Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Varhimo, E. Articles by Varmanen, P. Search for Related Content PubMed PubMed Citation Articles by Varhimo, E. Articles by Varmanen, P.

 Previous Article  |  Next Article 

Journal of Bacteriology, July 2007, p. 5210-5222, Vol. 189, No. 14
0021-9193/07/$08.00+0     doi:10.1128/JB.00473-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Identification of a Novel Streptococcal Gene Cassette Mediating SOS Mutagenesis in Streptococcus uberis

Emilia Varhimo,¹ Kirsi Savijoki,² Jari Jalava,³ Oscar P. Kuipers,⁴ and Pekka Varmanen^1*

University of Helsinki, Department of Basic Veterinary Sciences, P.O. Box 66, FIN-00014 Helsinki, Finland,¹ University of Helsinki, Institute of Biotechnology, P.O. Box 56, FIN-00014 Helsinki, Finland,² National Public Health Institute, P.O. Box 57, 20521 Turku, Finland,³ University of Groningen, Department of Molecular Genetics, P.O. Box 14, 9750 AA Haren, The Netherlands⁴

Received 29 March 2007/ Accepted 8 May 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Streptococci have been considered to lack the classical SOS response, defined by increased mutation after UV exposure and regulation by LexA. Here we report the identification of a potential self-regulated SOS mutagenesis gene cassette in the Streptococcaceae family. Exposure to UV light was found to increase mutations to antibiotic resistance in Streptococcus uberis cultures. The mutational spectra revealed mainly G:CA:T transitions, and Northern analyses demonstrated increased expression of a Y-family DNA polymerase resembling UmuC under DNA-damaging conditions. In the absence of the Y-family polymerase, S. uberis cells were sensitive to UV light and to mitomycin C. Furthermore, the UV-induced mutagenesis was almost completely abolished in cells deficient in the Y-family polymerase. The gene encoding the Y-family polymerase was localized in a four-gene operon including two hypothetical genes and a gene encoding a HdiR homolog. Electrophoretic mobility shift assays demonstrated that S. uberis HdiR binds specifically to an inverted repeat sequence in the promoter region of the four-gene operon. Database searches revealed conservation of the gene cassette in several Streptococcus species, including at least one genome each of Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus mitis, Streptococcus sanguinis, and Streptococcus thermophilus strains. In addition, the umuC operon was localized in several mobile DNA elements of Streptococcus and Lactococcus species. We conclude that the hdiR-umuC-ORF3-ORF4 operon represents a novel gene cassette capable of mediating SOS mutagenesis among members of the Streptococcaceae.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Organisms from all kingdoms of life avail of complex responses to protect cells from deleterious consequences of DNA damage caused by, e.g., UV radiation as well as some classes of antibiotics (23). The cellular physiological response to insult genetic integrity, i.e., SOS response, was first recognized in Escherichia coli more than three decades ago (52). In E. coli, the expression of SOS genes is controlled by a repressor protein, LexA, as well as by RecA via its inducible co-protease activity. In response to DNA damage, activated RecA induces autocatalytic cleavage of the Ala⁸⁴-Gly⁸⁵ bond of LexA, which disrupts its ability to dimerize (35, 57). Self-cleavage of LexA inactivates LexA as a repressor, which induces the expression of SOS genes. SOS mutagenesis is mainly mediated by error-prone polymerases and takes place under severe conditions where nonmutagenic repair processes are insufficient to ensure DNA replication over lesions (23). In the process of translesion synthesis (TLS), a DNA polymerase incorporates nucleotides opposite noninstructional or misinstructional DNA lesions. In E. coli, three SOS-induced genes encode DNA polymerases that perform TLS (42). The Y-family polymerases PolIV (DinB), encoded by dinB, and PolV (UmuD₂'C), encoded by the umuDC operon, and the B-family polymerase, encoded by the polB gene, improve the ability of cells to survive DNA damage by synthesizing through DNA lesions that block replication forks (63).

In E. coli, almost all SOS-targeted UV mutagenesis results from the activity of PolV (53, 64), and the umuDC operon is the only SOS locus that must be induced for SOS mutagenesis (61). PolV consists of one molecule of UmuC together with two molecules of activated UmuD (UmuD') that arise from RecA-mediated self-cleavage of native UmuD in a reaction resembling that of LexA (12). According to phylogenetic analysis, the UmuC subfamily of Y polymerases can be further subdivided into gram-negative and gram-positive branches (45). The umuC-like genes of gram-negative bacteria are characteristically regulated by LexA and always expressed in an operon with a umuD-like gene that has not been identified in gram-positive bacteria. With the notable exceptions of YqjW and YqjH of Bacillus subtilis (19, 62) and SACOL1400 of Staphylococcus aureus (16), there is little functional data on UmuC-like proteins from gram-positive bacteria. Thus, it remains to be determined which of the gram-positive orthologs identified in silico (45) are indeed functional homologs of E. coli UmuC.

Notably, TLS not only provides the cell with an immediate escape from DNA replication blocks but also is a major mechanism in adaptive mutation. Bacteria appear to be able to adjust their mutation rates depending on environmental conditions and, consequently, also speed up their adaptation to hostile conditions (6, 54). One outcome of genetic variation in bacterial populations is the evolution of resistance to antibiotics. SOS-driven adaptive mutation and the spread of antibiotic resistance through SOS-triggered induction of mobile DNA elements pose a major threat to public health and motivate studies of SOS-like mechanisms in pathogenic bacteria (28). Several antibiotics, such as ciprofloxacin (50), trimethoprim (32), rifamycins (14), and ß-lactams (39), are known to induce an SOS response that increases mutations and accelerates the evolution of antibiotic resistance in E. coli (14). Furthermore, it has been shown that the prevention of induction of the LexA-regulated SOS response inhibits the evolution of antibiotic resistance in E. coli (14). Thus, inhibitors of SOS-induced polymerases present an appealing strategy to combat the evolution of antibiotic resistance (14). Understanding of the mutagenic responses in diverse pathogens is crucial for such pharmacological approaches. In Vibrio cholerae, the ciprofloxacin-induced SOS response increased the expression of genes necessary for transfer of the integrating conjugative element SXT (3). SXT carries several antibiotic resistance genes, and the transfer of this element to other strains of V. cholerae promotes the spread of antibiotic resistance. In S. aureus, antibiotic-induced SOS responses affect virulence by modulating mobile genetic elements and affecting chromosomal virulence gene expression (4, 25, 37, 67). Remarkably, SOS-induced error-prone DnaE2 polymerase, by its mutagenic activity, contributes to the ability of Mycobacterium tuberculosis to persist and develop antibiotic resistance during infection (9).

The genus Streptococcus includes species that are part of the normal microbiota of animals and humans, although several members of this genus are important pathogens. Streptococcus uberis is an environmental mastitis pathogen and a member of the pyogenic group of streptococci. In a recent study, 51% of S. uberis infections failed to respond to conventional antibiotic treatment and most of these infections were found to be persistent (40), suggesting the adaptability of this pathogen. At present, the mechanisms of adaptive mutagenesis in S. uberis, as well as in other Streptococcus species, are largely unexplored. Streptococcal species lack LexA, and even the existence of a classical SOS response, defined by increased mutation after UV exposure, has remained questionable (24). However, streptococci are equipped with polymerases capable of mutagenic DNA repair. For example, in Streptococcus pyogenes, essential DnaE has been characterized as a highly error-prone DNA polymerase capable of TLS in vitro (11). Recently, Streptococcus pneumoniae cells were shown to respond, upon exposure to the DNA-damaging agent mitomycin C, by RecA-dependent induction of the com regulon and genetic transformability (51). It was demonstrated that in this bacterium competence could play a role similar to that of the SOS response in E. coli (51). However, as noted by Cirz and coworkers (15), genomes of S. pneumoniae do encode Y-family polymerases, which could contribute to induced mutagenesis and genetic diversification. Previously, Tn5252, a streptococcal conjugative transposon carrying genes capable of encoding coding proteins resembling UmuC and UmuD, has been reported to confer a mutagenic response in recipient cells (41). In our previous study, the genome of a nonpathogenic member of the Streptococcaceae, Lactococcus lactis, was searched for the presence of UmuD-like proteins (58). Functional analysis of the closest homolog of the UmuD-like protein of Tn5252, encoded by ynaB in L. lactis, revealed that YnaB carries an N-terminal helix-turn-helix (HTH) motif for DNA binding (58). Furthermore, it was found that YnaB is in fact a LexA-like regulator that was named HdiR (heat and DNA damage inducible regulator) (58). Unlike LexA, the N-terminal cleavage product of HdiR still binds to its target sequence and loses its repressor activity only after ClpP-dependent degradation. Thus, the activity of HdiR is controlled by both RecA and ClpP (22, 58).

