JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wiegeshoff, F.
Right arrow Articles by Marahiel, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wiegeshoff, F.
Right arrow Articles by Marahiel, M. A.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2006, p. 3130-3133, Vol. 188, No. 8
0021-9193/06/$08.00+0     doi:10.1128/JB.188.8.3130-3133.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Sigma L Is Important for Cold Shock Adaptation of Bacillus subtilis

Frank Wiegeshoff,1 Carsten L. Beckering,1 Michel Debarbouille,2 and Mohamed A. Marahiel1*

Philipps-Universität Marburg, FB Chemie-Biochemie, Hans-Meerwein-Str., D-35032 Marburg, Germany,1 Biologie des bacteries pathogenes a gram positif, Departement de Microbiologie fondamentale et Medicale (CNRS, URA 2172) Institut Pasteur, Paris 75724, France2

Received 28 November 2005/ Accepted 23 January 2006


   ABSTRACT
Top
 Abstract
Text
 References
 
Although sigma factor-dependent transcriptional regulation was shown to be essential for adaptation to different environmental stimuli, no such sigma factor has been related to the regulation of the cold shock response in Bacillus subtilis. In this study, we present genetic evidence for participation of {sigma}L ({sigma}54) and the two {sigma}L-dependent transcriptional enhancers BkdR and YplP in the cold shock response of Bacillus subtilis JH642. Single-gene deletion of either sigL, bkdR, or yplP resulted in a cold-sensitive phenotype.


   TEXT
Top
 Abstract
 Text
References
 
It has been shown that sigma factors allow the bacterial cell to regulate gene expression in response to different environmental stimuli (11, 14). The alternative sigma factor {sigma}B (12) is responsible for the induction of genes encoding general stress proteins following heat, ethanol, salt, and acid stress and during energy depletion in Bacillus subtilis (13). More than 150 general stress proteins or genes belong to the {sigma}B regulon (13), which provides nongrowing cells with a nonspecific, multiple, and preventive stress resistance (2, 10, 18). Interestingly, the sigB operon is also induced in cells continuously exposed to low temperatures (4) but not, however, after cold shock, which is defined as a sudden temperature shift from 37°C to 15°C (3). To explore the possible involvement of an alternative sigma factor in cold shock adaptation, we analyzed data from earlier transcriptional studies of B. subtilis (3). The cold-induced transcriptional regulator YplP was identified, which shares significant sequence similarity to {sigma}L-dependent transcriptional activators. The {Delta}yplP deletion mutant was shown to be cold sensitive in B. subtilis JH642 (3). The sigL gene encodes a homolog of the {sigma}54 subunit of RNA polymerase and requires regulator proteins of the NtrC/NifA family to activate gene transcription (5, 9). Four homologs of the transcriptional regulator YplP in B. subtilis have been genetically characterized. AcoR, LevR, and RocR are involved in activation of acetoin, carbohydrate, and amino acid metabolism, respectively (1, 6, 8), while BkdR regulates the bkd operon. The strongly cold-induced bkd operon (16) is involved in the synthesis of precursor molecules for branched-chain fatty acids (7), which were shown to be essential for membrane adaptation after cold shock (3, 16). As both {sigma}L-dependent BkdR and YplP transcriptional regulators are linked to the cold shock response, we have investigated the role of {sigma}L in cold shock adaptation by monitoring the growth rates of {Delta}sigL, {Delta}bkdR, and {Delta}yplP deletion mutants after a sudden temperature shift from 37°C to 15°C.

Strain construction. For the construction of strain {Delta}sigL (FW06) a DNA fragment was PCR amplified from chromosomal DNA of B. subtilis QB5505 (8) containing sigL disrupted with an aphA3 kanamycin resistance cassette with primers 5'sigL (TATTATCAAGGCTTTAGAGAGAAAATCGTC) and 3'sigL (ATGTTTTGTCAGCTCTTGTTTCAATGGCT). B. subtilis JH642 was transformed with the DNA fragment of 4,844 bp that was obtained, resulting in kanamycin-resistant strain {Delta}sigL (FW06).

