosynthesis of legiobactin may be uniquely simple, perhaps involving only LbtA and one or two precursor molecules. Alternatively, other L. pneumophila legiobactin genes exist but they would appear to be unusual in content and location. Interestingly, the gene directly upstream of the lbt locus is predicted to encode a 40-kDa outer membrane protein that, because of an iron box, seems to be Fur regulated. Thus, it is tempting to speculate that this protein is a receptor for ferrilegiobactin.
The fact that mutations in lbtAB do not completely abolish CAS reactivity suggests that there may be more than one L. pneumophila iron chelator produced in low iron environments. The residual activity was found to be the temperature-regulated component(s) of the CAS reactivity in CDM supernatants, since the lbtA mutants, like the wild type, showed an increase in CAS activity at room temperature. This activity might represent one or multiple molecules, including a legiobactin precursor(s), other low affinity siderophore(s), or nonsiderophore CAS-reactive specie(s). If the residual activity represents a new siderophore, it is still a member of the complexone class as it is not detected in the Arnow and Csáky assays.
The biological (i.e., growth-promoting) activity of this residual CAS activity is presently unclear. On the one hand, it was not active in the bioassays used in this study. On the other hand, since the lbtA and lbtB mutants grew normally in deferrated CDM, this residual CAS activity may promote bacterial growth so long as an additional iron chelator, such as citrate, is not present. When we investigated candidate siderophore genes, we found that neither frgA nor the pvc locus was involved in production of the activity, or legiobactin for that matter.
Numerous assays and the use of single and double mutants indicate that lbtA and legiobactin are not required for optimal intracellular infection or virulence. These data, however, do not demonstrate that legiobactin has no relevance for intracellular growth or in vivo persistence. Indeed, lbtA is expressed by L. pneumophila within the macrophage, suggesting a dispensable role for legiobactin in this intracellular environment that can be compensated for by another siderophore or another iron uptake system. It is also conceivable that lbtAB and legiobactin are only expressed and required for extracellular growth or persistence in aquatic environments. Further, legiobactin may be made during the log phase of growth but stored and only utilized during the planktonic phase and perhaps within biofilms.
In contrast to lbtAB, frgA is required for optimal intracellular growth in macrophages (35). These data and the sequence homology of FrgA raise the possibility that L. pneumophila encodes a siderophore that, unlike legiobactin, is necessary for optimal intracellular replication. Presently, there are few data concerning the role of siderophores in macrophage or amoebal intracellular infection, although mycobactin of Mycobacterium tuberculosis and 2,5-dihydroxybenzoic acid of Brucella abortus have been shown to promote infection of macrophages (20, 52). The hypothesis that L. pneumophila has evolved multiple siderophores in order to flourish in distinct intra- and extracellular niches is reasonable and worthy of future investigation.
Our understanding of L. pneumophila iron acquisition is still, relatively speaking, in its infancy. But LbtAB now join FrgA, FeoB, IraAB, Ccm proteins, Fur, and ferric reductases as L. pneumophila proteins required for growth in low iron and presumably in iron acquisition (34, 35, 47, 57, 59, 63, 81, 82). It remains to be determined whether these factors operate in common or distinct iron uptake pathways. However, we suspect that FeoB and LbtA are components of two critical pathways in iron uptake since simultaneous inactivation of feoB and lbtA was incompatible with growth under standard conditions. By utilizing various types of lbtAB mutations and mutants, we can design new genetic screens for identifying other components of L. pneumophila iron uptake.
K.A. was partly supported by NIH Training Grant GM08061. This work was funded by NIH grant AI34937 awarded to N.P.C.
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»