In the present study, we investigated S. uberis for the presence of mechanisms enabling adaptive mutagenesis and evolution of antibiotic resistance. We found a small DNA damage-inducible cassette including a gene encoding an error-prone DNA polymerase. Inactivation of the gene encoding the DNA polymerase revealed that this gene cassette promotes UV-inducible mutations to antibiotic resistance. The gene cassette was localized in several Streptococcus genomes and mobile elements. We propose that the novel mutagenesis gene cassette identified in this study represents a streptococcal SOS response unit.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bacterial strains, plasmids, oligonucleotides, and culture growth conditions. The strains and plasmids used in this study are listed in Table 1, and the oligonucleotides used are provided in Table 2. S. uberis ATCC BAA-854 (0140J) is a well-characterized bovine mastitis strain (26, 31, 60). The S. uberis strains were grown routinely at 37°C using TSYE agar (3% [wt/vol] Trypticase soy broth, 0.3% [wt/vol] yeast extract, 1.5% [wt/vol] Bacto agar) or THY broth (Todd-Hewitt broth with 1% [wt/vol] yeast extract), without shaking, supplemented with 1 µg/ml tetracycline when needed. E. coli strains were cultivated at 37°C in Luria-Bertani (LB) medium (55) supplemented with 5 µg/ml tetracycline when needed. The antibiotic concentrations used for the screening of S. uberis-resistant mutants were 2 µg/ml of ciprofloxacin (MP Biomedicals LLC, Germany) and 2 µg/ml of rifampin (Sigma).

View this table: [in this window] [in a new window]

TABLE 1. Strains and plasmids used in this work

View this table: [in this window] [in a new window]

TABLE 2. Oligonucleotides used in this work

MIC tests were performed using Etest strips (AB Biodisk, Sweden). S. uberis cells grown overnight on a TSYE agar plate and suspended in THY broth were used to seed fresh TSYE agar plates prior to placing Etest strips in the middle of the plate. Plates were incubated overnight, and results were interpreted according to the instructions provided by the manufacturer (AB Biodisk, Sweden). The MIC was defined as the lowest concentration of the antibiotic that inhibited growth.

UV-induced mutagenesis. The appropriate UV dose for S. uberis cells was determined as follows. Overnight cultures were diluted 1:500 in THY broth and grown at 37°C until an optical density at 600 nm (OD₆₀₀) of 0.2. Then, 2-ml aliquots were centrifuged (4,500 x g, 10 min, room temperature), and pelleted cells were resuspended in 10 ml of 0.9% NaCl. Cell suspensions were transferred to petri dishes and subjected to UV light dosages of 0, 25, or 50 J/m² using a Spectrolinker XL-1000 UV cross-linker (Spectronics Co.). Cells were plated immediately after UV treatment on TSYE agar and incubated overnight at 37°C. Cell viability was determined by counting the number of colonies. Using this protocol for the S. uberis ATCC BAA-854, the highest UV dose used (50 J/m²) was found to result in 20% (standard deviation, ±6.7%) cell survival, calculated from three independent experiments. To determine UV-induced antibiotic resistance, UV-irradiated cells were harvested as described above, resuspended in 15 ml of THY broth, and allowed to grow overnight at 37°C. Overnight cultures were plated onto TSYE agar (cell viability) and agar supplemented with 2 µg/ml rifampin or 2 µg/ml ciprofloxacin. Plates were grown overnight at 37°C, and the numbers of colonies were counted. The proportion of mutations was the ratio of resistant cells/viable cells. Determination of the proportions of rifampin- and ciprofloxacin-resistant cells was conducted from at least three independent cultures.

Pyrosequencing. For pyrosequencing of ciprofloxacin resistance-determining mutations, S. uberis cells were grown and UV induction was performed as described above. Following UV induction, the cultures were divided into 0.5-ml aliquots and grown overnight. Each aliquot was plated onto TSYE agar supplemented with 2 µg/ml ciprofloxacin. After incubation for 2 days at 37°C, a single ciprofloxacin-resistant colony from each plate was picked for sequencing analysis to ensure independent mutational events. DNA regions covering bases 228 to 255 and 293 to 314 from the parC gene were analyzed by pyrosequencing of ciprofloxacin-resistant wild-type (wt) and EH58 clones to determine the mutation frequency and mutation types present in the selected DNA region.

PCR amplification of part of the parC gene was performed with primer pair p1/p2, in which p2 was biotinylated. Pyrosequencing was performed using streptavidin-coated Sepharose beads (Amersham Biosciences), a PSQ 96 MA instrument, a vacuum prep workstation, and Pyro Gold SQA reagents (Biotage AB, Uppsala, Sweden) according to the instructions of the manufacturer. Twenty microliters of the PCR product and 15 pmol of sequencing primer p3 or p4 were used in sequencing reactions. The dispensation order was TGAGATCTAACGTACGTACGTACGTACGTACGTACGTACGT for the p3 sequencing reaction and TAGATCATCGATCGATCG for the p4 sequencing reaction.

Database and bioinformatic tools used for identification of S. uberis genes and protein sequence comparisons. The sequence data used were obtained from the S. uberis sequencing group at the Sanger Centre (ftp://ftp.sanger.ac.uk/pub/pathogens/su/). Protein and DNA sequences for putative umuC, hdiR, dinP, and dnaE were downloaded from the Sanger Centre after identification of homologs by on-site BLAST (http://www.sanger.ac.uk/cgi-bin/BLAST/submitblast/s_uberis). The sequences for the UmuC-like protein encoded by Tn5252 (accession no. AAC98439), putative DinP of S. pyogenes (accession no. AAM80202), S. pyogenes DnaE (accession no. P0C0F2) (10), and HdiR of L. lactis (accession no. CAD89881) (58) were used as query sequences.

Annotations of S. uberis proteins were retrieved from an FTP site at ftp://ftp.sanger.ac.uk/pub/pathogens/bf/. The search of UmuC orthologs in different genomes was performed using the BLAST program at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov) and the Comprehensive Microbial Resource at The Institute for Genomic Research (TIGR) website (http://www.tigr.org/tigr-scripts/CMR2/CMRHomePage.spl). The gene annotation of Streptococcus mitis NCTC12661 was taken from the TIGR Comprehensive Microbial Resource (http://www.tigr.org/tigr-scripts/CMR2/CMRHomePage.spl).

RNA extraction and Northern blotting. S. uberis overnight cultures were diluted 1:500 in THY broth and grown at 37°C to an OD₆₀₀ of 0.2 for the UV stress assay and an OD₆₀₀ of 0.4 for the ciprofloxacin stress assay. Samples were withdrawn at 0, 30, and 60 min after UV treatment with 50 J/m² or 0, 30, 60, and 180 min after the addition of 0.5 µg/ml (0.5x MIC) ciprofloxacin. Cells were disrupted with 250 mg of 0.1-mm-diameter glass beads (Sigma) and a Fastprep FP120 homogenizer (ThermoSavant). RNA extraction was performed using a QIAGEN RNeasy Mini kit. DNA probes specific for umuC (encoding SUB0898), dnaE (encoding SUB1002), hdiR (encoding SUB0899), and dinP (encoding SUB1567) were amplified from strain ATCC BAA-854 by PCR using primer pairs p5/p6, p7/p8, p9/p10, and p11/p12, respectively. For Northern analysis, separation and transfer of RNA were carried out using a Latitude precast gel (1.25% Seakem Gold gel; Cambrex, CA) and a Hybond-XL uncharged nylon membrane (Amersham Pharmacia Biotech, CA) following the instructions provided by the manufacturer. Probe DNAs were labeled with [-³³P]ATP (>92.5 TBq mmol^–1) using a DNA Megaprime labeling kit (Amersham Biosciences) following the manufacturer's instructions. Northern hybridization was carried out as described elsewhere (68).

The membrane was scanned and transcripts were quantified using a Fujifilm FLA-5100 scanner and AIDA software version 4.03.031 (Raytest Isotopenmessgeraete Gmbh, Germany). Differences in the amounts of RNA were corrected by quantifying the 16S rRNA amounts in each lane (primers p13/p14 for the probe).

Strain construction. Molecular cloning techniques were performed essentially as described by Sambrook and Russell (55). Restriction enzymes, DNA polymerase, and T4 DNA ligase were obtained from Promega (Madison, WI), Finnzymes (Espoo, Finland), and Roche (Mannheim, Germany), respectively. To create an in-frame deletion of the umuC gene in S. uberis ATCC BAA-854, a replacement recombination technique was used. The UmuC encoding region in ATCC BAA-854 was identified with the S. uberis BLAST server (http://www.sanger.ac.uk/cgi-bin/BLAST/submitblast/s_uberis) using the UmuC encoded by streptococcal conjugative transposon Tn5252 (accession no. AAC98439) as the query sequence.

PCR products were amplified from DNA regions flanking umuC with primers p15/p16 and p17/p18, digested with XbaI/PstI and PstI/SalI, respectively, and ligated to a XbaI/SalI-digested thermosensitive pGhost8 plasmid (36). The resulting plasmid, pEH55, was transferred to E. coli JM109 (Promega, WI), according to the manufacturer's instructions. Plasmid pEH55 was used to transform S. uberis cells in 10% glycerol with electroporation at 600 and 25 kV/cm using a Bio-Rad Genepulser (29). The transformed cells were allowed to recover in THY broth supplemented with 6% sucrose at 28°C for 2 h followed by plating onto TSYE agar supplemented with 1 µg/ml tetracycline. Plasmid integration and excision were carried out as described by Biswas and coworkers (5), with integration and excision temperatures of 37.5°C and 28°C, respectively. Mutants were screened using colony PCR with primer pair p15/p18. The mutant strain carrying an in-frame deletion of umuC was assigned as EH58.

