Previous Article | Next Article ![]()
Journal of Bacteriology, January 2007, p. 98-108, Vol. 189, No. 1
0021-9193/07/$08.00+0 doi:10.1128/JB.01347-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Centre for Cellular and Molecular Biology, Hyderabad 500007, India
Received 24 August 2006/ Accepted 16 October 2006
|
|
|---|
|
|
|---|
The most recently identified component of the septal ring is the predicted ABC transporter complex FtsEX (44), encoded by the second and third genes of the ftsYEX operon located at 77 min on the chromosome of E. coli (16). It has been shown that the recruitment of FtsX to the cell septum is dependent on the presence of early division proteins FtsZ, FtsA, and ZipA, whereas the later proteins FtsK, FtsQ, FtsL, and FtsI are in turn dependent on functional FtsEX for their localizations (44). The results of a bacterial two-hybrid analysis for membrane protein interactions have also shown that FtsX interacts with two other components of the divisome, FtsA and FtsQ (22). Mutations in ftsE were earlier isolated as "filamentation temperature sensitive" (fts), and hence, the locus was implicated in cell division (42).
Nevertheless, the classification of ftsE as a cell division gene has been questioned, as the mutants did not show extensive filamentation in minimal medium even at the restrictive temperature (46). An insertion mutant of ftsE is shown to be filamentous and requiring of high concentrations of salt for its viability. Furthermore, FtsE and FtsX are shown to interact and form a putative ABC-type transporter in the cytoplasmic membrane (11). Therefore, ftsE was considered a conditional salt-dependent essential gene and was implicated in salt transport (11). ftsE(Ts) mutants are also shown to be defective in translocating potassium pump proteins into the cytoplasmic membrane at the restrictive temperature, leading to the proposal that FtsE could participate in protein translocation (47). Interestingly, mutations in either ftsE or ftsX exhibit RecA- and LexA-dependent constitutive SOS induction that is indicative of endogenous DNA damage (35).
As the functions of FtsE and FtsX are not well understood, a genetic analysis of suppressors and of synthetic lethal partners of ftsEX was undertaken in this study. The results provide compelling evidence for the involvement of the FtsEX complex in cell division and also for its functional interactions with other division proteins. In addition, it is shown that the viability of ftsEX mutants is contingent on the presence of a periplasmic protein, SufI, that is implicated in cell division, suggesting the existence of functionally redundant or overlapping pathways in the process of cell septation. In light of these results, the possibility of the divisome assembly being intrinsically sensitive to conditions of low osmotic strength and/or high temperature is discussed.
|
|
|---|
lacI) was used as the wild-type strain. The construction of deletion-insertion mutants of ftsEX or sufI is described below. Null mutations in slmA and minCDE (obtained from Piet de Boer) and other division-defective mutations, ftsZ84, ftsA12, ftsK44, ftsQ1, or ftsI23 (from Jon Beckwith's laboratory), were introduced by P1 phage-mediated transduction into various strain backgrounds with the aid of linked antibiotic markers from strains TB85, TB14, DRC14, EC290, TOE44, JOE86, and LMG64, respectively. Phage P1kc was from laboratory stock. The ordered
phage library of the E. coli genome was obtained from K. Isono (25). |
View this table: [in a new window] |
TABLE 1. Strains and plasmids used in this study
|
Construction of a chromosomal ftsEX deletion-insertion mutant. A complete deletion of the ftsEX locus was made on the chromosome by recombineering as described previously (53). A pair of primers having homologies at the 5' end to the flanking region of the ftsEX locus and at 3' end to the sequences of the kanamycin resistance gene cassette (rpoH-Kan, 5'-CCCTGCTACGGAACCCATTGCAGGGAAAGAGTATAACACGCTTTTATTAGAAAAACTCATCGAG CATCAAATG-3', and ftsY-Kan, 5'-AGGCGGACGACTTTATAGAGGCACTTTTTGCCCGAGAGGATTAACATTGTGTCTCAAAATCTCTGATG-3', where italic type indicates the sequences that are homologous to the kanamycin resistance gene of plasmid pUC4K) were employed to amplify the 0.9-kb Kanr cassette using the plasmid pUC4K as the template. The purified linear PCR product with the flanking homologous sequences of ftsEX locus was introduced by electroporation into strain HME63 with or without a plasmid (pMN4) carrying a cloned ftsYEX region. The Kanr transformants were obtained (at 30°C) in both of the strains at equal frequencies (though the Kanr colonies in the strain without the plasmid pMN4 were slow growing and tiny), indicating that this mutant is viable on LB plates at 30°C. The putative ftsEX::Kan deletion-substitution was transferred into a fresh background by P1 transduction. Subsequently, the presence of the deletion was confirmed by PCR amplification using flanking primers (for ftsEXFP, 5'-GGAATTCTTTTTGCCCGAGAGGATTAAC-3', and for ftsEXRP, 5'-GGAATTCAGACCGTGATTTTATCCAC-3') and sequencing the junctions of the deletion-insertion. This ftsEX deletion precisely removes the entire intervening sequence from the start codon of ftsE to the stop codon of ftsX and does not appear to affect the expression of either the upstream gene ftsY or the downstream rpoH gene.
