Previous Article | Next Article ![]()
Journal of Bacteriology, May 2006, p. 3219-3227, Vol. 188, No. 9
0021-9193/06/$08.00+0 doi:10.1128/JB.188.9.3219-3227.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Infectious Diseases,1 Department of Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Dr. NW, Calgary, Alberta T2N 4N1,2 Department of Biochemistry and Microbiology, University of Victoria, Victoria, British Columbia V8W 3P6, Canada3
Received 30 November 2005/ Accepted 16 February 2006
|
|
|---|
|
|
|---|
Most Salmonella isolates possess the ability to form patterned, aggregative colonies when grown on surfaces (2, 26). This multicellular phenomenon has been termed the rdar morphotype (colonies are "red, dry, and rough" when grown on media containing Congo red [9, 29]). The rdar morphotype is primarily controlled by expression of the divergent agfDEFG and agfBAC (csgDEFG/BAC) operons encoding thin aggregative fimbriae (Tafi or curli) (7, 16). AgfD is a positive regulator of Tafi production by activating transcription of agfB (16, 47). AgfD also stimulates cellulose production by transcriptional activation of adrA (47). AdrA contains the GGDEF domain involved in the synthesis of cyclic di-GMP, a signaling molecule required for activation of cellulose synthesis (14, 27, 34). Tafi and cellulose, along with additional exopolysaccharides (11, 41), form a recalcitrant extracellular matrix that serves to physically link cells together within a colony. These extracellular factors are produced by Salmonella under nutrient-limiting conditions at low osmolarity and growth temperatures below 30°C (9, 29).
We and others have hypothesized that the rdar morphotype could be important for environmental survival due to the following qualities: the recalcitrant nature of extracellular matrix components (9, 35, 41, 47), characteristic growth conditions (29), and increased resistance to antimicrobial stresses (2, 32, 35). Here, we show that the rdar morphotype enhances Salmonella survival during desiccation in the absence of nutrients. After storage on plastic for 9 months, wild-type cells of S. enterica serovar Typhimurium ATCC 14028 had 10 to 30 times increased survival compared to mutants deficient in Tafi and cellulose production. Increased resistance to desiccation would undoubtedly aid in long-term survival of Salmonella in the environment and promote passage to future hosts.
|
|
|---|
22°C) or 28°C as indicated. To visualize the production of cellulose, cells were grown on T agar containing 200 µg/ml calcofluor white (fluorescent brightener 28; Sigma-Aldrich Canada). Colony pictures were taken with a Kodak Image Station 2,000MM camera system. For bioluminescence assays, overnight cultures were diluted 1:600 in T broth supplemented with 50 µg/ml Kan to a final volume of 150 µl in 96-well clear-bottom black plates (9520 Costar; Corning Inc.). The culture in each well was overlaid with 50 µl mineral oil prior to starting the assays. Cultures were assayed for luminescence (0.1 s) and absorbance (620 nm, 0.1 s) every 30 min during growth at 28°C with agitation in a Wallac Victor2 (Perkin-Elmer Life Sciences, Boston, Mass.). Recombinant DNA techniques and construction of lux reporters. Genomic DNA was prepared following the method of Walsh et al. (38). Promoter-containing regions for agfD, agfB, and adrA were PCR amplified from ATCC 14028 using primers agfD1 (GTGCTCGAGGGACTTCATTAAACATGATG [a XhoI site is underlined]) and agfD2 (GCCGGATCCTGTTTTTCATGCTGTCAC [a BamHI site is underlined]), adrA1 (GACCTCGAGAAGGCGATGACCGTAGCAAG [a XhoI site is underlined]) and adrA2 (GACGGATCCGCCTGTTCAACCGCTTTT [a BamHI site is underlined]). PCR products were purified (QIAGEN Inc.), sequentially digested with XhoI and BamHI (Invitrogen Canada Inc.), and ligated using T4 DNA ligase (Invitrogen Canada Inc.) into pCS26-Pac (XhoI-BamHI) or pU220 (BamHI-XhoI) reporter vectors containing the luxCDABE operon from Photorhabdus luminescens (4). The majority of pCS26 and pU220 cloning was performed in Escherichia coli DH10B (Invitrogen Canada Inc.). All plasmids were transformed into Salmonella strains by electroporation (Bio-Rad Laboratories Inc.). Promoter::lux plasmids were purified from Salmonella (QIAGEN Inc.), and DNA sequencing was performed by Macrogen (Seoul, South Korea) using primers pZE05 and pZE06 (4).
Construction of a sig38H4 reporter designed to measure RpoS activity.