Complementation of the umuC deletion in strain EH58 was performed by pGhost8-mediated replacement of the hdiR-umuC-ORF3-ORF4 operon with an intact operon. To accomplish this, a DNA fragment containing a hdiR-umuC-ORF3-ORF4 operon without its putative promoter region was amplified with the p19 and p20 oligonucleotides and cloned into pGhost8 as an EcoRI-XbaI fragment. Transformation, plasmid integration, and excision were performed as described above. The complemented EH58 derivative was assigned as EH80.

UV survival and mitomycin C sensitivity assays. UV sensitivity testing of S. uberis cells was performed on agar plates using spotting protocol adapted from Frees et al. (21). Briefly, overnight cultures were diluted 1:500 in fresh, preheated THY broth and incubated at 37°C to a final OD₆₀₀ of 0.1. At this point, dilutions were made in phosphate-buffered saline, and 10 µl of the different dilutions were spotted on TSYE agar plates. Plates were exposed to UV light with an irradiance of 0 J/m² and 50 J/m² as described above. Colony-forming abilities of the wt and mutant strains were assessed after 1 day of incubation at 37°C.

Mitomycin C sensitivity testing was performed by spotting 10 µl of overnight cultures and appropriate dilutions made in phosphate-buffered saline on TSYE agar and TSYE agar supplemented with 25 ng/ml mitomycin C (Sigma). Colony-forming abilities of the wt and mutant strains were assessed after 1 day of incubation at 37°C.

Overexpression and purification of HdiR and analysis of self-cleavage. The hdiR coding region was amplified using primer pair p21/p22, digested with BamHI and SalI, and cloned into respective sites in pQE30 (QIAGEN). His₆-HdiR was purified from E. coli XL1-Blue carrying pQE30-6His-hdiR using the HisTrap HP 1-ml column according to the standard procedure recommended by Amersham Biosciences. The purified His₆-HdiR was used for DNA gel mobility shift experiments.

Self-cleavage of the His₆-HdiR was studied in the pH range of 6.0 to 10.0 using a buffer system containing either 50 mM Bis-Tris, Tris-HCl, or glycine. Briefly, each reaction containing 1 µg (20 µl) of purified HdiR was incubated at room temperature for 18 h. Reaction products were separated in a 12% Bis-Tris NuPage gel (Invitrogen) followed by staining with Coomassie brilliant blue R-250.

EMSA. A DNA fragment (167 bp) covering –157 to +10 relative to the hdiR start codon from S. uberis was generated by PCR using primer pair p23/p24. As a control DNA, an internal 154-bp fragment of hdiR (from +4 to +157) was amplified by PCR using primers p21/p25. The primers p24 and p25 carried HEX (4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein) fluorescence label at their 5' end. Electromobility shift assay (EMSA) reactions (15 µl) were assembled by mixing the PCR-amplified fragment (35 ng) and the His₆-HdiR (0 to 80 ng) in gel shift buffer [20 mM Tris-HCl, pH 8.0, 60 mM KCl, 1 mM dithiothreitol, 10% glycerol, 0.1 mg/ml bovine serum albumin, and 2 µg poly(dI-dC)]. Gel shift reactions were incubated at 25°C for 15 min followed by electrophoresis on a 5% polyacrylamide gel with 0.5x TBE (0.0445 M Tris, 0.0455 M borate, 1.25 M EDTA) at room temperature. Following electrophoresis, gels were scanned with a Fuji FLA-5100 scanner (Fuji Photo Film Co., Ltd., Japan) using an excitation laser at 532 nm, an output voltage of 400 V, and an LPG emission filter. Images were analyzed using the Aida Image Analyzer software v. 4.03 (Raytest GmbH, Straubenhardt, Germany).

Oligonucleotide pairs p26/p27 and p28/p29 with overhangs creating EcoRI and XbaI compatible ends, respectively, were annealed, treated with T4 polynucleotide kinase (MBI Fermentas), and ligated with T4 ligase (Roche) to XbaI-EcoRI cut pBluescript-II SK+ to obtain pBluescript-IR and pBluescript-ctrl, respectively. The M13 rev and M13 uni primers were used to amplify 230-bp fragments from pBluescript-IR and pBluescript-ctrl for the gel mobility assay. Reactions (15 µl) were assembled by mixing the PCR-amplified fragment (35 ng) and His₆-HdiR (0 to 80 ng) in gel shift buffer (20 mM Tris-HCl, pH 8.0, 60 mM KCl, 1 mM dithiothreitol, 10% glycerol, 0.1 mg/ml bovine serum albumin, and 0.5 µg sonicated salmon sperm DNA). Gel shift reactions were incubated at 25°C for 15 min, followed by electrophoresis on a 5% polyacrylamide gel. Gels were stained with ethidium bromide, scanned with a Fuji FLA-5100 scanner (Fuji Photo Film Co., Ltd., Japan) using an excitation laser at 532 nm, an output voltage of 400 V, and an LPG emission filter. Images were analyzed using the Aida Image Analyzer software v. 4.03 (Raytest GmbH, Straubenhardt, Germany).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Induction of antibiotic resistance in S. uberis by UV light. Mutations leading to rifampin or ciprofloxacin resistance were used as an assay to determine whether S. uberis possesses a classical SOS response, as defined by increased mutation in response to UV light exposure. Rifampin resistance results from mutations in the ß subunit of RNA polymerase (rpoB) that allow the polymerase to overcome the block (13). Ciprofloxacin resistance has been characterized from mutations in two genes, the topoisomerase gene parC and the gyrase gene gyrA (27).

UV-induced mutagenesis was examined by measuring the proportion of rifampin-resistant (Rif^r) or ciprofloxacin-resistant (Cfx^r) cells in the population. After UV induction at 25 J/m² and 50 J/m², the number of rifampin-resistant clones in overnight cultures increased 145- and 209-fold, respectively (Fig. 1A), and the number of ciprofloxacin-resistant clones in overnight cultures increased 31-fold and 48-fold, respectively (Fig. 1B). We determined the MIC of rifampin for nine individual UV-induced rifampin-resistant S. uberis clones by Etest. All rifampin-resistant clones were found to exhibit over 500-fold higher MICs than the wt strain (data not shown).

View larger version (14K): [in this window] [in a new window]

FIG. 1. Induction of mutagenesis to antibiotic resistance by UV light exposure in S. uberis ATCC BAA-854. (A) The proportions of Rifr cells were determined in cultures that were either untreated (lane 1) or exposed to UV doses of 25 J/m2 (lane 2) or 50 J/m2 (lane 3). (B) The proportions of Cfxr cells were determined in cultures that were either untreated (lane 1) or exposed to UV doses of 25 J/m2 (lane 2) or 50 J/m2 cells (lane 3). Results are presented as an average from at least three independent experiments, and error bars indicate standard deviations. (C) UV mutation spectra in the quinolone resistance-determining region of the parC gene. Sixty-four percent of mutants analyzed had a mutation in this region. Nucleotides 228 to 297 of the parC and the deduced amino acid sequence are shown in this figure. Mutations indicated above and below the nucleotide sequence correspond to transitions and transversions, respectively. The amino acid changes caused by these mutations are shown below the deduced amino acid sequence.

The nature of UV-induced mutations was analyzed in the parC gene by sequencing and pyrosequencing. First, we sequenced a fragment covering nucleotides +88 to +570 of the parC gene in 12 ciprofloxacin-resistant clones (data not shown). This area is part of the quinolone resistance-determining region, a 699-bp region of parC where ciprofloxacin resistance-promoting mutations have been characterized in S. pneumoniae and S. pyogenes parC (27, 46, 47). Based on sequencing results (data not shown) and previous work on other Streptococcus species (27, 46, 47), a 71-bp region (bases 228 to 299 of parC) that contains three frequently occurring mutations in streptococci was chosen as the template for pyrosequencing. DNA samples from 28 randomly selected individual ciprofloxacin-resistant clones were extracted and subjected to pyrosequencing. In 18/28 (64%) ciprofloxacin-resistant mutants, a mutation was observed in the 71-bp region responsible for previously described fluoroquinolone resistance-conferring amino acid substitutions in ParC (33). The mutation spectrum is shown in Fig. 1C. Most of the mutations observed were G:CA:T transitions, constituting 67% of base changes observed. In most clones, the base substitution occurred in position 235 where 11 G:CA:T transitions and 3 G:CT:A transversions were detected (Fig. 1C). In one clone a transition was observed in position 246, whereas in three clones a transversion was observed in this position (Fig. 1C). In E. coli, G:CA:T transitions represent the hallmark of UV mutagenesis (23).

From these results we conclude that S. uberis is capable of SOS mutagenesis.