Construction of a chromosomal deletion of sufI.
A 1.1-kb KpnI internal fragment that spans the SufI open reading frame was excised from plasmid pMN18, and in its stead, a 1.0-kb KpnI fragment (from plasmid pKRP11) containing the Kanr gene cassette was ligated. The resulting plasmid, pMN19, thus carries an insertion of Kanr and a deletion of an almost complete sufI gene. The fragment carrying the
sufI::Kan mutation was recombined into the chromosome of the recBC strain JC7623 by linear transformation. A P1 lysate prepared on one Kanr transformant was used to transduce strain MR2, and the presence of the deletion was confirmed by sequence analysis using flanking primers of the sufI gene.
Identification of synthetic lethal partners of ftsEX using a conditional lethal strategy.
Strain MR19 (MG1655
lacI ftsE211::Tn10dCm/pMN2) was subjected to random insertion mutagenesis with transposon Tn10dKan following infection with phage
1316, as described previously (32). Plasmid pMN2 is a derivative of pMA2 (that has a temperature-sensitive pSC101 replicon and the gene encoding the LacI repressor) with a cloned ftsYEX operon. Therefore, MR19 is ftsE+ and lacI+ at 30°C, whereas at 42°C, it lacks ftsE and lacI. Consequently, this strain is white at 30°C and blue at 42°C on X-Gal-containing plates and when the strain is grown in the absence of selection at the semipermissive temperature (37°C), the plasmid pMN2 will be rapidly lost from the cells so that the colonies appear like mosaics with white and blue sectors. On the other hand, if any Kanr transposon insertion mutation causes inviability in this background, then that particular colony would remain white as the blue plasmid-cured cells fail to grow. The Kanr transposon-mutagenized library was therefore screened for colonies that were white on LB-X-Gal plates at 37°C. One such mutant clone was designated MR20. The precise location of the transposon in MR20 was identified by cloning the Kanr insertion along with flanking sequences onto the plasmid vector pCL1920, followed by sequencing the gene junctions with the outwardly directed Kan primers 5'-AGCATTACGCTGACTTGACGG-3' and 5'-GCAATGTAACATCAGAGATT-3'.
Screening for multicopy plasmids that suppress phenotypes of ftsEX mutants. A multicopy plasmid library carrying overlapping E. coli genomic DNA fragments cloned at the BamHI site in a p15A-based plasmid, pACYC184, was obtained from M. Radman's laboratory. The plasmid pool was introduced into strain MR10, and transformants were plated on LBON-Cm plates at 30°C. Plasmids were isolated from colonies that grew to different extents on these plates, and their abilities to suppress were reconfirmed after an additional round of transformation. Subsequent restriction analysis and sequencing (with the flanking vector primers 184TetA [5'CGCCGAAACAAGCGCTCATGAGCC-3'] and 184TetB [5'CTATGCGCACCCGTTCTCGGAGCAC-3']) yielded various classes of plasmids that restored the viability of ftsEX on LBON to different extents. The putative candidate genes from the primary suppressor clones (after eliminating the plasmids carrying ftsEX genes) were further subcloned, and these constructions are described below.
Plasmids.