A synthetic, 58-nucleotide, RpoS (
38)-responsive promoter (CTCGAGATAATTCCATGCGGTTTCGCTAAAATCATGTATACTTATTATCAATTGGATCC; 35 and 10 promoter regions are underlined, XhoI and BamHI restriction sites are in boldface) was generated using overlapping oligonucleotides. Primer clone (GCGCGCTCGAGAATAATTCCATGCGGTTTCGCTAAAATCA) and sig38-reverse (GCGCGGGATCCAATTGATAATAANTATANATGATTTTAGCGAAA) were mixed, denatured at 94°C for 10 min, and allowed to anneal on ice before ligation into XhoI- and BamHI-digested pCS26. Primer sequences were designed based on consensus promoter sequences from E. coli genes that are RpoS dependent (3). The 35 promoter region was designed to be divergent from the RpoD (
70) consensus sequence and therefore reduce binding of RpoD and subsequent transcription. Luminescence of the sig38H4 reporter in an
rpoS mutant strain of S. enterica serovar Typhimurium ATCC 14028 remained near background levels (<8,000 cps) during growth in 1% tryptone (data not shown).
Generation of serovar Typhimurium ATCC 14028 mutant strains. Deletion constructs for agfA and bcsA generated from serovar Enteritidis 27655-3b DNA and cloned into pHSG415 have been described previously (39, 41). An in-frame deletion removing 612 bp in agfD (encoding amino acids 6 to 210 in AgfD) was generated using PCR primers agfD-A (GACGAATCCGTGTGTTATGCCGCCATGGG [an EcoRI site is underlined]), agfD-B (GGACTGCAGTAAACATGATG [a PstI site is underlined]), agfD-C (GCCCTGCAGCAAACGATAATCTCAGGCGG [a PstI site is underlined]), and agfD-D (GCCAAGCTTTGTCCGTGACGTTGAGCTGG [a HindIII site is underlined]). The two PCR fragments generated were directionally cloned into EcoRI- and HindIII-digested pTZ18R (Amersham Biosciences) and subcloned into pHSG415 (17). Each mutation was introduced into the chromosome of ATCC 14028 by following established procedures (40) with modifications (A. P. White, E. Ambrose, B. W. Jones, R. DeVinney, W. W. Kay, and M. G. Surette, unpublished data). Screening for strains containing the truncated agfD gene was accomplished using primers agfDko1 (CACTTGCTTTAAGATTTGTAATGGC) and agfDko2 (ATTCGCTTTCCCATTTGTCG).
Long-term survival experiments and treatment with sodium hypochlorite.
Cells from 1 µl of ATCC 14028,
agfD,
agfA, and
bcsA overnight cultures were inoculated onto T agar and grown for 6 days at RT. Colonies were removed from the agar surface and tested immediately (initial numbers) or stored in 24-well tissue culture plates (one colony per well) at RT for 3 or 9 months. After rehydration of colonies in 500 µl phosphate-buffered saline (PBS), pH 7.4, for 1 h at RT, 100 µl of sodium hypochlorite solution (to a final concentration of 30 to 300 ppm) or PBS (control) was added and mixed continuously using a rotating microtube mixer for 20 min at RT. Cells and colony materials were centrifuged (7,000 x g, 2 min), and supernatant was removed. Fresh PBS (500 µl) was added, and colony slurries were mixed in a tissue homogenizer until uniform turbidity was reached (
20 s). For planktonic-grown cells, 20-h cultures in 1% tryptone were normalized to an optical density of 1 at 600 nm, and 1-ml aliquots of cells were pelleted (7,000 x g, 2 min) prior to the treatment. The homogenization step was omitted. To determine the number of viable cells remaining in each sample, cell mixtures were serially diluted in triplicate and plated in duplicate in 5-µl drops.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Prevalence of multicellular pattern formation (rdar morphotype) in Salmonella enterica subgroup I strains (SARB) (5)
|
![]() View larger version (105K): [in a new window] |
FIG. 1. Multicellular pattern formation during growth of Salmonella in colonies of the rdar morphotype. S. enterica serovar Montevideo (SARB 30) cells were inoculated on T agar and incubated at room temperature for 90 h. Colony images were recorded every 30 min. Bars represent 5 mm. The entire sequence of 170 pictures can be viewed as a movie (www.med.ucalgary.ca/webs/bprg/Surette/Surette.html).
|
38)-responsive promoter::lux fusion.