Expression of SUB0898 and hdiR are induced in response to DNA damage. To further investigate the mutagenic response and the role of error-prone polymerases in S. uberis, we mined the genome sequence of S. uberis ATCC BAA-854, available at http://www.sanger.ac.uk/Projects/S_uberis/, for the presence of umuC, dinP, and dnaE genes. In addition, we searched for the presence of a gene encoding HdiR, a LexA-like regulator identified previously in Lactococcus lactis (58). BLAST searches revealed undefined gene products annotated as SUB0898, SUB1567, SUB1002, and SUB0899 with amino acid sequences 59%, 77%, 66%, and 33% identical to the UmuC-like protein of Tn5252, the putative DinP of S. pyogenes, the DnaE of S. pyogenes, and the HdiR of L. lactis, respectively. Northern analyses were performed using probes specific for genes encoding SUB0898 (putative UmuC, PolV subunit), SUB1567 (putative DinP, PolIV), SUB1002 (DnaE), and SUB0899 (HdiR) and RNA samples isolated from S. uberis cultures treated either with UV or with ciprofloxacin, which induces the SOS response in E. coli and S. aureus (14, 16, 67). Northern analyses of S. uberis indicated constitutive expression of putative dinP and dnaE genes under the conditions used (data not shown), whereas the expression of both putative umuC and hdiR was induced three- to sixfold following both UV and ciprofloxacin treatments (Fig. 2). Furthermore, umuC- and hdiR-specific probes detected two transcripts of the same sizes, approximately 1,100 bp and 3,000 bp, respectively, and exhibiting the same expression pattern (Fig. 2). Thus, the adjacent SUB0898 and SUB0899 genes encoding putative the UmuC-like protein and HdiR, respectively, were both induced under the DNA-damaging conditions used, indicating that the genes could be transcribed in the same transcript in S. uberis.

View larger version (52K): [in this window] [in a new window]

FIG. 2. Northern blot analysis of SUB0898 (umuC) and hdiR expression following exposure to DNA-damaging conditions. (A) umuC expression in ATCC BAA-854 before (0') and 30 and 60 min after UV exposure of 50 J/m2. (B) umuC expression in ATCC BAA-854 before (0') and 30, 60, and 180 min after the addition of ciprofloxacin at 0.5 µg/ml. (C) hdiR expression in ATCC BAA-854 before (0') and 30 and 60 min after UV exposure of 50 J/m2. (D) hdiR expression in ATCC BAA-854 before (0') and 30, 60, and 180 min after the addition of ciprofloxacin at 0.5 µg/ml. Bar diagrams show the relative mRNA induction ratios calculated by dividing the signal from the RNA sample by the signal from the RNA sample at time zero. Only the longer transcript detected with the umuC probe was quantified. RNA amounts were corrected after rRNA hybridization (data not shown), and results represent the mean values of two independent experiments with standard errors.

UV-induced mutagenesis requires SUB0898, a potential functional homolog of UmuC. To investigate the function of SUB0898 in S. uberis, we first retrieved the DNA sequence encoding SUB0898 and its flanking regions from http://www.sanger.ac.uk/Projects/S_uberis/ for sequence analyses. The 1,425-bp gene encoding SUB0898 is preceded by a 690-bp gene encoding the HdiR homolog SUB0899. The stop codon of hdiR is separated by 8 nucleotides from the start of the gene encoding SUB0898 (Fig. 3). The 384-bp open reading frame (ORF3) of SUB0897 overlaps with SUB0898 by 8 nucleotides and is followed by the 330-bp open reading frame (ORF4) of SUB0896 overlapping with SUB0897 by 8 nucleotides (Fig. 3). The hdiR gene is preceded by a well-conserved putative promoter region 38 nucleotides upstream and an inverted repeat (IR) structure representing a putative transcription terminator overlaps the stop codon of ORF4. Another IR is located between the putative promoter and start codon of hdiR (Fig. 3). This 26-bp IR is 96% identical to the structure located 12 bp upstream of the gene for a putative repressor that is 71% identical to the HdiR protein of S. uberis and has been annotated as spyM18_1150, SPs1040, M28_Spy0886, Spy1198, SpyM3_0840, and M6_Spy0903 in S. pyogenes strains MGAS8232, MGAS6180, SSI-1, M1 SF370, MGAS315, and MGAS10394, respectively. The organization of genes encoding SUB0899, SUB0898, SUB0897, and SUB0896 (Fig. 3) suggests that they could form an operon. SUB0897 and SUB0896 are homologous to uncharacterized proteins of Streptococcus species, whereas SUB0898 shares a high degree of homology to putative UmuC-like proteins from Streptococcus and related species with amino acid identities ranging from 48 to 64% (data not shown). The most homologous results, using SUB0898 as a query sequence, were found against putative ImpP/MucB/SamB family proteins from Streptococcus agalactiae 2603V/R (accession no. AE014250_6) and S. pyogenes MGAS10394 (accession no. AAT87297.1). For studying the function of SUB0898 in S. uberis, a mutant strain with an 1,350-bp in-frame deletion in the corresponding gene was constructed and named EH58. Compared to the wt, EH58 was sensitive to both UV light and the DNA-damaging agent mitomycin C (Fig. 4). In the absence of stress, EH58 exhibited a growth rate and final cell density similar to those of the wt strain (data not shown). UV-induced mutagenesis was examined by rifampin and ciprofloxacin resistance assays. Figure 5A and B show that UV light-induced mutagenesis in EH58 is dramatically decreased in both assays. The SUB0898 shows low amino acid identity (22%, in a 343-amino-acid overlap) to E. coli UmuC (accession no. NP_415702) and is almost equally homologous (22% identity in a 322-amino-acid overlap) with DinB (accession no. NP_414766). However, the UV-induced expression of the SUB0898 encoding gene, the UV- and mitomycin C-sensitive phenotype of EH58, and the almost complete lack of UV-induced mutagenesis in EH58 demonstrate that SUB0898 is a key element in mutagenic repair of UV lesions, and it suggests that SUB0898 is a functional homolog of UmuC in S. uberis. Thus, we named the gene encoding SUB0898 umuC. Despite several attempts, we have been unable to clone the umuC gene or the umuC operon along with its putative promoter region in a plasmid vector. Therefore, we cloned the entire umuC operon without a promoter into the pGh8-vector integration vector and used this construct to replace the umuC operon of EH58 with the wt operon in order to obtain EH80. Both UV and mitomycin C sensitivities as well as UV-induced mutagenesis in EH80 were complemented to the wt level (data not shown). This confirmed that the phenotype of EH58 was not due to secondary mutations unrelated to the umuC operon and that the umuC operon accounts for most of the mutagenic DNA repair in S. uberis cells exposed to UV light.

View larger version (50K): [in this window] [in a new window]

FIG. 3. Partial nucleotide and deduced amino acid sequences of the ATCC BAA-854 hdiR-umuC operon. The predicted –10/–35 hexanucleotides are boxed. The start codons are in boldface with dark background, and the putative ribosome-binding sites (RBS) are in boldface and underlined. Translation stop codons are marked with asterisks. The dotted areas represent gaps in the presented sequence. The 26-bp IR structure in the putative promoter region and the putative transcription terminator are marked with arrows.

View larger version (47K): [in this window] [in a new window]

FIG. 4. Effect of absence of UmuC-like protein on DNA damage tolerance of S. uberis. (A) Survival of S. uberis ATCC BAA-854 and EH58 after UV exposure. ATCC BAA-854 (1 and 3) and EH58 (2 and 4) cultures were grown exponentially in THY and at an OD600 of 0.1, cultures were diluted, and 10 µl of each dilution was spotted on two TSYE agar plates. Plates either were not exposed (–UV) or were exposed to UV light of 50 J/m2 (+UV) prior to incubation overnight at 37°C. The results presented are representative of several independent experiments. (B) Sensitivity of S. uberis ATCC BAA-854 and EH58 to mitomycin C (MMC). ATCC BAA-854 (1 and 3) and EH58 (2 and 4) cultures were grown overnight in THY, and 10 µl of overnight cultures and appropriate dilutions were spotted on TSYE agar plates without and with 25 ng/ml of MMC. Plates were grown overnight at 37°C. The results presented are representative of several independent experiments.

View larger version (19K): [in this window] [in a new window]

FIG. 5. Effects of absence of UmuC-like protein on UV-targeted mutagenesis. The proportions of (A) rifampin- and (B) ciprofloxacin-resistant cells in ATCC BAA-854 (dark gray bars) and EH58 (light gray bars) were determined in cultures that were either untreated (1 and 2) or were exposed to UV doses of (3 and 4) 25 J/m2 and (5 and 6) 50 J/m2.

umuC and hdiR are part of a four-gene operon in S. uberis. Northern analysis with a umuC-specific probe revealed a 3,000-bp transcript (Fig. 2) that is considerably longer than the 1,425-bp coding region predicted for umuC. Furthermore, a 3,000-bp transcript was detected using a probe specific for the adjacent gene encoding HdiR. Both probes also detected a shorter transcript of approximately 1,100 bp, but the relative signals of 3,000-bp and 1,100-bp transcripts were different with umuC and hdiR probes (Fig. 2). To confirm that hdiR and umuC are expressed in the same transcript, we analyzed RNA samples isolated from EH58 carrying a 1.35-kb deletion in umuC by Northern blotting with a hdiR-specific probe. Results shown in Fig. 6 demonstrate the presence of a single UV-induced hdiR-specific transcript in EH58, and the size of this transcript corresponds to the deletion in the umuC gene. Furthermore, the absence of the 1,100-bp transcript in EH58 suggests that the hdiR-umuC mRNA is processed from a site located in the deleted region of umuC in the wt. This would also explain the relatively weak signal of the 1,100-bp transcript with the umuC-specific probe compared to the hdiR probe (Fig. 2), resulting from only partial overlap of the umuC probe with this transcript. The predicted transcript size of hdiR-umuC-ORF3-ORF4 is approximately 2.8 kb. This corresponds with the size of the longer transcript detected with hdiR and umuC probes as a result of Northern analyses.

