Journal of Bacteriology, June 2007, p. 4315-4319, Vol. 189, No. 11
0021-9193/07/$08.00+0 doi:10.1128/JB.01789-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Interspecies DNA Microarray Analysis Identifies WblA as a Pleiotropic Down-Regulator of Antibiotic Biosynthesis in Streptomyces
,
Seung-Hoon Kang,1,
Jianqiang Huang,2,
Han-Na Lee,1
Yoon-Ah Hur,1
Stanley N. Cohen,2* and
Eung-Soo Kim1*
Department of Biological Engineering, Inha University, Incheon 402-751, Korea,1
Department of Genetics, Stanford University School of Medicine, Stanford, California 943052
Received 27 November 2006/
Accepted 26 March 2007
 |
ABSTRACT
|
|---|
Using Streptomyces coelicolor microarrays to discover regulators of gene expression in other Streptomyces species, we identified wblA, a whiB-like gene encoding a putative transcription factor, as a down-regulator of doxorubicin biosynthesis in Streptomyces peucetius. Further analysis revealed that wblA functions pleiotropically to control antibiotic production and morphological differentiation in streptomycetes. Our results reveal a novel biological role for wblA and show the utility of interspecies microarray analysis for the investigation of streptomycete gene expression.
 |
TEXT
|
|---|
Doxorubicin is a clinically very important anticancer drug that belongs to a structural family of type II polyketide compounds generated by Streptomyces peucetius var. caesius, a gram-positive soil bacterium with high G+C content (1, 11, 18). Like the biosynthesis of other secondary metabolites in Streptomyces species, the synthesis of doxorubicin is believed to be tightly regulated, thereby limiting doxorubicin production in wild-type-S. peucetius cultures (6, 12, 17). Traditional strain improvement via recursive random mutagenesis has been used to increase doxorubicin synthesis, although the molecular genetic basis underlying such enhanced production remains largely unknown (13, 14, 15, 18).
Recently, "omics"-guided technologies, including cDNA microarrays, have been applied for the identification of gene expression alterations associated with overproduction of secondary metabolites in industrial strains. While analysis of transcriptional changes in erythromycin-producing Saccharopolyspora erythraea and tylosin-producing Streptomyces fradiae by use of sequenced Streptomyces coelicolor cDNA microarrays (10) has revealed differences in the transcriptomes between the wild type and the industrial overproducer, genes whose perturbation significantly affected productivity were not verified experimentally (10). In this brief communication, we report the identification of a previously unknown down-regulator gene via comparisons of gene transcription profiles by use of DNA microarrays. Overexpression of this gene, wblA, which has 50% identity in a 64-amino-acid overlap with the developmentally important whiB gene of S. coelicolor, inhibited the biosynthesis of doxorubicin in S. peucetius as well as the production of antibiotics in S. coelicolor, suggesting that wblA and its homologs act globally among streptomycetes as down-regulators of antibiotic biosynthesis.
The recursively mutated doxorubicin-overproducing S. peucetius industrial mutant strain (generously provided by the Boryung Pharmaceutical Company, Korea) and the wild-type S. peucetius strain (S. peucetius subsp. caesius ATCC 27952, purchased from the American Type Culture Collection) were grown in shake flask cultures in ND medium containing yeast extract (NDYE) (4). Both the supernatant and the cell pellet samples were harvested during a 10-day culture period, followed by high-performance liquid chromatography analysis for doxorubicin concentration and densitometry measurements of cell growth (9, 13). Whereas S. peucetius wild-type and mutant cells grew at similar rates, the wild-type cells produced no detectable doxorubicin while the industrial mutant strain produced approximately 20 to 30 mg/liter of doxorubicin (Fig. 1). In order to identify possible transcriptional differences between the wild type and the mutant, total RNA isolated from samples taken from cultures at five different growth stages (Fig. 1C and D) was investigated by cDNA microarray analysis. As the genomic sequence of the S. peucetius genome is not publicly available, S. coelicolor cDNA microarrays and mini-cDNA chips containing 40 genes that correspond to doxorubicin pathway genes of S. peucetius were employed for evaluation of the S. peucetius transcriptome (5, 9, 10).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1. (A) The S. peucetius wild type (upper-left panel) and the doxorubicin-overproducing industrial mutant (lower-left panel) were grown in an NDYE liquid culture for 6 days and an NDYE plate culture for 8 days (right panel, wild type at left and mutant at right). The recursively mutated industrial S. peucetius strain (generously provided by the Boryung Pharmaceutical Company, Korea) and the wild-type S. peucetius strain (S. peucetius subsp. caesius ATCC 27952, purchased from the American Type Culture Collection) were grown in shake flask cultures in NDYE, maintained in 20% glycerol stock solutions, and stored at 20°C (13). (B) Growth phase-dependent volumetric productivity of doxorubicin by the S. peucetius strains. Standard doxorubicin was purchased from Sigma-Aldrich (St. Louis, MO), and the high-performance liquid chromatography assay has been described elsewhere (13). ND, no detection of doxorubicin. (C) S. peucetius wild-type growth curve and RNA sampling time points. (D) S. peucetius industrial mutant growth curve and RNA sampling time points. OD600, optical density at 600 nm.