For the construction of strain {Delta}bkdR (FW10), a DNA fragment was PCR amplified from chromosomal DNA of B. subtilis QB7512 (7) containing bkdR disrupted with an aphA3 kanamycin resistance cassette using primers 5'bkdR (ATTGCAACGGAATAAATAGGT) and 3'bkdR (ATGTTTGCGTTTATTCTGCAA). B. subtilis JH642 was transformed with the DNA fragment of 2,325 bp obtained, resulting in strain {Delta}bkdR (FW10). All strains used in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. B. subtilis strains in this study

 
Growth analysis of JH642 deletion strains. Prior to any further experiments, possible polar effects arising from the described gene deletions of yplP and bkdR were analyzed. The growth phenotype resulting from the deletion of yplP could be complemented in trans by introducing a copy of yplP in the amyE site under control of an inducible promoter (data not shown). The analogous experiment for the {Delta}bkdR mutant was described by Debarbouille et al. (7). Therefore, we conclude that the deletion of either yplP or bkdR does not have any polar effects.

The deletion strains {Delta}bkdR (FW10) and {Delta}yplP (CB15) were grown in Spizizen's minimal medium (SMM) at 37°C and shocked to 15°C at an optical density at 600 nm (OD600) of 0.5 (Fig. 1A). Both {Delta}bkdR (FW10) and {Delta}yplP (CB15) lysed after cold shock, indicating that BkdR and YplP are important for the cold shock adaptation. In strain {Delta}bkdR (FW10), the transcriptional activator BkdR is not present any more to enhance the transcription of the bkd operon. Consequently, isoleucine is not converted to {alpha}-keto acids, and no branched-chain fatty acids are synthesized de novo to lower the melting point of the membrane (17). The cells lysed, due to the insufficient membrane adaptation in strain {Delta}bkdR (FW10). The observed lysis of {Delta}yplP (CB15) confirms the results of an earlier study (3); however, the underlying mechanism is still unknown.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
  		FIG. 1. Growth curves of B. subtilis JH642 (diamonds), {Delta}yplP (CB15) (squares), {Delta}bkdR (FW10) (triangles), and {Delta}sigL (FW06) (circles) in the absence (A) and presence (B) of isoleucine (50 µg/ml). Cells were grown in 200 ml SMM supplemented with 0.5% (wt/vol) glucose, 50 µg/ml tryptophan, 50-µg/ml phenylalanine, and trace elements at 37°C to an OD600 of 0.45 and then subjected to cold shock (15°C) (19). All experiments were repeated at least three times.

 
As both BkdR and YplP were shown to be important for cold shock adaptation, we investigated the role of the remaining three {sigma}L-dependent transcriptional activators, AcoR, LevR, and RocR. However, the analysis of the deletion mutant strains {Delta}acoR (FW13), {Delta}levR (FW14), and {Delta}rocR (FW15) did not show cell lysis or cold-dependent growth retardation after a shift from 37°C to 15°C. This implies that AcoR, LevR, and RocR are not essential for cold shock adaptation (data not shown).

As {sigma}L interacted with the cold-relevant transcriptional regulators YplP and BkdR (Fig. 2), we examined its influence on cold shock adaptation. The deletion strain {Delta}sigL (FW06) was grown in SMM at 37°C and then shifted to 15°C at an OD600 of 0.5 (Fig. 1A). Strain {Delta}sigL (FW06) showed cell lysis after cold shock. This is the first demonstration that an alternative sigma factor is important for cold shock adaptation (Fig. 1A). However, the cold-sensitive phenotype of the {Delta}sigL mutant was not as severe as that observed for {Delta}bkdR and {Delta}yplP.


Figure 2
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 2. A diagram showing {sigma}L-dependent transcriptional enhancers BkdR and YplP, which are associated with cold shock adaptation and the downstream-regulated genes. The {sigma}L/BkdR regulation pathway is responsible for the cold shock adaptation of the membrane by the degradation of isoleucine to {alpha}-keto acids for branched-chain fatty acid synthesis. {sigma}L/YplP downstream-regulated cold-relevant genes are still unknown.