View larger version (47K): [in this window] [in a new window]

FIG. 6. Northern analysis of hdiR transcription in umuC deletion strain EH58. The hdiR expression in ATCC BAA-854 and EH58 before (0') and 30 and 60 min after UV exposure of 50 J/m2 is shown.

HdiR undergoes LexA-like self-cleavage in vitro and binds specifically to an IR located upstream of the hdiR-umuC-ORF3-ORF4 operon. According to sequence analysis, the S. uberis HdiR is 33% identical to its counterpart in L. lactis (58). In L. lactis, HdiR is a negative transcriptional regulator that has been shown to repress gene expression by binding to an IR structure located in the promoter regions of target genes (58). The L. lactis HdiR carries an N-terminal HTH motif that is essential for its function as a repressor, whereas the C-terminal half of the protein is not crucial for sequence-specific DNA binding. Analogous to LexA, the L. lactis HdiR requires RecA for self-cleavage in vivo, while self-cleavage occurs spontaneously in vitro at high pH (58). The capability of L. lactis for SOS-induced mutagenesis remains to be elucidated as does the biological role of HdiR in this organism. S. uberis HdiR carries a putative N-terminal HTH motif similar to that of L. lactis HdiR. In addition, amino acids Ala84, Gly85, Ser119, and Lys156, involved in the RecA-dependent self-cleavage of E. coli LexA (34, 59) and L. lactis HdiR (58), are also conserved in the HdiR of S. uberis (Ala117, Gly118, Ser150, and Lys187) (data not shown). We have not been able to inactivate the recA gene in S. uberis or to replace the wt hdiR gene with gene encoding uncleavable G118D HdiR (data not shown), which has prevented studies of HdiR self-cleavage in vivo. To study the function of S. uberis HdiR in vitro, we overproduced and purified HdiR as a His-tagged protein. The autodigestion at alkaline pH is a characteristic feature of LexA-like proteins undergoing RecA-mediated cleavage in vivo and has been documented for every LexA-like protein tested (23). For investigation of LexA-like self-cleavage, we incubated purified HdiR protein at various pHs and observed that self-cleavage of HdiR proceeded spontaneously at high pH, resulting in two products of 14.6 and 13.1 kDa (Fig. 7A). Next, we used EMSA to study the binding of HdiR to the upstream region of the hdiR-umuC-ORF3-ORF4 operon. To this end, the gel shift reactions containing purified HdiR and the DNA fragment spanning the region from –157 to +10 (promoter probe) or +4 to +157 (control probe) were assembled in binding buffer and the DNA complexes were separated in TBE gel, as described above. When scanning with an excitation wavelength specific for HEX-labeled DNA complexes, we observed that HdiR binds in a concentration-dependent manner to the promoter probe but not to the control probe (Fig. 7B). The additional band observed by EMSA is a single-stranded PCR product as demonstrated by denaturating the probe with formamide prior to electrophoresis (data not shown).

View larger version (43K): [in this window] [in a new window]

FIG. 7. In vitro analyses of HdiR self-cleavage and DNA-binding activity. (A) pH-dependent cleavage of the His6-HdiR in the pH range of 6.0 to pH 10. Visualization of the autodigestion reactions containing 1,000 ng of the purified HdiR on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) gels stained with Coomassie brilliant blue. LMW refers to molecular weight standard (Bio-Rad). (B) Binding of the His6-HdiR to the putative promoter region of S. uberis hdiR-umuC. Reaction mixtures contained 35 ng of PCR-derived DNA fragments from the hdiR internal region (negative control, lanes 1 to 2) or from the upstream region of the hdir-umuC operon (lanes 3 to 7) mixed with 0 ng (lanes 1 and 3), 20 ng (lane 4), 40 ng (lane 5), 60 ng (lane 6), or 80 ng (lane 2 and 7) of HdiR. Reactions were separated by 5% PAGE followed by scanning of the gel with a Fujifilm FLA-5100 scanner using an excitation laser at 532 nm and an LPG emission filter. Positions of unbound (or free) DNA (U), protein-DNA complexes (B), and the single-stranded DNA probe (ss) are indicated. (C) Binding of the His6-HdiR to the pBluescript-II SK+ multiple cloning site containing a 26-bp control sequence without IR (lanes 1 to 3) or a 26-bp IR sequence (lanes 4 to 8) from the promoter region of hdiR. Reaction mixtures contained 35 ng of PCR-derived DNA fragments from pBluescript control (lanes 1 to 3) and from pBluescript-IR (lanes 4 to 8) mixed with 0 ng (lanes 1 and 4), 10 ng (lane 5), 20 ng (lane 6), 40 ng (lane 2), 60 ng (lane 7), and 80 ng (lanes 3 and 8) of HdiR. Reactions were separated in a 5% PAGE followed by staining with ethidium bromide and scanning with a Fuji FLA-5100 scanner using an excitation laser at 532 nm and an LPG emission filter. The positions of unbound (or free) DNA (U) and protein-DNA complexes (B) are indicated.

Next, we asked whether the 26-bp IR sequence inside the promoter probe is the target of HdiR binding. To examine this, the IR was cloned into pBluescript-II SK+ and used as a template in the PCR for the EMSA probe. In addition, a 26-bp sequence, located –96 to –70 from the start of hdiR, was cloned into pBluescript-II SK+ and used as a template for the control probe. EMSA using the probe amplified from pBluescript-IR and pBluescript-ctrl revealed that only the IR-containing DNA was retarded by HdiR (Fig. 7C).

Further EMSAs revealed that, parallel to L. lactis HdiR, the S. uberis HdiR retains its DNA-binding activity after self-cleavage (data not shown). We have made several attempts to inactivate hdiR in S. uberis using constructs that would lead to deletion of the entire gene or, alternatively, to deletion of the HTH motif of the protein. However, these efforts were not successful (data not shown). Inactivation of HdiR in S. uberis would presumably result in constitutive expression of the mutagenic gene cassette. Thus, it is possible that, unlike in L. lactis (58), this regulator cannot be inactivated, which hampers functional studies. However, the specific binding of purified HdiR to the IR sequence located between the putative promoter region and the start of hdiR strongly suggests that HdiR functions as a repressor of the expression of hdiR-umuC-ORF3-ORF4 and thereby regulates SOS mutagenesis in S. uberis in vivo.

The umuC operon and HdiR-binding sequence are conserved in Streptococcus genomes. Homology searches revealed genes encoding UmuC homologs with identities between 49 to 64% in S. agalactiae strains 2603V/R (65), H36B (66), and 18RS21 (66), in S. pyogenes strain MGAS10394 (2), in Streptococcus sanguinis strain SK36 (70), in S. thermophilus strains CNRZ1066 (8), LMG18311 (8), and LMD-9 (38), in S. mitis NCTC12661 (http://cmr.tigr.org/tigr-scripts/CMR/CmrHomePage.cgi), and in L. lactis strains IL1403 (7) and SK11 (38). In addition, S. pyogenes 2812A transposon Tn1207.3 (56), S. pneumoniae transposon Tn5252 (41), S. thermophilus genomic island CIME19258 (48), and L. lactis plasmids pMRC01 (18) and pNP40 (43) may encode proteins with 64%, 57%, 58%, 50%, and 48% amino acid identities to S. uberis UmuC, respectively. Furthermore, in S. pyogenes MGAS10394, S. mitis NCTC12661, and S. sanguinis strain SK36, the genetic organization of the hdiR-umuC-ORF3-ORF4 operon is conserved (Fig. 8). In S. agalactiae sequences, a 132-bp open reading frame for an unknown protein is located between hdiR and umuC, and in Tn1207.3, two ORFs of 225 bp and 135 bp separate hdiR and umuC (Fig. 8). In the S. thermophilus and L. lactis genomes, hdiR and umuC are not in the same locus (Fig. 8). In Tn5252 the organization of the four-gene operon is also conserved (Fig. 8). However, as noted previously (58), the product of ORF14 of Tn5252, exhibiting 63% amino acid identity to S. uberis HdiR, lacks a detectable N-terminal HTH motif according to the the Dodd-Egan algorithm (17) characteristic for all other HdiR homologs (Fig. 8).

View larger version (40K): [in this window] [in a new window]

FIG. 8. Distribution of umuC in members of the Streptococcaceae. Schematic presentation of the umuC regions in Streptococcus and Lactococcus sequences. Dark gray indicates the ORF14 of Tn5252 encoding a homolog of S. uberis HdiR lacking an N-terminal HTH motif.

Searches against completed genome sequences at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi revealed that S. pyogenes strains M1 GAS, MGAS10270, MGAS10750, MGAS2096, MGAS315, MGAS5005, MGAS6180, MGAS8232, MGAS9429, and SSI-1, S. agalactiae strains 515, A909, and NEM316, Streptococcus suis strain 89/1591, Streptococcus mutans strain UA159, and S. pneumoniae strains R6 and TIGR4 do not contain any gene encoding a UmuC homolog.

Next, we searched the upstream regions of streptococcal hdiR and umuC orthologs for the presence of sequences resembling the binding site of S. uberis HdiR. DNA sequences showing homology (54 to 77% identity) to the 26-bp IR of S. uberis were found between putative promoter regions and start sites of several operons (Fig. 9).