|
|
Daunorubicin production typically is initiated when the optical density at 600 nm of cultures exceeds 1. For growth phase-dependent microarray hybridizations, the time zero samples at an approximate optical density at 600 nm of 1 were labeled with Cy3 fluorescent dye (green). All samples from later time points were labeled with Cy5 dye (red) and cohybridized with the time zero sample for the same strain (Fig. 2, first and second columns). Wild-type cDNA samples labeled with Cy3 and industrial mutant samples labeled with Cy5, both of which were isolated at the same time point, were also directly compared (Fig. 2, third columns). In contrast to the late induction observed for most doxorubicin pathway genes in wild-type cultures, high expression of these genes was observed for mutant cells, beginning at the exponential growth phase of the mutant (Fig. 2A). Moreover, genes previously found to be involved in doxorubicin resistance, including drrA, drrB, and drrC, exhibited an even higher level of expression at later time points, possibly aiding resistance of doxorubicin-producing cells to the doxorubicin that accumulates in the mutant cultures (Fig. 2A). Such early and steady expression of pathway genes observed here has been observed previously with other antibiotic-overproducing mutant strains (8, 10).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2. (A) S. peucetius microarray analysis of doxorubicin pathway genes, carried out by use of an S. peucetius doxorubicin pathway chip in both the wild-type and the industrial mutant strains. The doxorubicin pathway chips have been described elsewhere (9). The growth phase-dependent transcription profiles of the wild-type (first column) and the mutant (second column) strains and the Cy3-labeled (green) T0 sample were used as references for each time course with the Cy5-labeled (red) samples. The wild-type (green) and industrial mutant (red) samples, both of which were isolated at the same time points, T0 and T1, were then cohybridized with one another (third column). (B and C) S. coelicolor microarray data showing 10 up-regulated (B) and 10 down-regulated (C) genes based on the S. coelicolor whole genome chip in both the wild-type and the industrial mutant strains. The sequenced S. coelicolor genome chips have been described elsewhere (2, 5). The growth phase-dependent transcription profiles of the wild-type strain (first columns) and the mutant strain (second columns) and the T0 sample were used as references for each time course. The wild-type (green) and industrial mutant (red) samples, both of which were isolated at the same time points, T0, T1, and T2, were then cohybridized with one another (third columns). The putative positive (SCO5147) and negative (wblA) regulatory genes are marked by a blue and a red star, respectively. The DNA chips were then scanned with a Genepix Personal 4100A system, and the data were grouped by a hierarchical clustering method (5). ECF, extracytoplasmic function; CoA, coenzyme A. Time points are designated as in Fig. 1C and D.