![]() View larger version (22K): [in a new window] |
FIG. 2. Temporal expression of genes required for formation of the rdar morphotype in serovar Typhimurium. Expression of agfD, agfB, adrA, or RpoS ( 38)-responsive promoter::lux fusions during ATCC 14028 growth in 1% tryptone at 28°C with agitation. A. Light production as a function of time. Luminescence (counts per second [cps]) measurements for agfD and agfB::lux fusions are on the left axis; measurements for adrA and RpoS-responsive lux fusions are on the right axis. Representative expression curves from one experiment are shown. The inset shows cell density measurements (A620) for each reporter strain as a function of time. B. Light production of lux reporter strains as a function of time, normalized by the maximum cps of each strain. To ensure accurate timing of expression during growth, each assay was repeated at least six times and individual growth curves were matched. The expression curves represent the average from these experiments. C. Expression curves from panel B were enlarged to highlight the temporal resolution of gene expression. The line is representative of the 10% gene activation level.
|
We compared normalized promoter expression profiles at the 10% activation level to determine the relative order of transcription (Fig. 2C) (20, 45). An increase in RpoS activity from basal levels was measured between 8 and 12 h of growth. This increase was followed immediately by activation of agfD transcription. There was a 5- to 6-h lag period before activation of agfB and adrA reporters, both of which had steep activation profiles. agfB was activated 90 to 120 min before adrA, on average (Fig. 2C). This suggests that fimbrial biosynthesis may be an initiating event in formation of the Salmonella extracellular matrix. The sharp expression peaks observed for agfB and adrA correspond to the sharp transition in pattern formation during colony growth (Fig. 1, 40 to 42 h).
Extracellular complementation of colony surface patterns.
ATCC 14028 forms large, patterned colonies (Fig. 3A) that can be peeled off the agar surface intact (29). An isogenic
agfD strain lacking both Tafi and cellulose production formed smaller colonies that remained smooth and mucoid (Fig. 3A) (28, 47). Strains lacking either Tafi production (
agfA) (8, 25) or cellulose production (
bcsA) (47) also formed smooth colonies (Fig. 3A), but these colonies were not entirely mucoid; Tafi provide short-range cell-cell interactions that yield an adhesive texture, and cellulose provides long-range cell-cell interactions that yield a sticky texture (28). To highlight the extracellular interactions leading to pattern formation, mutant strains lacking Tafi, cellulose, or both components (
agfA,
bcsA, or
agfD) were mixed prior to spotting on T agar. When
agfA and
bcsA cells were combined, the Tafi and cellulose polymers produced from different cells were able to restore pattern formation on the colony surface (Fig. 3B). These colonies had an adhesive texture, indicating that a partial multicellular network had formed. In contrast, mixtures of cells lacking either Tafi or cellulose formed colonies that remained smooth and partially mucoid (Fig. 3B). Thus, extracellular interactions between individual cells are responsible for the formation of colony surface patterns in the rdar morphotype of Salmonella.
![]() View larger version (54K): [in a new window] |
FIG. 3. Tafi and cellulose interact extracellulary to form surface patterns in Salmonella rdar morphotype colonies. A. Colony morphologies of ATCC 14028 and agfD, agfA, and bcsA deletion strains grown on 1% tryptone (T) agar at 28°C for 48 h. B. Colony morphologies of mixtures of equal numbers of agfD, agfA, or bcsA cells after growth on T agar at 28°C for 48 h.
|
70)-responsive promoter that had peak expression at day 1 and dropped below detectable limits after 7 days (data not shown). These data indicated that cells were alive and respiring after nearly 2 months. This led us to investigate the fate of cells in colonies that were peeled off from the agar surface and dried out in the plastic wells of a multiwell plate (Fig. 4B). Surprisingly, a large number of cells remained viable even after several months of storage. We hypothesized from these initial experiments that the rdar morphotype may contribute to the long-term survival of Salmonella.
![]() View larger version (45K): [in a new window] |
FIG. 4. Long-term survival of serovar Typhimurium in colonies of the rdar morphotype. A. RpoS ( 38) activity in growing cells was monitored using the sig38H4 promoter::lux fusion. Colonies were inoculated with 105 cells from an overnight culture and were grown at RT ( 22°C) for 50 days. Pictures were taken at the times indicated to record colony morphology (white) or luminescence production (lux). B. Individual rdar colonies peeled off the surface of T agar were stored for 3 to 9 months at RT in plastic wells of a 24-well plate in the absence of nutrients prior to testing survival and resistance to bleach treatment.