 
To evaluate if both transcriptional activators BkdR and YplP are involved in membrane adaptation, {Delta}sigL (FW06), {Delta}bkdR (FW10), and {Delta}yplP (CB15) were grown in SMM in the presence of isoleucine after a temperature shift from 37°C to 15°C (Fig. 1B). Under these conditions, the growth of all strains was improved after cold shock. While the addition of isoleucine supported the growth of {Delta}sigL (FW06) and {Delta}bkdR (FW10) to the level of the wild type, growth of {Delta}yplP (CB15) was significantly retarded (Fig. 1B). This suggests a membrane-dependent function of the {sigma}L/BkdR complex and a membrane-independent role of the {sigma}L/YplP complex for cold shock adaptation.

The {sigma}L/BkdR complex activates the bkd operon, which is responsible for the conversion of isoleucine to {alpha}-keto acids that are used as precursors for branched-chain fatty acid synthesis (Fig. 2). Although the transcriptional activator BkdR was missing in the {Delta}bkdR (FW10) mutant, sufficient amounts of {alpha}-keto acids were synthesized by residual amounts of the bkd operon-encoded enzymes if a large excess of isoleucine was present. This high substrate concentration compensated for the reduced amount of enzymes in the {Delta}bkdR (FW10) mutant. The residual amounts of bkd-encoded enzymes resulted from the basal transcription level of the bkd operon. Therefore, the observed growth rate of the {Delta}bkdR (FW10) mutant can be fully rescued by the addition of isoleucine. This is in full agreement with the published findings of Klein et al. (17), who showed that isoleucine serves as a switch in the fatty acid branching pattern for membrane adaptation to low temperatures. In contrast, the growth of the {Delta}yplP (CB15) mutant was not restored to wild-type levels. This suggests that the {sigma}L/YplP-regulated pathway contains at least one additional element, which is not involved in membrane adaptation.

We conclude that {sigma}L is involved in the regulation of at least two cold shock adaptation pathways in B. subtilis JH642 (Fig. 2). The first is the adaptation of the bacterial membrane by {sigma}L/BkdR-mediated activation of the bkd operon. The second is the {sigma}L/YplP-dependent pathway, with as-yet-unknown functions. Further investigations are in progress to reveal the nature of the {sigma}L/YplP-activated genes.


   ACKNOWLEDGMENTS
 
The Deutsche Forschungsgemeinschaft (SFB 395) supported this work.

We thank Julia Wiesner for technical assistance.


   FOOTNOTES
 
* Corresponding author. Mailing address: Philipps-Universität Marburg, FB Chemie-Biochemie, Hans-Meerwein-Str., D-35032 Marburg, Germany. Phone: 49 6421 282 5722. Fax: 49 6421 282 2191. E-mail: marahiel{at}chemie.uni-marburg.de. Back