The fragment carrying the wild-type ftsYEX region was cloned from Kohara phage
612 as a 4.5-kb HindIII fragment into a pSC101-based Spcr plasmid pCL1920 (27) to construct plasmid pMN4. This fragment was also subcloned into an Ampr, pSC101-based, temperature-sensitive plasmid, pMA2, and a pMB1-based, conditional IPTG-dependent, Ampr plasmid, pAM34 (15) to yield pMN2 and pMN6, respectively. The complete ftsQ-ftsA-ftsZ region was subcloned from Kohara phage
111 as a 5-kb PstI fragment into pCL1920 to create pMN8. A 2.9-kb internal NsiI fragment of pMN8 carrying ftsQ and ftsA was cloned at the PstI site of pCL1920 to make pMN9. Plasmid pMN10 with only ftsQ was obtained by digesting pMN8 with HindIII and religation. The plasmid, pMN11 was generated by BamHI digestion and self-ligation of pMN9, so as to retain only ftsA. The plasmid with the ftsAZ region (pMN12) was made by cloning a 4-kb BamHI fragment from pMN8 at the same site of pCL1920. However, all the plasmid clones obtained had the insert in opposite orientation to that of lac promoter of the vector and the expression of ftsA and ftsZ was poor as seen by the partial complementation of the cognate mutants. All of the other plasmid clones (pMN8 to pMN11) efficiently complemented the thermosensitivity of the corresponding mutant strains.
The complete ftsN gene was cloned between PstI and BamHI sites of pCL1920 as a 1.4-kb NsiI-BclI fragment to create pMN14. The 1.2-kb XmaI-PstI fragment-containing sdiA gene, along with its promoter, was subcloned at the cognate sites in pCL1920 to generate pMN15. The sufI gene was cloned as a 1.7-kb SacI fragment from Kohara phage
505 at the same site in pCL1920 to generate pMN16. Plasmid pMN17 is a pACYC184 derivative encoding the N-terminal 411 amino acids of the relA gene product. Plasmids pALS10 and pALS13 carrying relA were obtained from M. Cashel (45). Plasmid pJK537, a pBR322 derivative carrying the dksA gene, was obtained from E. Craig via M. Cashel (21).
Molecular and genetic techniques. Standard protocols were followed for experiments involving recombinant DNA and plasmid manipulations (43). Transpositions, transductions, P1 phage preparations and ß-galactosidase assays were performed using standard methods as described previously (32).
Growth and viability measurements. The viability of each strain was measured by applying 10-µl aliquots of various dilutions (102, 104, 105, 106, and 107) of overnight cultures onto appropriate plates and incubating them, generally for 20 to 36 h. The relative plating efficiency and growth values were determined for each strain based on a comparison with its control strain on the same plate.
Microscopy. The strains to be examined by microscopy were diluted into the appropriate medium from fresh overnight cultures and were processed after 6 to 8 h of growth. They were fixed in 2% formaldehyde for 1 h at 37°C, washed twice with phosphate-buffered saline, and suspended in the same buffer containing 50% glycerol. For the DAPI (4,6-diamidino-2-phenylindole dihydrochloride) staining of nucleoids, fixed cells were treated with 0.25 µg/ml DAPI for 15 min at room temperature and mounted on slides. Differential interference contrast (DIC) and fluorescence images were taken using a Zeiss Axioplan fluorescence microscope and processed in Adobe Photoshop.
|
|
|---|
ftsEX mutant strain.
In order to study the phenotypes of the ftsEX mutant strain, a complete deletion of the ftsEX region was made on the chromosome of strain MR2 (MG1655
lacI) as described in Materials and Methods. This strain, MR10 (MR2
ftsEX210::Kan), grew well on LB medium (with 1% NaCl) forming healthy colonies at 30°C, whereas at 37°C or 42°C, the colonies were very tiny and sick (Fig. 1A). Similarly, it exhibited mild elongation of cells at 30°C, which became very extensive at higher temperatures (Fig. 1B). However, this mutant did not grow on LB without NaCl (LBON) at any temperature, possibly due to excessive lethal filamentation (Fig. 2A, B, and C). Supplementation with any of a variety of osmolytes, such as glucose, sucrose, glycerol, or NaCl, completely rescued the growth of MR10 on LBON medium (Fig. 2A, B, and C). Though the growth of strain MR10 was completely inhibited on LBON plates (Fig. 2A), the cultures grown in LBON broth showed an initial increase in cell mass, as seen by the slow and gradual increase in optical density (optical density at 600 nm of
1) before the cessation of growth (Fig. 2B), and at this stage, the culture was extremely filamentous (Fig. 2C). The osmotic requirement did not appear to cause cell death in these mutants, as the addition of the osmolytes restored growth to an inhibited late-stage culture in LBON (data not shown). The filaments of ftsEX mutant grown in LB at 42°C or in LBON at 30°C were very long and appeared to have elongated cells (Fig. 1B and 2C). The visualization of the nucleoids by DAPI staining, followed by fluorescence microscopy, revealed that they are normal and regularly spaced without any significant chromosomal aberrations or partition defects (Fig. 2D).
![]() View larger version (45K): [in a new window] |
FIG. 1. Growth and filamentation of ftsEX mutants. (A) Growth of the wild type (wt) and of ftsEX mutants on LB at different temperatures. (B) DIC micrographs of cells grown in LB broth at different temperatures.
|
![]() View larger version (47K): [in a new window] |
FIG. 2. Growth and filamentation of ftsEX mutants. (A) Growth of the wild type (wt) and ftsEX mutants on LBON plates supplemented with 0.4 M osmolytes. (B) Growth of MR10 ( ftsEX210::Kan) in LBON broth (diamonds), LBON supplemented with either 0.4 M glucose (closed circles) or 0.4 M NaCl (open circles) at 30°C. OD600, optical density at 600 nm. (C) DIC micrographs of cells grown in LB without NaCl or with added osmolytes at 30°C. (D) DIC micrograph of a single filament of the ftsEX mutant and the corresponding fluorescence image after DAPI staining.
|
Identification of multicopy suppressors of ftsEX. To understand the basis of ftsEX phenotypes, multicopy suppressor plasmids that restored viability to these mutants on low-osmolarity medium were identified (see Materials and Methods). Briefly, strain MR10 was transformed with a multicopy plasmid library, plasmids that conferred growth on LBON were isolated, and the candidate genes responsible for the growth rescue were identified. The extent of suppression by each of these plasmids was rather variable (Fig. 3A and B). Some of the candidate genes that suppressed encode (i) SdiA, a transcriptional activator of the ftsQ-ftsA-ftsZ operon (51); (ii) RelA, a 411-amino-acid, N-terminal fragment of ppGpp synthetase I (8); and (iii) DksA, a potentiator of ppGpp response identified earlier as a multicopy suppressor of dnaK null mutations (21, 36). The suppression shown by plasmids encoding SdiA or DksA was fairly efficient (Fig. 3A) compared to the suppression with RelA plasmid, which was extremely weak (data not shown). The plasmids pALS10 or pALS13, encoding the full length or N-terminal 455 amino acids of the relA product, respectively (45) also partially suppressed the ftsEX phenotypes (data not shown). As all of these factors are implicated in the positive regulation of the expression of the ftsQ-ftsA-ftsZ (ftsQAZ) operon either directly or indirectly (20, 39), the effect of ftsQAZ overexpression on the viability of ftsEX was examined.
![]() View larger version (64K): [in a new window] |
FIG. 3. Effect of multicopy suppressor plasmids on growth of ftsEX. (A) Cultures of ftsEX carrying vector pCL1920 or its derivatives with cloned ftsYEX, ftsN, ftsQAZ, and sdiA genes or plasmid pJK537 (pBR322 with dksA) are grown at 30°C in LB, and 10-µl aliquots of various dilutions (102, 104, 105, 106, and 107) are applied on LBON plates and grown for 32 h at 30°C. (B) DIC micrographs of the same cells grown in LBON to midexponential phase at 30°C.
|
111 of the Kohara phage library onto plasmid vector pCL1920 to create pMN8. This plasmid abolished the growth defects of ftsEX and made these mutant cells less filamentous but not completely normal in LBON at 30°C (Fig. 3A and B). To identify the division component(s) responsible for the suppression, the QAZ region was further subcloned. A plasmid carrying ftsQ (pMN10) alone did not suppress the defect, whereas plasmids carrying ftsQA (pMN9) or ftsA (pMN11) could not be introduced into the
ftsEX mutant. A plasmid carrying the ftsAZ region (pMN12) improved the growth of ftsEX on LB at high temperatures marginally but did not support growth on LBON. This could possibly be due to the poor transcription (as this fragment lacks any promoter) of these two genes. Consistent with this possibility, plasmid pMN12 showed weak complementation of ftsA12 and ftsZ84 mutants. The plasmid carrying only ftsZ could not be constructed in this vector, even after repeated attempts. All of these results indicated that the increased coexpression of divisome components FtsQ, FtsA, and FtsZ eliminates the need for FtsEX on medium of low osmolarity. Multicopy FtsN restores viability to ftsEX. The screen for the identification of multicopy suppressors yielded a class of plasmids that suppressed the inviability of ftsEX on LBON very effectively. All of these clones had a complete FtsN open reading frame along with some adjoining gene fragments. A plasmid construct of pCL1920 carrying only the subcloned ftsN (pMN14) gene efficiently suppressed the growth defects and filamentation (Fig. 3A and B), demonstrating that FtsN in multicopy can suppress the division defects of ftsEX in addition to partially suppressing the thermosensitivity of other division-defective mutations in ftsA, ftsQ, and ftsI (9). Though all of the above-mentioned multicopy plasmids rescued the growth of ftsEX mutants on LBON at 30°C to variable extents, only pMN14 was effective in restoring viability on LBON at 42°C (data not shown).
ftsEX exacerbates the defects of most division mutants.
The effect of ftsEX deletion on the growth of other temperature-sensitive cell division mutants was examined. Mutations in division genes, such as ftsZ84, ftsA12, ftsK44, ftsQ1, or ftsI23, were introduced into strain MR11 (
ftsEX210::Kan/pMN6) by phage P1-mediated transductions and selected for the linked leuB::Tn10 antibiotic marker. Plasmid pMN6 is a pAM34 derivative (with an IPTG-dependent replicon) (Table 1) carrying a cloned ftsYEX operon. Hence, with IPTG supplementation, strain MR11 is ftsEX+ and, without IPTG, it lacks ftsEX. The cultures of the double-mutant strains carrying pMN6 were grown with IPTG supplementation, and viability measurements were taken at 30°C (Fig. 4A). On plates without IPTG, the ftsEX single mutant grew well, whereas the double mutants carrying ftsA12, ftsK44, ftsQ1, and ftsI23 alleles showed reduced viability. On the other hand, all of these strains grew well on IPTG-supplemented plates, showing that the single temperature-sensitive division mutants had no growth defects on such plates. Increasing the osmolarity of the medium by the addition of either glucose or NaCl relieved growth inhibition completely in the case of ftsA, ftsK, or ftsQ mutants, but not of ftsI23 mutants, because the growth of the ftsI23 single mutant itself was significantly inhibited on these plates. It was observed during the course of this study that, as opposed to all of the other temperature-sensitive division mutants (such as ftsZ84, ftsA12, ftsQ1, and ftsK44 mutants), ftsI23 mutants grew well on medium lacking NaCl (LBON) at all temperatures and they were extremely sensitive to high osmolarity, even at a permissive temperature (data not shown).
![]() View larger version (99K): [in a new window] |
FIG. 4. Effect of ftsEX deletion on division-defective mutations. (A) Growth of strain MR11 ( ftsEX210::Kan/pMN6) and its mutant derivatives on LB-Amp-IPTG, LB, or LB supplemented with 0.4 M glucose at 30°C. (B) Growth of ftsEX and ftsEX ftsZ84 mutants. Cultures are grown in LB at 30°C, and 10 µl of various dilutions are spotted on LBON (the plate incubated at 37°C has 102, 104, and 105 dilutions) or LB plates, followed by incubation at 30°C or 37°C for 32 h. (C) DIC micrographs of the cultures grown in LB at 37°C.
|
In addition, mutations in ftsE conferred extreme sickness to strains carrying a deletion of the slmA gene that codes for nucleoid occlusion protein and also to a mutant deleted for minCDE. Again, the growth defects of the double mutants were suppressed by elevating the medium osmolarity (Fig. 4A). All of the above inviabilities were also abrogated by increased levels of FtsQAZ or FtsN (data not shown). In summary, the absence of ftsEX is detrimental to the mutants that are already compromised for cell division (except the ftsZ84 mutant) and increasing the medium osmolarity or the amount of other division proteins abolishes the requirement of FtsEX.
Identification of mutations that are synthetically lethal with ftsE. The viability of ftsEX mutants on high-osmolarity medium suggested the possible presence of another division protein with an overlapping function. Therefore, to identify the gene products that are essential for the growth of ftsE mutants on LB plates, a genetic screen for the isolation of synthetic lethal mutations of ftsE was employed as described in Materials and Methods. One Kanr insertion mutation that conferred inviability to the ftsE mutant was identified using this screen. The insertion was found to disrupt the 171-amino-acid-encoding tatB gene after codon 144; thus, it most likely affected the formation of functional TatABC translocase. The tatB::Tn10dKan mutation was transferred to strain MR14 (ftsE211::Tn10dCm/pMN6), and the growth characteristics of the double mutant were compared on medium with or without IPTG. As shown in Fig. 5A, all of the strains grew well on IPTG-supplemented plates, whereas on plates without IPTG, the double mutants did not grow.