View larger version (18K): [in this window] [in a new window]

FIG. 9. Multiple-sequence alignment of DNA sequences identified upstream of Streptococcus genes resembling the binding site of S. uberis HdiR. A black background indicates nucleotides identical to the only known streptococcal HdiR-binding site, the IR structure preceding SUB0899.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Here, we show the existence of an SOS response-like DNA repair mechanism in a pathogenic member of the Streptococcaceae family. This activity includes mutation-promoting replication that requires the action of gram-positive-type UmuC after induction with UV light. Furthermore, this study adds to previous work on HdiR (58), and we propose that this DNA-binding protein is a regulator of SOS mutagenesis as LexA is in other bacteria.

It was shown that UV light exposure induces mutations that confer antibiotic resistance in S. uberis ATCC BAA-854. Under DNA-damaging conditions, increased expression of the hdiR-umuC-ORF3-ORF4 operon was detected by Northern analyses, whereas no effect on dinP or dnaE expressions was observed. In addition to UV light, exposure to fluoroquinolone antibiotic ciprofloxacin also induced the expression of the hdiR-umuC-ORF3-ORF4 operon. A previous study revealed that the DNA polymerase encoded by dnaE in S. pyogenes is highly error prone, producing frameshift and point mutations in undamaged DNA as well as during TLS in vitro (11). In M. tuberculosis the SOS-induced DnaE2 was shown to be essential for evolution of antibiotic resistance in vivo (9). The functional study of DnaE proteins in gram-positive bacteria equipped with a single dnaE is hampered by the essentiality of the gene product (11). Our results demonstrate that the intact umuC gene is essential for UV-induced mutagenesis in S. uberis in vivo under the growth conditions used. The mutation types detected in the wt S. uberis strain after UV exposure were mainly transition-type base substitutions. This is in accordance with the transition mutations caused by PolV after UV induction in E. coli (30, 64). PolIV mainly produces –1 frameshift deletions in E. coli (69).

It was shown that the umuC gene is cotranscribed with a gene encoding the HdiR homolog as well as two unknown genes in S. uberis. Northern analyses suggest that the mRNA containing the hdiR-umuC-ORF3-ORF4 operon is processed within the umuC gene. The processing of the hdiR-umuC-ORF3-ORF4 transcript and possible differential stability of processing products could be a tool used by S. uberis to ensure that the amount of HdiR regulator exceeds other gene products of the operon and, possibly, results in more-efficient repression of the mutagenic operon. The novel regulator HdiR was previously characterized from L. lactis and was shown to function as a repressor that binds to an IR sequence located in the promoter regions of target genes (58). One target gene of HdiR was a umuC-like gene, present in L. lactis IL1403 but absent in another L. lactis strain, MG1363 (58). O'Driscoll and coworkers (44) recently reported the presence of a umuC ortholog in the Lactococcus plasmid pNP40 preceded by a repeat structure highly similar to the HdiR-binding sequence. EMSA revealed that the target sequence of S. uberis HdiR binding is located within an IR sequence that differs from the target of L. lactis HdiR. This is not surprising, since the two DNA-binding proteins are only 33% identical and the putative DNA-binding domains are not particularly well conserved (data not shown). DNA elements resembling the binding site of S. uberis HdiR were located upstream of hdiR and umuC genes in several Streptococcus species. However, it remains to be experimentally determined whether these DNA sequences represent functional operator sites of HdiR proteins in these organisms and whether the HdiR-binding site is conserved among streptococci. Database searches revealed that many, but not all, Streptococcus genomes encode proteins highly homologous to S. uberis UmuC. On the other hand, with the exception of S. pneumoniae genomes, all publicly available genome sequences from Streptococcaceae indicate the presence of an HdiR homolog (data not shown). However, the functions of all these HdiR-like proteins remain to be elucidated. Interestingly, while pathogenic and commensal members of the Streptococcaceae equipped with UmuC have conserved the organization of hdiR and umuC in a single operon, in the nonpathogenic dairy bacteria L. lactis and S. thermophilus, the operon organization has been split during evolution (Fig. 8.). It could be speculated that the presence of positive pressure in L. lactis and S. thermophilus, adapted to dairy environments, resulted in a separate regulator that gives the ability, e.g., for improved repression of mutagenic genes. umuDC homologs are often associated with mobile genetic elements of bacteria (49). In Streptococcus and Lactococcus, database searches revealed the presence of umuC homologs in plasmids, transposons, and genomic islands. Munoz-Najar and Vijayakumar (41) previously reported the presence of genes encoding UmuDC-like proteins in the pneumococcal conjugative transposon Tn5252. It was shown that plasmids carrying fragments of Tn5252 restored UV-inducible mutagenic repair in S. pneumoniae (41). The UmuD-like protein encoded by Tn5252 is highly homologous to HdiR; however, the lack of a HTH motif in the UmuD-like protein indicates functional diversification from HdiR. Small DNA damage-inducible and self-regulated gene cassettes capable of mediating adaptive mutagenesis have previously been identified from other bacteria including Proteobacteria and Actinobacteria (1, 20). However, to our knowledge the hdiR-umuC-ORF3-ORF4 operon enabling UV-induced adaptive mutagenesis in S. uberis, and potentially in other streptococci, represents the first SOS mutagenesis system that is not regulated by LexA.

In E. coli the function and activity of PolV is regulated at the transcriptional and posttranscriptional level, and it needs several other proteins to be capable of TLS. Despite the fact that UmuC is the catalytically active subunit, PolV requires two truncated UmuD subunits in order to be active (23). In gram-positive organisms, the functional homolog of UmuD remains to be identified despite the identification of candidates co-occurring with gram-positive UmuC-like proteins, like YqjX with YqjW in B. subtilis (19, 49). One of our future goals is to study the function encoded by the two uncharacterized genes present in hdiR-umuC-ORF3-ORF4 and address the question of why these genes co-occur with umuC among streptococci.

 
This study received financial support from the Academy of Finland (decision no. 211165 and 209136).

 
* Corresponding author. Mailing address: University of Helsinki, Department of Basic Veterinary Sciences, P.O. Box 66, FIN-00014, Finland. Phone: 358919157057. Fax: 358919157033. E-mail: pekka.varmanen{at}helsinki.fi