|
|
To detect global changes in mRNA abundance associated with overproduction of doxorubicin in S. peucetius, comparative transcriptome analyses of cultures of the wild-type and mutant strains of S. peucetius were conducted using S. coelicolor cDNA microarrays containing targets of known sequence. Initially, approximately 160 S. coelicolor potential candidate genes showing at least a twofold change in transcription between the wild-type and mutant strains in at least one time point were identified (see Fig. S1 in the supplemental material). After further analyses of the growth phase-dependent transcription profiles of these potential candidate genes, 20 genes showing particularly large transcriptional changes between two strains were selected (Fig. 2B and C) and individually overexpressed in S. coelicolor under the control of a constitutively active mutant ermE promoter from Saccharopolyspora erythraea (4) that had been introduced into the pES34 Streptomyces expression vector (see Fig. S2 in the supplemental material). Among these genes, SCO5147, as a putative positive regulator, induced the most prominent increase in production of the blue-pigment antibiotic actinorhodin. The greatest decrease in actinorhodin expression was observed with cells expressing SCO3579 (Fig. 3A). Expression of the S. peucetius homolog of SCO5147 in the S. peucetius industrial mutant strain was fourfold higher than that in the S. peucetius wild-type strain at the T3 time point (Fig. 2B), whereas the S. peucetius homolog of SCO3579 was repressed in the industrial mutant strain by 50% (Fig. 2C). Real-time reverse transcription PCR (RT-PCR) targeting these two potential regulatory genes in the S. peucetius strains confirmed the transcriptional perturbations observed by microarray analysis (data not shown).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 3. (A) R2-yeast extract plate cultures of S. coelicolor transformants harboring the empty expression vector pSE34 alone (top, white star) or overexpressing SCO5147 (right, blue star) or wblA (left, red star). (B) NDYE plate cultures of the S. peucetius mutant strains harboring the expression vector pSE34 alone (top, white star), SCO5147 (right, blue star), or wblA (left, red star). (C) Gene expression analysis of the actII-ORF4, redD, redZ, and cdaR genes by RT-PCR. Lane M, 100-bp size marker; lanes 1 and 2, actII-ORF4; lanes 3 and 4, redD; lanes 5 and 6, redZ; lanes 7 and 8, cdaR; lanes 9 and 10, wlbA; lanes 11 and 12, rRNA genes; odd-numbered lanes, RT-PCR with total RNA from S. coelicolor transformants harboring the vector pSE34; even-numbered lanes, RT-PCR with total RNA from S. coelicolor transformants overexpressing wblA. Only the DNA fragment containing a ribosome binding site (RBS) and the open translateral reading frame of wblA without its own promoter was cloned under the ermE* promoter, leading to the increased expression of ermE*-driven wblA in a high-copy-number pSE34 plasmid. Each primer pair (20-mer) was designed to generate a PCR product of approximately 150 to 250 bp. RT-PCR primer sequence pairs (5' to 3') were as follows: for rRNA genes, GACTCCTACGGGAGGCAGCA and CGCCCAATAATTCCGGACAA; for actII-ORF4, TCCCTGGTAATTTCGCATCC and CCATGTGCATACGCTGGATT; for redD, CCCTGGAGGATCTCATCAGC and GTACGACTCCAGGGCGTCTC; for redZ, ACGTCGGTCGAAGAACTGGT and GAGGAGGACTTCCGTTTCCC; and for cdaR, CCATCGAAGAGATCGGTCTTG and GCTACGCCCGATGAAGTAGG. (D) Plasmid map of the Streptomyces pSE34-based expression vector (white star) and two putative regulatory genes SCO5147 (blue star) and wblA (red star).
|
|
The putative positive regulatory gene SCO5147 has previously been classified as one of the 50 extracytoplasmic function subfamily sigma factor genes present in the genome of S. coelicolor. Its biological role has not been determined (http://streptomyces.org.uk/), although our inability to delete it in S. coelicolor suggests that its function is essential to bacterial viability (J. Huang et al., unpublished data). The putative negative regulatory gene SCO3579 was previously proposed to be a whiB-like putative transcription factor gene named wblA in S. coelicolor (http://streptomyces.org.uk/) (16). Although whiB is a developmental regulatory gene identified and characterized in S. coelicolor as being essential for sporulation of aerial hyphae, the biological function of wblA with regard to secondary metabolite regulation has not been determined previously (16).
To examine directly the biological effects of these two potential candidate genes on doxorubicin overproduction, the S. coelicolor SCO5147 and wblA genes cloned in pES34 were each introduced into the S. peucetius mutant strain by transformation. While constitutive expression of the SCO5147 gene in the mutant was associated in some experiments with a further increase in doxorubicin production in liquid cultures, this positive effect was not consistently observed with liquid cultures and was not detected at all with plate cultures (Fig. 3B). Additionally, introduction of a multicopy plasmid carrying the positive regulatory gene SCO5147 into the wild-type S. peucetius strain (ATCC 27952) did not produce a detectable increase in doxorubicin production (data not shown), arguing that SCO5147 overexpression per se is insufficient to elevate doxorubicin biosynthesis. In contrast, introduction of the wblA gene in the S. peucetius doxyrubicin-overproducing mutant resulted in dramatically reduced production of the red doxorubicin pigment during growth in liquid media as well as in plate cultures (Fig. 3B). The 420-bp putative promoter-containing regions 5' to the predicted SCO5147 open reading frame (ORF) and the predicted wblA ORF were cloned and sequenced for the S. peucetius wild-type strain and the industrial mutant strain. No sequence difference between the wild-type and industrial strains was observed in these regions (data not shown), suggesting that the differential expression of SCO5147 and wblA in these strains is a consequence of mutations in regulatory proteins rather than in the promoter.