![]() View larger version (48K): [in a new window] |
FIG. 5. Interactions of ftsE with sufI. (A) Synthetic lethal mutants of ftsE. Growth of ftsE sufI or ftsE tatB mutants carrying plasmid pMN6. Cultures were grown with IPTG and dilutions were spotted on LB-Amp-IPTG, LB, or LB-glucose plates. (B) Effect of multicopy sufI on the growth and filamentation of ftsEX mutants.
|
Division defects of ftsEX mutants are abolished by multicopy SufI.
The reduced viability of sufI ftsE double mutants suggested that both gene products may perform an essential and overlapping function during the process of cell division. Therefore, whether multiple copies of SufI would compensate for the absence of FtsEX was examined. Hence, the wild-type sufI gene, along with its native promoter, was cloned into pCL1920 (pMN16) from Kohara phage
505 and transformed into strain MR10. As shown in Fig. 5B, strain MR10 with vector alone did not grow on LBON plates, whereas the plasmid pMN16 conferred total viability. The filamentation of strain MR10/pMN16 completely disappeared, and cells regained their shape (Fig. 5B). The plasmid pMN16 also abrogated the temperature sensitivity of the ftsI23 mutant as reported earlier (23; data not shown). To summarize, increased SufI levels conferred growth to ftsEX mutants on LBON, whereas deleting both ftsE and sufI was detrimental to the cell. In addition, the plasmid pMN16 did not suppress the inviability of tatB ftsE double mutants, confirming that a functional Tat transport system is needed for the export of SufI, and it is the periplasmic SufI that is required for the suppression of ftsEX phenotypes (data not shown).
SOS induction of ftsEX mutants. Insertions in ftsE and ftsX were isolated earlier as weak SOS-inducing mutations in a screen employed for the identification of constitutive SOS-inducing mutations (35). In this study also, it was shown that ftsEX null mutations exhibit a low-level SOS induction (which is dependent on RecA and LexA), as measured by the expression of a ß-galactosidase reporter gene fused to a DNA damage-inducible promoter dinD (Table 2). This observation indicates the occurrence of endogenous DNA damage in these mutants that leads to the generation of single-stranded DNA, which is the signal for the induction of SOS response. Interestingly, this induction was not suppressed by either the addition of osmolytes or the introduction of multicopy plasmids encoding FtsQAZ, FtsN, or SufI (Table 2). In an earlier study, it was shown that the inactivation of FtsI either by treatment with ß-lactam antibiotics or by temperature upshift of the ftsI23(Ts) allele induces the DNA damage response through the DpiBA two-component signal transduction system (31). The researchers of that study suggested that defective cell wall synthesis is an initiator of SOS response, which is dependent on functional dpiA, recA, or lexA genes. It is tempting to speculate that the SOS induction observed in ftsEX strains could be due to a similar kind of membrane damage. However, in this study, the effect of dpiA or dpiB mutations on the SOS induction of ftsEX mutants was not examined. Though ftsEX mutants exhibit SOS induction and, therefore, would contain induced levels of SulA, which is an inhibitor of FtsZ, the growth or filamentation of ftsEX strains was not affected by a mutation in sulA (data not shown). On the other hand, the sufI deletion strain did not exhibit a significant increase in SOS induction levels (Table 2).
|
View this table: [in a new window] |
TABLE 2. ß-Galactosidase expression levels
|
|
|
|---|
Involvement of FtsEX in cell division. The extreme filamentation of the ftsEX deletion strain in LBON or in LB at higher temperatures (Fig. 1B and 2C) suggests that this mutant is defective in the process of cell division (references 11, 16, 42, and 44 and this study). Similarly, the growth pattern of the ftsEX mutant in LBON broth with an increase in cell mass for a few generations, followed by growth cessation (Fig. 2B), also indicates that FtsEX is required for cell division but not for growth. However, this observation contradicts an earlier study (44), wherein it was shown that the growth of strain RG60 stops immediately and completely after shift to the LBON broth, thereby suggesting that FtsEX is needed for both growth and division. The reason for this variation is not obvious, though it could be due to differences either in the strain background or in the composition of the growth medium that was used. The division phenotypes of ftsEX mutants are partly suppressed by multiple copies of ftsQAZ. There are quite a few instances of ftsQAZ overexpression suppressing the division defects. Recently, it was shown that the deficiency of FtsK could be compensated by increasing the levels of FtsQAZ (13). Similarly, the growth defects of minCDE envC or minCDE slmA double mutants are suppressed by pftsQAZ (3, 4). Null mutations in the cell shape gene pbpA can be obtained in strains with elevated FtsQAZ levels (50). The suppression of ftsEX growth defects by multicopy plasmids encoding SdiA or RelA could also be through the upregulation of ftsQAZ (20, 39, 51). The function of DksA is not very clear, though it is implicated in altering the strength of the promoters that are regulated by ppGpp (36). The preliminary results from this lab show that the suppression by multicopy DksA is not mediated by RelA; introducing a relA251::Kan mutation into an ftsE::Tn10dCm/pdksA strain does not abolish the growth suppression on LBON (data not shown).
The suppression of ftsEX phenotypes by multicopy FtsN strongly argues for the functional involvement of the FtsEX complex in the division process. FtsN is a multicopy suppressor of most of the temperature-sensitive division mutants, such as ftsA12, ftsQ1, ftsI23, and ftsK44, but not of ftsZ84 (9, 17). The biochemical function of FtsN is not clear; in vitro it binds murein sacculus (48) and is presumed to be involved in either the peptidoglycan assembly or the stabilization of the division components.
There is evidence to indicate that there are complex interactions between FtsEX and other division proteins, and it is discussed below. The observation that low-copy-number plasmids carrying ftsA or ftsQA genes could not be introduced into the ftsEX mutant (but which can be transformed into wild-type strains without any difficulty) suggests that there are physical and functional interactions between these division proteins. In the absence of FtsEX, even a subtle increase in FtsA levels may cause an imbalance of the FtsA-to-FtsZ ratio. It is known that the ratio of FtsA to FtsZ is a crucial factor in deciding the fate of Z rings even in normal cells (reviewed in reference 29). There could be a defective assembly of the division components, as more FtsA can cause aberrant Z rings due to the absence of either a coordinate increase in FtsZ levels or a functional FtsEX. Hence, it is possible that FtsEX could be modulating the interaction of the FtsZ-FtsA complex. This model also explains the suppression of ftsEX mutations by ftsZ84 allele. The suppression of ftsEX phenotypes by ftsZ84 is intriguing and implies that functional FtsZ generates a requirement for FtsEX. In other words, the defective ftsZ84 allele can bypass the need for FtsEX, at least partially, most likely by reducing the flux into the division pathway, thus eliminating the requirement for FtsEX in low-osmotic-strength medium. Alternatively, FtsEX may stabilize the interaction between the Z ring scaffold and the FtsQLB complex, particularly in low-osmolarity conditions. This is consistent with the earlier finding that the localization of the FtsEX complex to the septal ring is dependent on the presence of early divisomal proteins, FtsZ and FtsA. Due to this reason, FtsEX was placed between FtsA and FtsQ in the linear recruitment pathway (44). FtsX was also shown to interact with FtsA and FtsQ in two-hybrid studies (22), suggesting that it may bind or connect the Z ring to the periplasmic connector consisting of FtsQLB complex. All of these observations taken together suggest a role for FtsEX in the stabilization of FtsZ ring. It has been proposed earlier (44) that FtsEX is important for the assembly or stability of the septal ring, especially in salt-free medium. Normally, this interaction could be dependent on the osmotic strength of the local environment and, in absence of optimal osmotic conditions, FtsEX would be absolutely required for proper assembly. Since the divisome assembly is based mostly on protein-protein interactions, it is plausible that appropriate osmotic conditions are required for the correct folding of this multiprotein complex. As proposed earlier (13), division proteins may perform two main functions; one is to stabilize the interactions between divisome components, and the second one is to generate the division septum. FtsEX may fall into the former class of divisome proteins. In this context, it is worth noting that organisms of the Mycobacterium tuberculosis complex do not have either zipA, ftsA, or ftsN homologues but have ftsEX genes (30, 33). It would be interesting to examine whether the FtsEX complex would be essential for cell division and growth in these organisms.