|
agfD,
agfA, and
bcsA colonies were significantly reduced to 6.2%, 11%, and 21% of initial numbers, respectively (Table 1). After 9 months of storage, survival of ATCC 14028 cells was nearly 10%, whereas cell numbers for
agfD and
agfA colonies were further reduced to 0.27% and 1.2%, respectively (Table 1). Survival of
bcsA cells was also reduced compared to ATCC 14028, but the difference was not statistically significant (Table 1). These data demonstrated that production of Tafi and cellulose enhanced long-term survival of Salmonella under these conditions. The
bcsA and
agfA mutants had different survival characteristics, demonstrating that these two extracellular polymers collectively enhance survival, with cellulose being slightly less important. |
View this table: [in a new window] |
TABLE 2. Survival of Salmonella after months of desiccation in the absence of exogenous nutrients
|
![]() View larger version (21K): [in a new window] |
FIG. 5. Survival of serovar Typhimurium cells in colonies of the rdar morphotype following a 20-min exposure to sodium hypochlorite. A. ATCC 14028 rdar colonies stored for 3 months on plastic were rehydrated and treated with different concentrations of sodium hypochlorite. Each point represents the average number of surviving cells (CFU) per colony and standard errors corresponding to at least two individual colonies. B. Survival of cells from 3-month-old colonies of ATCC 14028, agfD, agfA, and bcsA was compared to that of planktonic cells grown at 37°C for 20 h (stationary phase) after treatment with 60 ppm sodium hypochlorite. Bars represent the average relative survival (log CFU after treatment/log CFU before treatment) and standard errors from at least four individual colonies or aliquots of planktonic cells. CFUs for colonies before treatment are displayed in Table 1; for planktonic cells, the initial values ranged from 4.2 x 108 to 5.5 x 108 CFU.
|
agfD,
agfA, and
bcsA cells were compared after growth in conditions when Tafi and cellulose are not produced (i.e., stationary-phase planktonic cells at 37°C) versus rdar colonies that had been stored for 3 months (Fig. 5B). Planktonic cells from all strains were susceptible to 60 ppm sodium hypochlorite and showed greater than 6-log reductions in CFU after treatment (Fig. 5B, gray bars). In contrast, cells in dried colonies of the
agfA strain were resistant with less than 1-log reduction in CFU after treatment. This level of resistance was similar to that of rdar colonies from ATCC 14028 (Fig. 5A). Cells in dried colonies from the cellulose-deficient
bcsA strain were susceptible and showed greater than a 4-log reduction in CFU (<0.01% survival; Fig. 5B). Mucoid colonies of the
agfD strain were most susceptible; survival was reduced to levels similar to that of planktonic-grown cells (Fig. 5B). These results demonstrated that cellulose and additional components regulated by AgfD confer protection to sodium hypochlorite.
When equal numbers of
bcsA and
agfA cells were combined prior to growth,
bcsA cells in the hybrid rdar colonies (Fig. 3B) showed increased resistance to sodium hypochlorite (data not shown). The degree of protection correlated with the number of cellulose-positive (
agfA) cells present, indicating that survival was dependent on the overall amount of cellulose present in the colony. This reinforced the correlation between the extracellular interactions leading to the rdar morphotype and the inherent resistance of this multicellular state.
|
|
|---|
The rdar morphotype was formed by 58 of 72 (80.5%) natural isolates in the SARB collection. Previous studies to determine the prevalence of the rdar morphotype within S. enterica subgroup I have primarily focused on human-associated serovars Enteritidis and Typhimurium (26, 35). More recent work has focused on a variety of serovars isolated from clinical and food sources (36). In each of these studies, rdar morphotype formation was detected in greater than 70% of isolates. Given that the SARB represents a comprehensive strain collection, we conclude that the ability to form the rdar morphotype is prevalent throughout S. enterica subgroup I. Serovars Choleraesuis and Typhi appear to be exceptions, since all 36 isolates tested by Romling et al. (26) did not express the rdar morphotype. However, both serovar Typhi isolates tested in this study were capable of forming rdar colonies. The reason for this discrepancy is unclear but is presumed to represent diversity within serovar Typhi.
Our experiments demonstrate an important role for the rdar morphotype in the enhanced long-term survival and persistence of Salmonella. The enhanced survival under conditions of desiccation would be advantageous in many natural environments and may also contribute to the contamination of dried food products (19). The finding that almost 10% of ATCC 14028 cells were alive after 9 months of storage illustrates the remarkable survival properties of Salmonella. The increased resistance of 3-month-old rdar colonies to sodium hypochlorite has obvious implications for the sanitization of contaminated surfaces (i.e., in the agricultural and food-processing industries). Our observations were comparable to those of a recent study performed on cells forming pellicles at the air-liquid interface in standing liquid culture (32). This was not surprising, since the same ATCC 14028 strain was analyzed and Tafi and cellulose are required for pellicle formation (14). These and other studies (2, 21, 31) stress the differences between studying planktonic cells grown in typical laboratory conditions and cells growing in more resistant physiological states.
Individual extracellular matrix components had different contributions to long-term survival and persistence. The Tafi-deficient strain (
agfA) had a surprising reduction in survival of desiccation compared to the cellulose-deficient strain (
bcsA). Our gene expression analyses indicated that Tafi production may be an initiating event during the formation of the rdar morphotype. The temporal difference between agfB (Tafi production) and adrA (cellulose production) activation was approximately 90 to 120 min. Overexpression of adrA from a multicopy plasmid resulted in a more rapid appearance of the rdar phenotype, although the colony morphology was visibly altered (data not shown). Therefore, the significance of the temporal difference between agfB and adrA is unknown. Tafi production is required for the increased surface spreading observed in rdar colonies;
bcsA (Cellulose, Tafi+) colonies are consistently larger than
agfA (Cellulose+, Tafi) colonies (Fig. 3A). From these different observations, we hypothesize that Tafi plays a critical role in organizing the extracellular matrix, perhaps leading to an optimal spatial arrangement of cells (47) and increased survival. Cellulose, on the other hand, was not as important for survival but conferred protection against sodium hypochlorite. Cellulose-positive strains (wild type and
agfA) had greater than 4 orders of magnitude increased survival compared to that of cellulose-deficient strains (
bcsA and
agfD). This confirmed previous sodium hypochlorite tests with broth-grown cells of Salmonella (35). The protective nature of cellulose could apply to other reactive compounds, such as hydrogen peroxide (2). Cellulose polymers may directly remove or neutralize reactive species, as suggested by Scher et al. (32). The presence of cellulose may also trap additional Salmonella polysaccharides on the cell surface (41) to enhance protection.
Long-term survival during desiccation and resistance to sodium hypochlorite was most reduced in the agfD mutant strain lacking Tafi and cellulose production (47). The absence of these two polymers did not entirely account for the reduction measured, however. Survival of
agfD was four times less than that of the Tafi-deficient (
agfA) strain after 9 months of storage and 2 logs less than that of the cellulose-deficient strain (
bcsA) after treatment with sodium hypochlorite. AgfD is a global transcriptional regulator known to regulate the expression of several genes related to biofilm formation (6) as well as newly identified components of the extracellular matrix, such as capsular polysaccharides (D. L. Gibson, A. P. White, S. D. Snyder, C. Heiss, P. Azadi, M. G. Surette, and W. W. Kay, unpublished) and BapA, a large cell surface protein containing repeated sequence motifs (23). It is hypothesized that
agfD cells have increased susceptibility to desiccation stress and sodium hypochlorite due to lack of these additional extracellular components.
The relationship between the Salmonella rdar morphotype and survival described here may be just one example of a generalized survival strategy used by many other microorganisms, both pathogens and nonpathogens. The genes for Tafi (agf or csg) and cellulose (bcs or yhj) are conserved throughout the salmonellae (http://globin.cse.psu.edu/enterix/enteric/enteric.html) (12), and these polymers are expressed by the vast majority of isolates. Curli and cellulose can also be produced by environmental E. coli isolates (10) and organisms commonly isolated from the human digestive tract (46). In addition, cellulose is produced by numerous soilborne organisms and plant pathogens, such as Agrobacterium tumefaciens (1), Pseudomonas fluorescens (37), and Erwinia chrysanthemi (43), and contributes to the fitness of these organisms in their natural environments. P. aeruginosa (13), Candida spp. (22), and Vibrio cholerae (44) all display coordinated multicellular behavior when grown on solid media. Unlike Salmonella spp., none of these microorganisms are known to produce Tafi or cellulose. However, in each case, protein and sugar polymers are involved in the formation of an extracellular matrix that encases individual cells and leads to aggregation. This is likely the principle function of Tafi and cellulose in Salmonella, to enable individual cells to stick together on surfaces and withstand stresses in the environment. This would allow for the smooth transition of Salmonella between hosts.
This work was supported by grants from the National Sciences and Engineering Research Council (NSERC) to W.W.K. and Canadian Institutes of Health Research to M.G.S. and through Genome Prairie, Genome BC, and Inimex Pharmaceuticals through the "Functional Pathogenomics of Mucosal Immunity" project. M.G.S. is supported as an Alberta Heritage Foundation for Medical Research (AHFMR) Senior Scholar and Canada Research Chair in Microbial Gene Expression. A.P.W. is supported by a postdoctoral fellowship from AHFMR.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»