Published ahead of print on 18 May 2007.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Abella, M., I. Erill, M. Jara, G. Mazón, S. Campoy, and J. Barbé. 2004. Widespread distribution of a lexA-regulated DNA damage-inducible multiple gene cassette in the Proteobacterium phylum. Mol. Microbiol. 54:212-222.[CrossRef][Medline]
2
2. Banks, D. J., S. F. Porcella, K. D. Barbian, S. B. Beres, L. E. Philips, J. M. Voyich, F. R. DeLeo, J. M. Martin, G. A. Somerville, and J. M. Musser. 2004. Progress toward characterization of the group a Streptococcus metagenome: complete genome sequence of a macrolide-resistant serotype M6 strain. J. Infect. Dis. 190:727-738.[CrossRef][Medline]
3
3. Beaber, J. W., B. Hochhut, and M. K. Waldor. 2004. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature 427:72-74.[CrossRef][Medline]
4
4. Bisognano, C., W. L. Kelley, T. Estoppey, P. Francois, J. Schrenzel, D. Li, D. P. Lew, D. C. Hooper, A. L. Cheung, and P. Vaudaux. 2004. A RecA-LexA-dependent pathway mediates ciprofloxacin-induced fibronectin binding in Staphylococcus aureus. J. Biol. Chem. 279:9064-9071.[Abstract/Free Full Text]
5
5. Biswas, I., A. Gruss, S. D. Ehrlich, and E. Maguin. 1993. High-efficiency gene inactivation and replacement system for gram-positive bacteria. J. Bacteriol. 175:3628-3635.[Abstract/Free Full Text]
6
6. Bjedov, I., O. Tenaillon, B. Gerard, V. Souza, E. Denamur, M. Radman, F. Taddei, and I. Matic. 2003. Stress-induced mutagenesis in bacteria. Science 300:1404-1409.[Abstract/Free Full Text]
7
7. Bolotin, A., P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach, S. D. Ehrlich, and A. Sorokin. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11:731-753.[Abstract/Free Full Text]
8
8. Bolotin, A., B. Quinquis, P. Renault, A. Sorokin, S. D. Ehrlich, S. Kulakauskas, A. Lapidus, E. Goltsman, M. Mazur, G. D. Pusch, M. Fonstein, R. Overbeek, N. Kyprides, B. Purnelle, D. Prozzi, K. Ngui, D. Masuy, F. Hancy, S. Burteau, M. Boutry, J. Delcour, A. Goffeau, and P. Hols. 2004. Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus. Nat. Biotechnol. 22:1554-1558.[CrossRef][Medline]
9
9. Boshoff, H. I., M. B. Reed, C. E. Barry III, and V. Mizrahi. 2003. DnaE2 polymerase contributes to in vivo survival and the emergence of drug resistance in Mycobacterium tuberculosis. Cell 113:183-193.[CrossRef][Medline]
10
10. Bruck, I., and M. O'Donnell. 2000. The DNA replication machine of a gram-positive organism. J. Biol. Chem. 275:28971-28983.[Abstract/Free Full Text]
11
11. Bruck, I., M. F. Goodman, and M. O'Donnell. 2003. The essential C family DnaE polymerase is error-prone and efficient at lesion bypass. J. Biol. Chem. 278:44361-44368.[Abstract/Free Full Text]
12
12. Burckhardt, S. E., R. Woodgate, R. J. Scheuermann, and H. Echols. 1988. UmuD mutagenesis protein of Escherichia coli, overproduction, purification, and cleavage by RecA. Proc. Natl. Acad. Sci. USA 85:1811-1815.[Abstract/Free Full Text]
13
13. Campbell, E. A., N. Korzheva, A. Mustaev, K. Murakami, S. Nair, A. Goldfarb, and S. A. Darst. 2001. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 104:901-912.[CrossRef][Medline]
14
14. Cirz, R. T., J. K. Chin, D. R. Andes, V. D. Crecy-Lagard, W. A. Craig, and F. E. Romesberg. 2005. Inhibition of mutation and combating the evolution of antibiotic resistance. PLoS Biol. 3:e176.[CrossRef][Medline]
15
15. Cirz, R. T., N. Gingles, and F. E. Romesberg. 2006. Side effects may include evolution. Nat. Med. 12:890-891.[CrossRef][Medline]
16
16. Cirz, R. T., M. B. Jones, N. A. Gingles, T. D. Minogue, B. Jarrahi, S. N. Peterson, and F. E. Romesberg. 2007. The complete and SOS-mediated response of Staphylococcus aureus to the antibiotic ciprofloxacin. J. Bacteriol. 189:531-539.[Abstract/Free Full Text]
17
17. Dodd, I. B., and J. B. Egan. 1990. Improved detection of helix-turn-helix DNA binding motifs in protein sequences. Nucleic Acids Res. 18:5019-5026.[Abstract/Free Full Text]
18
18. Dougherty, B. A., C. Hill, J. F. Weidman, D. R. Richardson, J. C. Venter, and R. P. Ross. 1998. Sequence and analysis of the 60 kb conjugative, bacteriocin-producing plasmid pMRC01 from Lactococcus lactis DPC3147. Mol. Microbiol. 29:1029-1038.[CrossRef][Medline]
19
19. Duigou, S., S. D. Ehrlich, P. Noirot, and M. F. Noirot-Gros. 2004. Distinctive genetic features exhibited by the Y-family DNA polymerases in Bacillus subtilis. Mol. Microbiol. 54:439-451.[CrossRef][Medline]
20
20. Erill, I., S. Campoy, G. Mazon, and J. Barbe. 2006. Dispersal and regulation of an adaptive mutagenesis cassette in the Bacteria domain. Nucleic Acids Res. 34:66-77.[Abstract/Free Full Text]
21
21. Frees, D., P. Varmanen, and H. Ingmer. 2001. Inactivation of a gene that is highly conserved in gram-positive bacteria stimulates degradation of non-native proteins and concomitantly increases stress tolerance in Lactococcus lactis. Mol. Microbiol. 41:93-103.[CrossRef][Medline]
22
22. Frees, D., K. Savijoki, P. Varmanen, and H. Ingmer. 2007. Clp ATPases and ClpP proteolytic complexes regulate vital biological processes in low GC, gram-positive bacteria. Mol. Microbiol. 63:1285-1295.[CrossRef][Medline]
23
23. Friedberg, E. C., G. C. Walker, W. Seide, R. D. Wood, R. A. Schultz, and T. Ellenberger. 2006. DNA repair and mutagenesis, 2nd ed. American Society for Microbiology, Washington, DC.
24
24. Gasc, A. M., N. Sicard, J. P. Claverys, and A. M. Sicard. 1980. Lack of SOS repair in Streptococcus pneumoniae. Mutat. Res. 70:157-165.[CrossRef][Medline]
25
25. Goerke, C., J. Koller, and C. Wolz. 2006. Ciprofloxacin and trimethoprim cause phage induction and virulence modulation in Staphylococcus aureus. Antimicrob. Agents Chemother. 50:171-177.[Abstract/Free Full Text]
26
26. Hill, A. W. 1988. Pathogenicity of two strains of Streptococcus uberis infused into lactating and non-lactating bovine mammary glands. Res. Vet. Sci. 45:400-404.[Medline]
27
27. Janoir, C., V. Zeller, M. D. Kitziz, N. J. Moreau, and L. Gutmann. 1996. High-level fluoroquinolone resistance in Streptococcus pneumoniae requires mutations in parC and gyrA. Antimicrob. Agents Chemother. 40:2760-2764.[Abstract]
28
28. Kelley, W. L. 2006. LexA marks the spot: the virulent side of SOS and a closer look at the LexA regulon. Mol. Microbiol. 62:1228-1238.[CrossRef][Medline]
29
29. Kimoto, H., and A. Taketo. 2003. Efficient electrotransformation system and gene targeting in pyogenic streptococci. Biosci. Biotechnol. Biochem. 67:2203-2209.[CrossRef][Medline]
30
30. LeClerc, J. E., A. Borden, and C. W. Lawrence. 1991. The thymine-thymine pyrimidine-pyrimidinone (6-4) ultraviolet light photoproduct is highly mutagenic and specifically induces 3' thymine-to-cytosine transitions in Escherichia coli. Proc. Natl. Acad. Sci. USA 88:9685-9689.[Abstract/Free Full Text]
31
31. Leigh, J. A., T. R. Field, and M. R. Williams. 1990. Two strains of Streptococcus uberis, of differing ability to cause clinical mastitis, differ in their ability to resist some host defence factors. Res. Vet. Sci. 49:85-87.[Medline]
32
32. Lewin, C. S., and S. G. Amyes. 1991. The role of the SOS response in bacteria exposed to zidovudine or trimethoprim. J. Med. Microbiol. 34:329.[Abstract/Free Full Text]
33
33. Lim, S., D. Bast, A. McGeer, J. de Azavedo, and D. E. Low. 2003. Antimicrobial susceptibility breakpoints and first-step parC mutations in Streptococcus pneumoniae: redefining fluoroquinolone resistance. Emerg. Infect. Dis. 9:833-837.[Medline]
34
34. Little, J. W. 1984. Autodigestion of LexA and phage lambda repressors. Proc. Natl. Acad. Sci. USA 81:1375-1379.[Abstract/Free Full Text]
35
35. Little, J. W. 1991. Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease. Biochimie 73:411-422.[Medline]
36
36. Maguin, E., H. Prevost, S. D. Ehrlich, and A. Gruss. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935.[Abstract/Free Full Text]
37
37. Maiques, E., C. Ubeda, S. Campoy, S. Salvador, I. Lasa, R. P. Novick, J. Barbe, and J. R. Penades. 2006. ß-Lactam antibiotics induce the SOS response and horizontal transfer of virulence factors in Staphylococcus aureus. J. Bacteriol. 188:2726-2729.[Abstract/Free Full Text]
38
38. Makarova, K., A. Slesarev, Y. Wolf, A. Sorokin, B. Mirkin, E. Koonin, A. Pavlov, N. Pavlova, V. Karamychev, N. Polouchine, V. Shakhova, I. Grigoriev, Y. Lou, D. Rohksar, S. Lucas, K. Huang, D. M. Goodstein, T. Hawkins, V. Plengvidhya, D. Welker, J. Hughes, Y. Goh, A. Benson, K. Baldwin, J. H. Lee, I. Diaz-Muniz, B. Dosti, V. Smeianov, W. Wechter, R. Barabote, G. Lorca, E. Altermann, R. Barrangou, B. Ganesan, Y. Xie, H. Rawsthorne, D. Tamir, C. Parker, F. Breidt, J. Broadbent, R. Hutkins, D. O'sullivan, J. Steele, G. Unlu, M. Saier, T. Klaenhammer, P. Richardson, S. Kozyavkin, B. Weimer, and D. Mills. 2006. Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. USA 103:15611-15616.[Abstract/Free Full Text]
39
39. Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer, and S. N. Cohen. 2004. SOS response induction by ß-lactams and bacterial defense against antibiotic lethality. Science 305:1629-1631.[Abstract/Free Full Text]
40
40. Milne, M. H., A. M. Biggs, D. C. Barrett, F. J. Young, S. Doherty, G. T. Innocent, and J. L. Fitzpatrick. 2005. Treatment of persistent intramammary infections with Streptococcus uberis in dairy cows. Vet. Rec. 27:245-250.
41
41. Munoz-Najar, U., and M. N. Vijayakumar. 1999. An operon that confers UV resistance by evoking the SOS mutagenic response in streptococcal conjugative transposon Tn5252. J. Bacteriol. 181:2782-2788.[Abstract/Free Full Text]
42
42. Nohmi, T. 2006. Environmental stress and lesion-bypass DNA polymerases. Annu. Rev. Microbiol. 60:231-253.[CrossRef][Medline]
43
43. O'Driscoll, J., F. Glynn, O. Cahalane, M. O'Connell-Motherway, G. F. Fitzgerald, and D. Van Sinderen. 2004. Lactococcal plasmid pNP40 encodes a novel, temperature-sensitive restriction-modification system. Appl. Environ. Microbiol. 70:5546-5556.[Abstract/Free Full Text]
44
44. O'Driscoll, J., F. Glynn, G. F. Fitzgerald, and D. van Sinderen. 2006. Sequence analysis of the lactococcal plasmid pNP40: a mobile replicon for coping with environmental hazards. J. Bacteriol. 188:6629-6639.[Abstract/Free Full Text]
45
45. Ohmori, H., E. C. Friedberg, R. P. Fuchs, M. F. Goodman, F. Hanaoka, D. Hinkle, T. A. Kunkel, C. W. Lawrence, Z. Livneh, T. Nohmi, L. Prakash, S. Prakash, T. Todo, G. C. Walker, Z. Wang, and R. Woodgate. 2001. The Y-family of DNA polymerases. Mol. Cell 8:7-8.[CrossRef][Medline]
46
46. Orscheln, R. C., D. R. Johnson, S. M. Olson, R. M. Presti, J. M. Martin, E. L. Kaplan, and G. A. Storch. 2005. Intrinsic reduced susceptibility of serotype 6 Streptococcus pyogenes to fluoroquinolone antibiotics. J. Infect. Dis. 191:1272-1279.[CrossRef][Medline]
47
47. Pan, X. S., and L. M. Fisher. 1996. Cloning and characterization of the parC and parE genes of Streptococcus pneumoniae encoding DNA topoisomerase IV: role in fluoroquinolone resistance. J. Bacteriol. 178:4060-4069.[Abstract/Free Full Text]
48
48. Pavlovic, G., V. Burrus, B. Gintz, B. Decaris, and G. Guédon. 2004. Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology 150:759-774.[Abstract/Free Full Text]
49
49. Permina, E. A., A. A. Mironov, and M. S. Gelfand. 2002. Damage-repair error-prone polymerases of eubacteria: association with mobile genome elements. Gene 293:133-140.[CrossRef][Medline]
50
50. Power, E. G., and I. Phillips. 1992. Induction of the SOS gene (umuC) by 4-quinolone antibacterial drugs. J. Med. Microbiol. 36:78-82.[Abstract/Free Full Text]
51
51. Prudhomme, M., L. Attaiech, G. Sanchez, B. Martin, and J. P. Claverys. 2006. Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae. Science 313:89-92.[Abstract/Free Full Text]
52
52. Radman, M. 1974. Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli: SOS repair hypothesis, p. 128-142. In L. Prakash, F. Sherman, M. Miller, C. W. Lawrence, and H. W. Tabor (ed.), Molecular and environmental aspects of mutagenesis. Charles C. Thomas, Springfield, IL.
53
53. Reuven, N. B., G. Arad, A. Maor-Shoshani, and Z. Livneh. 1999. The mutagenesis protein UmuC is a DNA polymerase activated by UmuD', RecA, and SSB and is specialized for translesion replication. J. Biol. Chem. 274:31763-31766.[Abstract/Free Full Text]
54
54. Rosenberg, S. M. 2001. Evolving responsively: adaptive mutation. Nat. Rev. Genet. 2:504-515.[Medline]
55
55. Sambrook, J., and D. W. Russell. 2001. Molecular cloning. A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
56
56. Santagati, M., F. Iannelli, C. Cascone, F. Campanile, M. R. Oggioni, S. Stefani, and G. Pozzi. 2003. The novel conjugative transposon Tn1207.3 carries the macrolide efflux gene mef(A) in Streptococcus pyogenes. Microb. Drug Resist. 9:243-247.[CrossRef][Medline]
57
57. Sassanfar, M., and J. W. Roberts. 1990. Nature of the SOS-inducing signal in Escherichia coli. The involvement of DNA replication. J. Mol. Biol. 212:79-96.[CrossRef][Medline]
58
58. Savijoki, K., H. Ingmer, D. Frees, F. K. Vogensen, A. Palva, and P. Varmanen. 2003. Heat and DNA damage induction of the LexA-like regulator HdiR from Lactococcus lactis is mediated by RecA and ClpP. Mol. Microbiol. 50:609-621.[CrossRef][Medline]
59
59. Slilaty, S. N., and J. W. Little. 1987. Lysine-156 and serine-119 are required for LexA repressor cleavage: a possible mechanism. Proc. Natl. Acad. Sci. USA 84:3987-3991.[Abstract/Free Full Text]
60
60. Smith, A. J., P. N. Ward, T. R. Field, C. L. Jones, R. A. Lincoln, and J. A. Leigh. 2003. MtuA, a lipoprotein receptor antigen from Streptococcus uberis, is responsible for acquisition of manganese during growth in milk and is essential for infection of the lactating bovine mammary gland. Infect. Immun. 71:4842-4849.[Abstract/Free Full Text]
61
61. Sommer, S., J. Knezevic, A. Bailone, and R. Devoret. 1993. Induction of only one SOS operon, umuDC, is required for SOS mutagenesis in Escherichia coli. Mol. Gen. Genet. 239:137-144.[Medline]
62
62. Sung, H. M., G. Yeamans, C. A. Ross, and R. E. Yasbin. 2003. Roles of YqjH and YqjW, homologs of the Escherichia coli UmuC/DinB or Y superfamily of DNA polymerases, in stationary-phase mutagenesis and UV-induced mutagenesis of Bacillus subtilis. J. Bacteriol. 185:2153-2160.[Abstract/Free Full Text]
63
63. Sutton, M. D., B. T. Smith, V. G. Godoy, and G. C. Walker. 2000. The SOS response: recent insights into umuDC-dependent DNA damage tolerance. Annu. Rev. Genet. 34:479-497.[CrossRef][Medline]
64
64. Tang, M., P. Pham, X. Shen, J.-S. Taylor, M. O'Donnell, R. Woodgate, and M. F. Goodman. 2000. Roles of E. coli polymerases IV and V in lesion-targeted and untargeted SOS mutagenesis. Nature 404:1014-1018.[CrossRef][Medline]
65
65. Tettelin, H., V. Masignani, M. J. Cieslewicz, J. A. Eisen, S. Peterson, M. R. Wessels, I. T. Paulsen, K. E. Nelson, I. Margarit, T. D. Read, L. C. Madoff, A. M. Wolf, M. J. Beanan, L. M. Brinkac, S. C. Daugherty, R. T. DeBoy, A. S. Durkin, J. F. Kolonay, R. Madupu, M. R. Lewis, D. Radune, N. B. Fedorova, D. Scanlan, H. Khouri, S. Mulligan, H. A. Carty, R. T. Cline, S. E. Van Aken, J. Gill, M. Scarselli, M. Mora, E. T. Iacobini, C. Brettoni, G. Galli, M. Mariani, F. Vegni, D. Maione, D. Rinaudo, R. Rappuoli, J. L. Telford, D. L. Kasper, G. Grandi, and C. M. Fraser. 2002. Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc. Natl. Acad. Sci. USA 99:12391-12396.[Abstract/Free Full Text]
66
66. Tettelin, H., V. Masignani, M. J. Cieslewicz, C. Donati, D. Medini, N. L. Ward, S. V. Angiuoli, J. Crabtree, A. L. Jones, A. S. Durkin, R. T. Deboy, T. M. Davidsen, M. Mora, M. Scarselli, I. Ros, J. D. Peterson, C. R. Hauser, J. P. Sundaram, W. C. Nelson, R. Madupu, L. M. Brinkac, R. J. Dodson, M. J. Rosovitz, S. A. Sullivan, S. C. Daugherty, D. H. Haft, J. Selengut, M. L. Gwinn, L. Zhou, N. Zafar, H. Khouri, D. Radune, G. Dimitrov, K. Watkins, K. J. O'Connor, S. Smith, T. R. Utterback, O. White, C. E. Rubens, G. Grandi, L. C. Madoff, D. L. Kasper, J. L. Telford, M. R. Wessels, R. Rappuoli, and C. M. Fraser. 2005. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial "pan-genome". Proc. Natl. Acad. Sci. USA 102:13950-13955.[Abstract/Free Full Text]
67
67. Ùbeda, C., E. Maiques, E. Knecht, I. Lasa, R. P. Novick, and J. R. Penades. 2005. Antibiotic-induced SOS response promotes horizontal dissemination of pathogenicity island-encoded virulence factors in staphylococci. Mol. Microbiol. 56:836-844.[CrossRef][Medline]
68
68. Varmanen, P., H. Ingmer, and F. K. Vogensen. 2000. ctsR of Lactococcus lactis encodes a negative regulator of clp gene expression. Microbiology 146:1447-1455.[Abstract/Free Full Text]
69
69. Wagner, J., P. Gruz, S. R. Kim, M. Yamada, K. Matsui, R. P. Fuchs, and T. Nohmi. 1999. The dinB gene encodes a novel E. coli DNA polymerase, DNA Pol IV, involved in mutagenesis. Mol. Cell 4:281-286.[CrossRef][Medline]
70
70. Xu, P., J. M. Alves, T. Kitten, A. Brown, Z. Chen, L. S. Ozaki, P. Manque, X. Ge, M. G. Serrano, D. Puiu, S. Hendricks, Y. Wang, M. D. Chaplin, D. Akan, S. Paik, D. L. Peterson, F. L. Macrina, and G. A. Buck. 2007. Genome of the opportunistic pathogen Streptococcus sanguinis. J. Bacteriol. 189:3166-3175.[Abstract/Free Full Text]

---

Journal of Bacteriology, July 2007, p. 5210-5222, Vol. 189, No. 14
0021-9193/07/$08.00+0     doi:10.1128/JB.00473-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Scott, J., Thompson-Mayberry, P., Lahmamsi, S., King, C. J., McShan, W. M. (2008). Phage-Associated Mutator Phenotype in Group A Streptococcus. J. Bacteriol. 190: 6290-6301 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Varhimo, E. Articles by Varmanen, P. Search for Related Content PubMed PubMed Citation Articles by Varhimo, E. Articles by Varmanen, P.