Overexpression of wblA also inhibited the biosynthesis of actinorhodin (Act) in S. coelicolor (Fig. 3A and B) as well as the synthesis of two other S. coelicolor antibiotics: undecylprodigiosin (Red) and calcium-dependent antibiotic (Cda) in S. coelicolor (see Fig. S3 in the supplemental material). Moreover, transcripts encoded by activators of biosynthesis of the three major S. coelicolor antibiotics (i.e., actII-ORF4 for actinorhodin, redDZ for undecylprodigiosin, and cdaR for Cda) were reduced in wblA-overexpressing S. coelicolor (Fig. 3C), suggesting that wblA acts broadly to down-regulate antibiotic biosynthesis in this organism. A search for conserved motifs within regions 5' to ORFs of the actII-ORF4, redDZ, and cdaR genes revealed no commonality except for 5' untranslated region sequences known to represent ribosome binding sites (AGGAG) (data not shown). This suggests that the WblA protein, which includes a C-terminal alpha helix segment rich in basic residues and is believed to be a candidate for DNA binding (16), does not act directly as a transcriptional repressor of these genes. Aerial mycelium formation was also decreased in the S. coelicolor transformant, which consequently showed a bald phenotype (Fig. 3A), implying that wblA modulates morphological differentiation as well as antibiotic biosynthesis in Streptomyces.
wblA is predicted to encode a protein having 50% amino acid identity to WhiB in a 64-amino-acid region as well as 68% identity within a 78-amino-acid region that overlaps with the putative WhiB-related regulator WhmA of Mycobacterium tuberculosis (16). As WblA contains four conserved cysteine residues (16), it has been suggested that signaling by this protein may be sensitive to redox changes, perhaps via disulfide bond formation, as has been found with the Escherichia coli OxyR transcription factor (7, 16, 19). Whereas antibiotic regulatory genes have commonly been identified by their ability to activate antibiotic biosynthesis (3), our results now suggest that genome-wide screening using cDNA microarrays containing sequences from the S. coelicolor genome, together with antibiotic-overproducing industrial strains of related streptomycetes, may be an efficient approach to the discovery of regulatory genes affected by unidentified mutations in the industrial strains. Potentially, further manipulation of previously unknown biosynthetic modulators, such as wblA, may result in further improvements in the productivity of pharmaceuticals produced by industrial Streptomyces strains, including those for which complete genome sequence information and knowledge of regulatory mechanisms at the molecular level are not currently available.
 |
ACKNOWLEDGMENTS
|
|---|
We thank the Boryung Pharmaceutical Company, Korea, for providing the doxorubicin-overproducing industrial mutant strain and the ERC of Inha University, Korea, for technical support.
The work described in the paper was supported by NIH grant AI08619 to S.N.C. and by the Korean Systems Biology Research Program of the Ministry of Science and Technology.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address for Stanley N. Cohen: Department of Genetics, Stanford University School of Medicine, Stanford, CA 94305. Phone: (605) 723-5315. Fax: (605) 725-1536. E-mail: sncohen{at}stanford.edu. Mailing address for Eung-Soo Kim: Department of Biological Engineering, Inha University, Incheon 402-751, Korea. Phone: 82-32-860-8318. Fax: 82-32-872-4046. E-mail: eungsoo{at}inha.ac.kr 
Published ahead of print on 6 April 2007. 
Supplemental material for this article may be found at http://jb.asm.org/. 
These authors contributed equally to the work. 
 |
REFERENCES
|
|---|
- Arcamone, F. 1984. Antitumor anthracycline: recent developments. Med. Res. Rev. 4:153-188.[CrossRef][Medline]
- Bucca, G., A. M. Brassington, G. Hotchkiss, V. Mersinias, and C. P. Smith. 2003. Negative feedback regulation of dnaK, clpB and lon expression by the DnaK chaperone machine in Streptomyces coelicolor, identified by transcriptome and in vivo DnaK-depletion analysis. Mol. Microbiol. 50:153-166.[CrossRef][Medline]
- Chater, K. F. 1992. Genetic regulation of secondary metabolic pathways in Streptomyces. Ciba Found. Symp. 171:144-156.[Medline]
- Hopwood, D. A., T. Kieser, M. J. Bibb, M. J. Buttner, and K. F. Chater. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, United Kingdom.
- Huang, J., C.-J. Lin, K. H. Pan, and S. N. Cohen. 2001. Global analysis of growth phase responsive gene expression and regulation of antibiotic biosynthetic pathway in Streptomyces coelicolor using DNA microarrays. Genes Dev. 15:3183-3192.[Abstract/Free Full Text]
- Huang, J., J. Shi, V. Molle, B. Sohlberg, D. Weaver, M. J. Bibb, N. Karoonuthaisiri, C.-J. Lih, C. M. Kao, M. J. Buttner, and S. N. Cohen. 2005. Cross-regulation among disparate antibiotic biosynthetic pathways of Streptomyces coelicolor. Mol. Microbiol. 58:1276-1287.[Medline]
- Jakimowicz, P., M. R. Cheesman, W. R. Bishai, K. F. Chater, A. J. Tomson, and M. J. Buttner. 2005. Evidence that the Streptomyces developmental protein WhiD, a member of the WhiB family, binds a [4Fe-4S] cluster. J. Biol. Chem. 280:8309-8315.[Abstract/Free Full Text]
- Kalakoutskii, L. V., and N. S. Agre. 1976. Comparative aspects of development and differentiation in actinomycetes. Bacteriol. Rev. 40:469-524.[Free Full Text]
- Kang, S.-H., M.-G. Kim, H.-J. Park, and E.-S. Kim. 2005. Expression profiles of Streptomyces doxorubicin biosynthetic gene cluster using DNA microarray system. Korean J. Biotechnol. Bioeng. 20:239-246.
- Lum, A. M., J. Huang, C. R. Hutchinson, and C. M. Kao. 2004. Reverse engineering of industrial pharmaceutical-producing actinomycete strains using DNA microarrays. Metab. Eng. 6:186-196.[CrossRef][Medline]
- Nicholls, G., B. J. Chark, and J. E. Brown. 1992. Solid-phase extraction and optimized separation of doxorubicin, epirubicin and their metabolites using reverse-phase high performance liquid chromatography. J. Pharm. Biomed. Anal. 10:949-957.[CrossRef][Medline]
- Otten, S. L., J. Ferguson, and C. R. Hutchinson. 1995. Regulation of daunorubicin production in Streptomyces peucetius by the dnrR2 locus. J. Bacteriol. 177:1216-1224.[Abstract/Free Full Text]
- Park, H.-S., S.-H. Kang, H.-J. Park, and E.-S. Kim. 2005. Doxorubicin productivity improvement by the recombinant Streptomyces peucetius with high-copy regulatory genes cultured in the optimized media composition. J. Microbiol. Biotechnol. 15:66-71.
- Park, H.-S., H.-J. Park, Y.-H. Kim, S.-M. Lim, D.-I. Kim, W.-S. Ryu, S.-L. Kim, and E.-S. Kim. 2003. Development of doxorubicin overproducing Streptomyces strain using protoplast regeneration. Korean J. Biotechnol. Bioeng. 18:289-293.
- Rodriguez, E., Z. Hu, S. Ou, Y. Volchegursky, C. R. Hutchinson, and R. McDaniel. 2003. Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30:480-488.[CrossRef][Medline]
- Soliveri, J. A., J. Gomez, W. R. Bishai, and K. F. Chater. 2000. Multiple paralogous genes related to the Streptomyces coelicolor development regulatory gene whiB are present in Streptomyces and other actinomycetes. Microbiology 146:333-343.[Abstract/Free Full Text]
- Stutzman-Engwall, K. J., S. L. Otten, and C. R. Hutchinson. 1992. Regulation of secondary metabolism in Streptomyces spp. and overproduction of daunorubicin in Streptomyces peucetius. J. Bacteriol. 174:144-154.[Abstract/Free Full Text]
- Vetrivel, K. S., and K. Dharmalingam. 2001. Isolation and characterization of stable mutants of Streptomyces peucetius defective in daunorubicin biosynthesis. J. Genet. 80:31-38.[Medline]
- Zhengnn, M., F. Aslund, and G. Storz. 1998. Activation of the OxyR transcription factor by reversible disulfide bond formation. Science 279:1718-1721.[Abstract/Free Full Text]
Journal of Bacteriology, June 2007, p. 4315-4319, Vol. 189, No. 11
0021-9193/07/$08.00+0 doi:10.1128/JB.01789-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.