It is also feasible that the FtsEX complex could function as an assembly protein; it may facilitate the assembly of division components as well as other proteins that are targeted to the cytoplasmic membrane. This may explain the inability of an ftsE(Ts) mutant to translocate the potassium pump proteins into the inner membrane (47). The ftsX mutants of Flavobacterium johnsoniae are deficient in gliding motility, and this again may reflect their incapability to assemble some essential factors required for motility (24). The expression of ftsE is shown to be upregulated in Corynebacterium glutamicum after treatment with the cell-wall-inhibitory agent ethambutol (40), suggesting that FtsE could be a stress-induced protein. However, in E. coli, the expression of ftsEX (either from the major promoter that is upstream to ftsY or from the weak internal promoter of ftsE and ftsX) does not appear to be transcriptionally regulated either by conditions of stress, such as DNA damage, oxidative stress, altered osmolarity, and high temperature, or by the absence of global regulators like RpoS, H-NS, Fis, or LexA (M. Reddy, unpublished results).
Redundancy of FtsEX and SufI in cell division. As FtsEX is not essential for growth on medium of high osmolarity, there was a possibility of the existence of another protein performing a related or overlapping function. The identification of sufI as a synthetic lethal mutation of ftsEX permitted the inference that SufI could be such a potential candidate protein. However, the inviability of ftsEX mutants (with a functional copy of SufI) in medium of low osmotic strength raises the question of the role of SufI in these conditions. One explanation for this could be that in low-osmolarity conditions, SufI may not be functional or is limiting. The fact that the increased level of SufI was able to suppress most of the mutant phenotypes of ftsEX favors the latter possibility. Since the sufI mutation is epistatic to multicopy ftsN and ftsQAZ (as sufI ftsE inviability was not abrogated by these multicopy plasmids), it indicates that the latter are acting through the SufI pathway in achieving division in absence of FtsEX.
Is the process of cell division sensitive to conditions of low osmotic strength and/or high temperature? The fact that most of the point mutations in various division genes are osmoremedial and also that the occurrence of osmoremedial null mutations in genes involved in cell division reflects that perhaps the process of division itself is intrinsically sensitive to conditions of low osmotic strength. ftsZ84, the best-characterized mutation of ftsZ, is osmoremedial at a high temperature (37, 39). In addition, other temperature-sensitive division mutations, such as ftsA12, ftsQ1, ftsK44, and ftsI23, are also sensitive to variations in the osmotic strength of the medium. The existence of osmoremedial null mutations, such as ftsEX, affected in division is also a strong indication that this pathway is dependent on high osmotic strength. In addition to ftsEX mutations, an insertion mutation in ftsK (that disrupts FtsK after codon 233 in the linker region) was found to be osmoremedial (M. Reddy, unpublished results). The phenotypes of this strain were quite similar to that of an ftsEX mutant, i.e., it did not grow on LBON at any temperature but grew normally on LB at 30°C and very poorly at 42°C. In addition, a mutation in the yhhP gene that codes for an 81-amino-acid, putative RNA binding, SirA-like protein was shown to confer extreme filamentation and was also osmoremedial (19). Their results implicate a role for yhhP in division, as its phenotypes were suppressed either by increased osmolarity or by multiple copies of FtsZ or DksA (19). Taken together, all of these findings suggest that the assembly of cell division machinery may require optimal conditions of osmotic strength, as the divisome is essentially a large multiprotein complex tethered by mostly protein-protein interactions. In the absence of optimal osmotic strength, the division components may require additional proteins for their stability or assembly. High temperature may also affect the hydrophobic protein-protein interactions of the divisomal assembly and may therefore alter its stability, particularly in low-osmolar conditions. Consistent with this, the growth patterns of the above-mentioned osmoremedial mutations reflect the increased dependence of osmotic strength at high temperatures (Fig. 1). However, it is also possible that the osmotic strength or temperature may alter the activity of chaperones which facilitate the proper folding of the division proteins and, thus, their effect on division could be indirect. It has been shown earlier that the process of protein export itself is cold sensitive (38). Based on the existence of multiple cold-sensitive mutations in various secretion genes and also cold-sensitive ribosomal null mutations, the cold sensitivity of the secretion process was postulated. The process of cell division could be similarly susceptible to changes in the osmotic conditions of the medium.
This work was supported in part by funds from the Department of Biotechnology, Government of India.
Published ahead of print on 27 October 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»