   REFERENCES
Top
 Abstract
 Text
 References
 

  1. Ali, N. O., J. Bignon, G. Rapoport, and M. Debarbouille. 2001. Regulation of the acetoin catabolic pathway is controlled by sigma L in Bacillus subtilis. J. Bacteriol. 183:2497-2504.[Abstract/Free Full Text]
  2. Antelmann, H., S. Engelmann, R. Schmid, and M. Hecker. 1996. General and oxidative stress responses in Bacillus subtilis: cloning, expression, and mutation of the alkyl hydroperoxide reductase operon. J. Bacteriol. 178:6571-6578.[Abstract/Free Full Text]
  3. Beckering, C. L., L. Steil, M. H. Weber, U. Völker, and M. A. Marahiel. 2002. Genomewide transcriptional analysis of the cold shock response in Bacillus subtilis. J. Bacteriol. 184:6395-6402.[Abstract/Free Full Text]
  4. Brigulla, M., T. Hoffmann, A. Krisp, A. Volker, E. Bremer, and U. Volker. 2003. Chill induction of the SigB-dependent general stress response in Bacillus subtilis and its contribution to low-temperature adaptation. J. Bacteriol. 185:4305-4314.[Abstract/Free Full Text]
  5. Buck, M., M. T. Gallegos, D. J. Studholme, Y. Guo, and J. D. Gralla. 2000. The bacterial enhancer-dependent {sigma}54 ({sigma}N) transcription factor. J. Bacteriol. 182:4129-4136.[Free Full Text]
  6. Calogero, S., R. Gardan, P. Glaser, J. Schweizer, G. Rapoport, and M. Debarbouille. 1994. RocR, a novel regulatory protein controlling arginine utilization in Bacillus subtilis, belongs to the NtrC/NifA family of transcriptional activators. J. Bacteriol. 176:1234-1241.[Abstract/Free Full Text]
  7. Debarbouille, M., R. Gardan, M. Arnaud, and G. Rapoport. 1999. Role of bkdR, a transcriptional activator of the sigL-dependent isoleucine and valine degradation pathway in Bacillus subtilis. J. Bacteriol. 181:2059-2066.[Abstract/Free Full Text]
  8. Debarbouille, M., I. Martin-Verstraete, A. Klier, and G. Rapoport. 1991. The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both sigma 54- and phosphotransferase system-dependent regulators. Proc. Natl. Acad. Sci. USA 88:2212-2216.[Abstract/Free Full Text]
  9. Debarbouille, M., I. Martin-Verstraete, F. Kunst, and G. Rapoport. 1991. The Bacillus subtilis sigL gene encodes an equivalent of sigma 54 from gram-negative bacteria. Proc. Natl. Acad. Sci. USA 88:9092-9096.[Abstract/Free Full Text]
  10. Engelmann, S., and M. Hecker. 1996. Impaired oxidative stress resistance of Bacillus subtilis sigB mutants and the role of katA and katE. FEMS Microbiol. Lett. 145:63-69.[CrossRef][Medline]
  11. Haldenwang, W. G. 1995. The sigma factors of Bacillus subtilis. Microbiol. Rev. 59:1-30.[Abstract/Free Full Text]
  12. Haldenwang, W. G., and R. Losick. 1980. Novel RNA polymerase sigma factor from Bacillus subtilis. Proc. Natl. Acad. Sci. USA 77:7000-7004.[Abstract/Free Full Text]
  13. Hecker, M., and U. Völker. 2001. General stress response of Bacillus subtilis and other bacteria. Adv. Microb. Physiol. 44:35-91.[Medline]
  14. Helmann, J. D., and C. P. Moran. 2002. RNA polymerase and sigma factors, p. 289-312. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, D.C.
  15. Hoch, J. A., and J. Mathews. 1973. Chromosomal location of pleiotropic sporulation mutations in Bacillus subtilis. Genetics 73:215-228.[Abstract/Free Full Text]
  16. Kaan, T., G. Homuth, U. Mader, J. Bandow, and T. Schweder. 2002. Genome-wide transcriptional profiling of the Bacillus subtilis cold-shock response. Microbiology 148:3441-3455.[Abstract/Free Full Text]
  17. Klein, W., M. H. Weber, and M. A. Marahiel. 1999. Cold shock response of Bacillus subtilis: isoleucine-dependent switch in the fatty acid branching pattern for membrane adaptation to low temperatures. J. Bacteriol. 181:5341-5349.[Abstract/Free Full Text]
  18. Völker, U., B. Maul, and M. Hecker. 1999. Expression of the {sigma}B-dependent general stress regulon confers multiple stress resistance in Bacillus subtilis. J. Bacteriol. 181:3942-3948.[Abstract/Free Full Text]
  19. Weber, M. H., C. L. Beckering, and M. A. Marahiel. 2001. Complementation of cold shock proteins by translation initiation factor IF1 in vivo. J. Bacteriol. 183:7381-7386.[Abstract/Free Full Text]

Journal of Bacteriology, April 2006, p. 3130-3133, Vol. 188, No. 8
0021-9193/06/$08.00+0     doi:10.1128/JB.188.8.3130-3133.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wiegeshoff, F.
Right arrow Articles by Marahiel, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wiegeshoff, F.
Right arrow Articles by Marahiel, M. A.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS