| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,

Division of Infectious Diseases, School of Public Health, University of California, Berkeley, California 94720
Received 13 July 2006/ Accepted 11 October 2006
| ABSTRACT |
|---|
|
|
|---|
70-like promoter elements. Transcriptional initiation by a sigma factor responsible for constitutive gene expression indicates that undefined activators or repressors regulate developmental stage-specific expression of chlamydial type III secretion system genes. | INTRODUCTION |
|---|
|
|
|---|
Chlamydiae are obligate intracellular bacteria that manipulate host cells throughout their developmental cycle. Based on sequence homology, chlamydiae carry an almost-complete repertoire of genes representing a type III secretion system (23, 55). Chlamydiae enter host cells as metabolically inert elementary bodies (EB) that have surface projections reminiscent of a type III secretion apparatus (40). EB invade nonphagocytic cells (5), and entry is associated with a candidate type III secretion effector protein, TARP (7). Once internalized, chlamydiae establish a unique vacuole called the inclusion that avoids fusion with endosomes and lysosomes yet acquires exocytic lipids (20, 51). Chlamydia-encoded proteins decorate the inclusion membrane and have been implicated in intracellular vesicular trafficking (47). Inclusion membrane-localized proteins have also been proposed to be secreted by the type III secretion system (57). Within the established inclusion, EB convert into the metabolically active and replication-competent reticulate bodies (RB). As RB divide, they are tightly associated with the inclusion membrane and have observable projections protruding through the inclusion membrane that are thought to be type III secretion apparatuses (39). Through unknown signals and ill-defined mechanisms, RB asynchronously convert into EB which are eventually released into the extracellular environment, thus completing the developmental cycle.
Relatively little is known regarding the mechanisms regulating the chlamydial developmental cycle. Global gene expression profiling during development emphasized the governing role of transcriptional regulation. Within 6 to 8 h postinfection (hpi), greater than 75% of predicted Chlamydia trachomatis open reading frames are transcribed, and most are constitutively expressed throughout the developmental cycle (2, 43). Chlamydiae encode a primary DNA-dependent RNA polymerase
factor (
66) that is homologous to
70 factors responsible for constitutive gene expression (11, 27). While few chlamydial promoters have been experimentally defined,
66 promoter elements precede constitutively expressed genes (21). At approximately 18 to 24 hpi, coinciding with conversion from early RB to EB in C. trachomatis, virtually all differentially expressed genes (
20% of the open reading frames) are upregulated (43). Of the differentially expressed genes analyzed, all but one (hctB) (65) also have
66 promoter elements (21). These data indicate that transcriptional activators or repressors play a critical role in chlamydial differential gene expression (13). While it is anticipated that the alternative
factors encoded by chlamydiae,
28 and
54, are also involved in developmental regulation, only
28-directed hctB expression has been demonstrated (65).
Type III secretion system genes are among those upregulated during RB-to-EB conversion (43); however, the regulatory mechanisms are unknown. Determining chlamydial type III secretion system regulatory elements involved in gene expression is complicated by the unique genomic structure. Typically, type III secretion system genes are similarly organized and tightly clustered within a single locus located in a chromosomal pathogenicity island or virulence-associated plasmid (24). Among chlamydial species, the type III secretion system genetic content and organization are highly conserved (25). However, chlamydial type III secretion system genes are disordered and chromosomally dispersed within six loci (55). Within these loci are structural components that comprise the needle structure, specific chaperones for secreted proteins (effectors), and two translocator systems that are necessary for secreted proteins to cross the host cell membrane (24). Additionally, genes encoding proteins with unknown function flank many type III secretion system homologs. While transcriptional regulators of type III secretion genes are located predominantly within the same locus in other organisms (24), a homolog has not been identified in the chlamydial loci.
Chlamydiae have a significant impact on public health worldwide and are associated with a diverse spectrum of disease manifestations, including blindness, pneumonia, athlerosclerosis, and reproductive sterility (49). Despite the medical significance, very little is known regarding the mechanisms of pathogenicity. This study was designed to elucidate regulatory systems for the type III secretion virulence factors in C. trachomatis. Due to the genetic complexity of the chlamydial type III secretion system, the operon structure was characterized to facilitate identification of cis-acting regulatory elements. Genes contained within a transcriptional unit predominantly encode proteins involved in the same cellular function (29). Therefore, determining the chlamydial type III secretion system operon structure also identified proteins likely involved in type III secretion system-mediated virulence, including candidate regulatory and effector proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Transcriptional linkage analysis. To define operon structure, reverse transcription coupled with PCR (RT-PCR) was utilized to determine if flanking genes are contained on the same transcriptional unit (operon). Chlamydial RNA was isolated at 24 hpi as described previously (43). cDNA was generated from 5 µg of RNA by using random hexamers and Superscript III reverse transcriptase according to the manufacturer's protocol (Invitrogen). PCR was performed using primers designed to generate an approximately 800-bp PCR product (amplicon) representative of a region approximately 400 bp upstream and downstream of the predicted translational start site (see Table S1 in the supplemental material). Amplicons were separated and visualized in ethidium bromide-stained 1% agarose gels.
Quantitative gene expression analysis. Total RNA was isolated directly from C. trachomatis-infected L929 cells at 6-h increments postinfection through 36 h postinfection by using Trizol (Invitrogen, Carlsbad, CA). Isolated RNA was treated with RQ1 DNase (Promega, Madison, WI) for 2 h prior to purification according to the manufacturer's protocol (RNeasy Cleanup Column; QIAGEN, Valencia, CA). For each RNA sample, cDNA was generated using random hexamers and Superscript III reverse transcriptase (Invitrogen), following the manufacturer's procedures. Real-time PCR analysis was performed using 16S ribosomal primers, verifying that RNA samples were free of contaminating DNA and confirming cDNA generation. For each gene, quantitative PCR was performed on each cDNA sample (including an RT-negative sample) and on dilutions of C. trachomatis genomic DNA (5 x 109 through 6.4 x 1015 grams), using an Applied Biosystems 7500 real-time PCR detection system (Applied Biosystems, Foster City, CA). Each reaction mixture contained template, 300 nmol of each primer, and 2x SYBR green PCR master mix (Applied Biosystems). Threshold fluorescence was established within the geometric phase of logarithmic amplification for each gene, and the cycle threshold (CT) was determined. Log genomic DNA versus CT was plotted to establish standard curves for each gene, and genomic equivalents were determined from each cDNA sample. Genomic equivalents were averaged and standard deviations calculated. For normalization, ratios to the constitutively expressed CT190 (gyrB) for each time point were ascertained.
Identification of 5' transcript ends. To identify the transcriptional start sites for each operon, 5' transcript termini were determined following the 5' rapid amplification of cDNA ends (RACE) protocol of Invitrogen, with the following exceptions. cDNA was generated from chlamydial RNA isolated at 24 hpi, using primers listed in Table S1 in the supplemental material and Superscript reverse transcriptase III (Invitrogen) with a 55°C annealing temperature. Terminal deoxytransferase reaction mixtures were incubated at 37°C for 20 min before heat inactivation at 65°C for 10 min. Initial PCRs were performed using 30 cycles of 94°C, 55°C, and 72°C for 30 seconds each cycle with gene-specific RACE nested 3' primers (see Table S1 in the supplemental material). Secondary PCRs (30 µl) were performed using 5 µl of a 1:500 dilution of the primary PCR products with an annealing temperature of 60°C. Amplicons were separated on a 1.8% agarose gel, and bands unique to reactions containing terminal deoxytransferase were excised. DNA was purified from excised bands following the manufacturer's protocol (DNA gel purification kit; QIAGEN), and amplicons were sequenced directly using RACE nested primers (see Table S1 in the supplemental material) (University of California, Berkeley, DNA core sequencing facility and Applied Biosystems 3730). Sequencing trace files were analyzed for the first nucleotide after the incorporation of a string of dCTPs to predict the transcriptional 5' termini.
Computational prediction of
70 promoter elements.
To predict the presence of
70 promoter elements, Neural Network Promoter Prediction 2.2 was utilized (4). One-hundred-base-pair regions corresponding to 80 and 20 bp upstream and downstream of experimentally identified transcriptional start sites, respectively, were analyzed. Predicted promoters are provided a score ranging from 0 to 1. Other than for CT663, a threshold of 0.9 was applied. At this threshold, the false-positive rate was 0.3% and the correlation coefficient was 0.71 for E. coli
70 promoters. Additionally, approximately 50% of E. coli
70 promoters scored higher than 0.9 (M. Reese, personal communication; http://www.fruitfly.org/seq_tools/nnppHelp.html).
Computational transcriptional terminator prediction. The C. trachomatis genome has been analyzed for Rho-independent termination sites by using the TransTerm algorithm (12), and results are available at http://www.cbcb.umd.edu/software/TransTerm/. For each predicted operon, regions downstream of the stop codon for the 3'-most proximal gene were inspected for Rho-independent transcriptional termination sites. For those genes for which sites were not identified using TransTerm, regions were searched for the presence of inverted palindromes separated by 3 to 10 bp that could form stem-loop structures. Free energies for predicted stem-loops were calculated using Mfold (67).
ß-Galactosidase expression analysis. ß-Galactosidase activity was used to the measure the transcriptional compatibility of type III secretion system promoters in E. coli. An expression vector containing a lacZ gene lacking a promoter (pAC-lacZ) was generated by cloning the lacZ gene into pACYC184. The lacZ gene from the pBAD-lacZ vector (Invitrogen) was amplified and cloned using the EagI and HindIII sites. Upstream regions containing type III secretion system promoter elements were amplified using primers listed in Table S1 in the supplemental material and were cloned into the EagI site. All clones were sequenced to confirm insertion and orientation by using lacZ 3' screen primer (5'-TTGAGGGGACGACGACAGTATC-3'). For ß-galactosidase activity assays, triplicate samples from overnight cultures grown in Luria-Bertani broth and chloramphenicol (50 µg/ml) were diluted 1:100 in fresh broth and grown at 37°C for approximately 2 h (early to mid-log phase) before the optical density at 600 nm (OD600) was measured. ß-Galactosidase expression analysis was performed as described previously (41) with the following exceptions to adapt the analysis to 1.8-ml microcentrifuge tubes: cells were diluted in a total volume of 500 µl with Z-buffer; 50 µl of chloroform and 25 µl of 0.1% sodium dodecyl sulfate were added, vortexed for 10 seconds, and incubated at room temperature for 10 min; 100 µl of ortho-nitrophenyl-ß-galactoside (4 mg/ml) was added; and the time was measured before addition of 250 µl of 1 M Na2CO3 to stop reactions. Reaction mixtures were centrifuged for 5 min at 16,000 x g, the upper phase was removed, and the OD420 and OD550 ratio was measured.
In vitro transcription assays.
To analyze the transcriptional compatibility of E. coli
70 and type III secretion system promoters, in vitro transcription reactions were performed. One and a half picomoles of core RNA polymerase or
70 saturated holoenzyme (Epicenter, Madison, WI) and 40 units of RNasin (Promega) were mixed with transcription buffer (200 mM Tris-HCl [pH 7.5], 750 µM KCl, 50 mM MgCl2, 0.05% Triton X-100, and 10 mM dithiothreitol) prior to addition of 50 femtomoles of template DNA. Template DNA consisted of the type III secretion system promoter-lacZ fusion constructs utilized in ß-galactosidase assays. Reactions were incubated at 22°C for 10 min to allow RNAP to bind to DNA before transcription was initiated by addition of 300 µM nucleoside triphosphates with 0.1 mg/ml heparin. Reaction mixtures were incubated at 30°C for 20 min before treatment with 5 units of RQ1 RNase-free DNase (Promega) for 4 h at 37°C. Transcribed RNA was purified according to the manufacturer's protocol (RNeasy Cleanup; QIAGEN).
The amount of transcribed RNA in each reaction was determined by quantitative PCR. cDNA was generated from equal volumes of RNA eluted from each reaction, using a 3' lacZ primer (GGGCGCATCGTAACCGTGCATCTGC) and Superscript III reverse transcriptase according to the manufacturer's protocol (Invitrogen). Quantitative PCR was performed on 1:500 dilutions of cDNA containing 300 nmol of each primer (lacZ RT [5' GCTGGCGTAATAGCGAAGAGG] and 3' TTGAGGGGACGACGACAGTATC) and 2x SYBR green PCR master mix (Applied Biosystems). Threshold fluorescence was established within the geometric phase of exponential amplification, and the CT was determined for each reaction. Fold change in transcript (E
70 versus core RNA polymerase) was determined using the 2
CT method (32).
| RESULTS |
|---|
|
|
|---|
Transcriptional linkage analysis reveals seven type III secretion operons. Detection of RT-PCR products by using primers specific to genes flanking an intergenic region indicates genes that share a common transcript. However, transcripts with extensive 5' and 3' untranslated regions could overlap neighboring genes, causing inaccurate prediction of transcriptional linkage. In E. coli, transcriptional initiation and termination sites are approximately 100 bp upstream or downstream of translational start and stop sites, respectively (4). Information regarding the lengths of chlamydial untranslated regions is limited; however, the chlamydial genome is compact, with small intergenic regions (55). Therefore, primers were designed to amplify regions that correlate to approximately 400 bp on either side of a translational start site to diminish potential false positives.
Transcriptional linkage analysis was performed on the six loci that harbor homologs to the type III secretion system (see Fig. 5) (55). This analysis revealed that within these six loci, seven operons are present (Fig. 1). These operons are comprised of 37 genes and include 13 genes encoding proteins of unknown function (CT560, CT577, CT663 to -668, CT670, CT671, CT716, CT718, and CT863) as well as 4 genes identified as homologs to MalQ (CT087), LpdH (CT557), LipA (CT558), and Pkn5 (CT673). Thus, these gene relationships define 7 operons consisting of coordinately regulated genes.
|
|
|
Given the divergent expression patterns of genes bordering the 5' end of internal operons (CT558-CT559, CT664-CT665, and CT673-CT674), RT-PCR linkage analysis was repeated with an added level of specificity to confirm the presence of a shared parental transcript. cDNA was generated using primers specific for downstream genes compared to random hexamers. PCR of the resulting cDNA produced amplicons of the expected size, and sequencing of these products confirmed that RNA transcripts correlating to these regions are indeed present (data not shown).
Gene expression profiling indicates early type III secretion system expression. EB are prearmed with type III secretion machinery (40) that is likely utilized for host cell entry (7). It has been proposed that other early infectious processes that require type III secretion, such as secretion of inclusion proteins, also utilize preformed type III secretion machinery (16). Global gene expression analyses reported that genes encoding type III secretion structural components are upregulated during the middle to late stages of the developmental cycle as RB-to-EB conversion occurs (2, 16, 43). This supports late-stage gene expression and prearming of EB with functional type III secretion system machinery; however, early expression (6 to 8 hpi) of some structural type III secretion components was also detected. Gene expression profiling of individual type III secretion genes confirmed upregulation of structural components as the developmental cycle progresses (Fig. 2). Additionally, while many expression levels were lower than that of the constitutively expressed reference gyrB, RNAs from all type III secretion machinery genes were detected at 6 hpi (Fig. 2). The presence of transcripts at this time indicates that de novo type III secretion apparatus is synthesized and likely functioning, thereby contributing to early stages of infection.
Chlamydial translocases exhibit independent expression patterns. Translocases are proteins secreted via the type III secretion system that form pores in membranes required for effector molecule delivery (24). Chlamydiae have two loci that encode predicted translocase systems (CT576-CT579 and CT863-CT860). Unlike the shared transcriptional profile for the genes that encode structural components of the type III secretion system, distinct patterns of gene expression were observed for the two translocase loci. Quantitative gene expression analysis indicated that CT863-CT860 transcripts were present at 6 hpi, and levels remained static throughout the developmental cycle. In contrast, very low transcription levels were detected for CT576-CT579 during early time points (6 and 12 hpi), but these increased over 64-fold by 24 hpi, accounting for the largest increase in transcription for all genes analyzed in this study. Similar expression patterns for C. pneumoniae orthologs were reported by Oullette et al. (44). These expression patterns suggest that each translocase system is utilized at different stages in the developmental cycle.
Type III secretion system operons contain
70-like promoter elements.
Sigma factors recognize and bind to DNA-encoded promoter elements located immediately upstream of transcriptional initiation sites. Thus, determination of the 5' end of an mRNA is necessary and sufficient to interrogate the nearby DNA sequence for promoter elements. Moreover, the spacing and sequence of promoter elements can directly implicate a particular
factor as being involved in its gene transcription (19). Chlamydiae encode three
factors,
66,
54, and
28, that recognize distinct promoter elements (55). To identify the chlamydial
factor likely associated with type III secretion system expression, 5' transcript ends of operons were determined and upstream regions analyzed for the presence of promoter motifs.
Based upon operon predictions for the seven major operons and three internal operons, an unambiguous 5' terminus was determined for all except the previously identified CT673-CT674 operon (38) (Fig. 3A). The upstream regions were analyzed for the presence of specific
factor promoter elements. To test whether
70-like promoter elements were present, a neural network algorithm trained with experimentally defined E. coli
70 promoter elements (4) was applied to regions surrounding transcriptional start sites of each operon. With the exception of CT663, E. coli
70-like promoters were predicted computationally for each operon. The scores associated with promoter predictions were high (>0.93 on a scale of 0 to 1) (Fig. 3A). Moreover, these elements correlated with the experimentally defined 5' termini.
|
factor promoter elements. Neither
28 nor
54 promoter motifs were apparent in any of the adjacent upstream regions. Consistent with computational analysis,
70-like elements were evident for all but CT663. Similar to E. coli canonical
70 motifs, 4 to 7 bases upstream of predicted transcriptional start sites, 10 and 35 hexamers separated by 17 to 19 nucleotides were identified (Fig. 3A). These data indicate that
66 directs type III secretion expression, with perhaps the exception of CT663. The mechanism of CT663 initiation was not apparent from this analysis based on the identified 5' terminus. However, computational analysis did predict a transcriptional start site and
70-like promoter 19 bp upstream of the 5' terminus. This may indicate that the 5' end of this transcript is particularly labile and that transcription begins at this site.
Within canonical E. coli
70 promoter motifs, nucleotide variation occurs in 10 and 35 hexamers, although certain bases are present at higher frequencies than others (31). For the 10 region, the first two bases (TA) and the last base (T) occur at the highest frequency in E. coli. Similarly, the first two and last nucleotides are predominantly TA and T in chlamydial 10 promoter regions. The first three bases (TTG) of the 35 region are prevalent in E. coli promoters, and all predicted chlamydial type III secretion system 35 hexamers start with TTG. Thus, the chlamydial 10 and 35 promoter element motifs determined for these operons exhibited nucleotide utilization frequencies similar to those of E. coli
70 promoters (Fig. 3B). Conservation of high-frequency nucleotides within these promoter elements suggests that native
66 promoter requirements may be similar to those of E. coli
70 (50).
E. coli
70 directs transcription of seven chlamydial type III secretion system promoters.
Due to the current lack of a system for genetic exchange in chlamydiae, we analyzed the functionality of the type III secretion promoters within E. coli by using in vitro transcription assays. Based on the similarity of the chlamydial promoters to canonical
70, we tested whether these promoters would direct transcription by E. coli
70. Prior data demonstrated that both E. coli
70 and C. trachomatis
66 initiate transcription from the chlamydial dnaK promoter, which has nearly an exact canonical
70 promoter motif (50). However, a chlamydial promoter with less similarity to
70 was recognized only by C. trachomatis
66 (10). Two approaches were employed to test recognition of chlamydial
70-like promoter elements: determination of promoter-directed ß-galactosidase activity in E. coli and transcription activity in vitro using purified E. coli
70 holoenzyme.
For determination of promoter-directed ß-galactosidase activity, chlamydial promoter elements were placed upstream of the lacZ gene and ß-galactosidase activity was measured during mid-logarithmic growth, which correlates to highest
70 activity (22). Type III secretion promoters resulted in expression of ß-galactosidase activity for most promoters (Fig. 4A). Surprisingly, CT559 and -674, which exhibit close similarity to canonical
70 motifs, promoted activity close to vector control levels. Despite this, these data show that six chlamydial type III secretion system promoters (CT091, -557, -576, -663, -665, and -863) are functional and direct transcription in E. coli. The lack of CT559-, CT674-, and CT719-directed ß-galactosidase activity could be due to many issues, including inhibitory trans-acting factors within E. coli. To diminish potential confounding factors and demonstrate specific recognition of
70 to these promoters, in vitro transcription was performed using promoter-lacZ fusion vectors. Transcription by E. coli core RNA polymerase, free of detectable
70, was compared to that by
70-saturated RNA polymerase. Similar to the results of ß-galactosidase analysis, CT557, CT665, and CT863 were the most active type III secretion system promoters (Fig. 4B). CT674 produced little ß-galactosidase but resulted in
70-directed transcription. In contrast, CT091 exhibited relatively high ß-galactosidase activity but promoted low
70-specific transcription in vitro. These data show that E. coli
70 directed in vitro transcription of five type III secretion system promoters (CT091, -557, -665, -674, and -863).
|
70 system. These data, combined with identification of 5' termini, support that these promoter elements are utilized in vivo. Transcriptional terminators predicted at 3' ends of operons. Identification of transcriptional termination sites, in conjunction with identification of initiation sites and transcriptional linkage analysis, provides support for operon definition. Transcription terminates through Rho-dependent and -independent mechanisms. While Rho-dependent terminators are not identifiable through consensus sequences or structures (46), Rho-independent terminators have been effectively predicted computationally for numerous bacteria (12). This is accomplished through identification of an inverted repeat which forms a stem-loop structure in the mRNA followed by short stretch of uracil residues. In E. coli and Bacillus subtilis, termination structures are frequently located downstream close to the stop codon, usually within 100 bp (9, 30). To ascertain whether Rho-independent terminators were present downstream of predicted type III secretion operons, a computational approach was employed.
Of the 10 predicted transcripts, transcriptional linkage and expression analysis support that three (CT557-CT564 and CT559-CT564, CT663-CT672 and CT665-CT672, and CT673-CT674 and CT674) share a 3' terminus (Fig. 1 and 2). This indicates that seven genes (CT087, -564, -579, -672, -674, -716, and -860) should have a transcriptional termination site downstream of the stop codon. A computational algorithm (TransTerm) was designed and applied to numerous bacteria, including Chlamydia spp (12). This analysis identified Rho-independent terminators downstream of stop codons for CT564, -579, -674, and -860 (Table 1). One of the components for this analysis relies on the free energy (
G) for stem-loop formation for accurate prediction. However, it has been reported that the required
G for stem-loop formation can vary in different bacteria, including Chlamydia (60). In E. coli, the
G for non-stem-loop formation is approximately 11.5 and drops to 16 where termination stem-loops have been discovered. In contrast, this variance is approximately 8 to 12 for the same regions in Chlamydia. This indicates that the
G requirement may be less for functional stem-loop formation in Chlamydia. Therefore, we analyzed the downstream regions for the remaining three genes for inverted repeats that could form potential stem-loop structures. Inverted repeats were identified for CT672 and -716, with stem-loop
G values of 10.9 and 9, respectively, although the 3' tails had few uracils. No stem-loop structures with
G values less than 9 could be predicted for CT860, which may indicate the Rho-dependent termination.
|
| DISCUSSION |
|---|
|
|
|---|
The global organization of type III secretion system genes in chlamydiae is fragmented and rearranged relative to that in other bacteria; nevertheless, this organization is highly conserved among diverse members of the Chlamydiaceae. The type III secretion machineries are multicomponent structures requiring various molar ratios of each protein. Therefore, gene retention within operons should be advantageous, which suggests that the operon organization for the chlamydial type III secretion system facilitates the expression required for developmental stage-specific morphogenesis of chlamydial organisms. This conclusion is consistent with global gene expression patterns indicating that type III secretion system components are differentially regulated during early stages of development and as RB-to-EB conversion occurs.
Expression patterns indicate that in addition to requiring preformed type III secretion machinery for early infection stages, such as entry and inhibition of lysosomal fusion, de novo machinery and associated components are also required. Furthermore, data suggest a functional separation during the developmental cycle for each translocase system. Chlamydiae encounter at least two diverse membranes during the developmental cycle: the host cell plasma and inclusion membranes. Translocases insert into membranes and are required for delivery of effector molecules. Based on expression patterns, we speculate that proteins encoded within CT863-CT860 facilitate delivery of molecules through the inclusion membrane that are necessary to maintain intracellular growth. In contrast, CT576-CT579 translocator expression patterns indicate late developmental stage function interacting with a modified inclusion membrane and/or being packaged into EB for host cell plasma membrane translocation during entry.
Transcriptional initiation is the primary stage for controlling prokaryotic gene expression (3). Sigma factors provide specificity and direct RNA polymerases to initiate transcription at promoter elements located upstream of transcriptional start sites. This study revealed that eight
70-like promoters precede type III secretion operons and, with one exception (CT863-CT860), are differentially expressed during the developmental cycle. Relatively few promoters have been experimentally defined in Chlamydia. Of these, all but three (hctB [65] and CT652.1 and CT683 [38]) most closely resemble
70-like promoters (21). Most of these promoters precede differentially expressed genes, supporting the conclusion that additional regulatory trans-acting factors are required. To date, four trans-acting transcriptional regulators of differentially expressed genes have been described; however, relatively few gene targets are affected (6, 28, 62, 66). With approximately 20% of chlamydial open reading frames differentially expressed during the developmental cycle (43), and with the paucity of alternative sigma factors and apparent gene targets, it is anticipated that global gene regulatory factors for key stages in the developmental cycle remain to be identified.
The functional differences between chlamydial
66 and E. coli
70 have been somewhat enigmatic. This is mainly due to the high conservation of
66 regions that interact with DNA promoter elements (regions 4.2 and 2.4) (27), the presence of
70-like promoter elements in chlamydiae, and the relatively high transcriptional activity exhibited by
66 in vitro to an almost exact
70 consensus promoter (50). Despite the inherent ability, if not preference, for
66 to initiate transcription from
70-like promoters, several chlamydial
70-like promoters are not compatible with E. coli
70 (10, 53). Furthermore, chlamydial
66 has less restriction to promoter sequence structure compared to other
70 vegetative sigma factors, which may contribute to this difference (36, 58). Likely overriding issues are that
66 responds optimally to a promoter structure affected by additional amino- and carboxyl-terminal amino acids (37). These extensions are conserved among chlamydial species (data not shown), and among the abundant
70 protein sequences, only one other has been reported in bacteria (34). Moreover, 50% of E. coli genes require at least one other factor in addition to
for appropriate transcriptional initiation, compensating for promoter degeneration (35). It is expected that chlamydial promoters, especially those of differentially expressed genes, may also require additional trans-acting factors. In E. coli, these factors are likely not compatible with cis-acting elements surrounding chlamydial promoters. These observations emphasize the need for experimental systems that will allow for accurate analysis of promoter elements and trans-acting regulatory factors.
Mechanisms for chlamydial developmental differentiation are poorly understood. Of the identified 10 operons harboring 37 genes associated with type III secretion, 8 were preceded by
70-like promoter elements that were confirmed to be transcriptionally active in a
70-based system. This supports the prediction of functional promoters for type III secretion operons that are regulated by the primary
factor in Chlamydia. Based upon the frequency of chlamydial genes preceded by
66 promoter elements that have expression patterns similar to those of type III secretion genes, trans-acting regulators are likely shared. These observations highlight the potentially critical role of unidentified regulators involved in developmental cycle regulation.
| ACKNOWLEDGMENTS |
|---|
We thank K. Hybiske and S. Dela Cuesta for critical review of the manuscript.
| FOOTNOTES |
|---|
Published ahead of print on 20 October 2006. ![]()
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
Current address: Division of Molecular Biosciences, University of Kansas, Lawrence, KS 66045. ![]()
| REFERENCES |
|---|
|
|
|---|

Ct method. Methods 25:402-408.[CrossRef][Medline]This article has been cited by other articles:
| |||||||||||||||||||||||||