This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lasocki, K.
Right arrow Articles by Jagura-Burdzy, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lasocki, K.
Right arrow Articles by Jagura-Burdzy, G.

 Previous Article  |  Next Article 

Journal of Bacteriology, August 2007, p. 5762-5772, Vol. 189, No. 15
0021-9193/07/$08.00+0     doi:10.1128/JB.00371-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Deletion of the parA (soj) Homologue in Pseudomonas aeruginosa Causes ParB Instability and Affects Growth Rate, Chromosome Segregation, and Motility{triangledown}

Krzysztof Lasocki,1,{dagger} Aneta A. Bartosik,1 Jolanta Mierzejewska,1 Christopher M. Thomas,2 and Grazyna Jagura-Burdzy1*

The Institute of Biochemistry and Biophysics, PAS, 02-106 Warsaw, Pawinskiego 5A, Poland,1 School of Biosciences, The University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdon2

Received 12 March 2007/ Accepted 22 May 2007


arrow
ABSTRACT
 
The parA and parB genes of Pseudomonas aeruginosa are located approximately 8 kb anticlockwise from oriC. ParA is a cytosolic protein present at a level of around 600 molecules per cell in exponential phase, but the level drops about fivefold in stationary phase. Overproduction of full-length ParA or the N-terminal 85 amino acids severely inhibits growth of P. aeruginosa and P. putida. Both inactivation of parA and overexpression of parA in trans in P. aeruginosa also lead to accumulation of anucleate cells and changes in motility. Inactivation of parA also increases the turnover rate (degradation) of ParB. This may provide a mechanism for controlling the level of ParB in response to the growth rate and expression of the parAB operon.


arrow
INTRODUCTION
 
The ubiquitous superfamily of Walker-type ATPases is involved in many bacterial processes (7, 34, 45). One subfamily of these proteins, the ParA proteins, normally functions with a second protein, ParB, and in plasmid systems the combination of ParA and ParB has been associated with better-than-random segregation of low-copy-number plasmids (6, 19, 23). Although the plasmid partitioning systems fall into two groups on the basis of the ATPase type of component A (type I with Walker-type ATPase and type II with actin-like ATPase), the two groups seem to be unified in the general mechanism of plasmid pairing and directional separation of plasmid molecules prior to cell division. The ParB-like protein binds a centromere-like sequence and is proposed to form pairs of the plasmid molecules (12, 17, 30, 54). The separation of replicons and their transfer towards opposite poles of the dividing cell correlate with the ability of the ParA-like protein to form a dynamic scaffold in the cells (1, 3, 11, 41), its ATPase activity, and its ability to interact with the ParB-parS complex.

Duplication of bacterial chromosomes is part of the cell cycle events leading to cell division. Data gathered during the last decade have revealed the role of many different proteins involved in replication and segregation, as well as the spatial and temporal sequence of these processes (4, 14). However, there are still many questions concerning the directional separation of chromosomes to the progeny cells and the regulation of this process. The discovery of highly conserved homologues of ParA (Walker-type ATPase) and ParB encoded by bacterial chromosomes in close vicinity to oriC (5, 18, 36, 44, 47) suggested a role for these proteins in chromosome segregation. To date, the potential roles of both the ParA and ParB proteins in cell biology have been related to regulatory cell cycle check points (8, 16, 37, 44, 48, 49), positioning of oriC domains (38, 50), separation of replicated origins (37), and the translocation of the proteins to fixed cell locations (55, 61). Studies on chromosomal ParA and ParB also revealed a lack of uniformity in their action in different organisms despite the high degree of conservation at the levels of sequence and genetic organization (5, 20, 21, 26, 32, 40, 44, 55, 56, 60).

The aim of the work described in this paper was to define the role of ParA of Pseudomonas aeruginosa in order to complement previously reported studies on ParB (5). The par genes are in a region located approximately 8 kb from oriC of P. aeruginosa PAO1 between coordinates 6254972 and 6259197 (accession no. NC_002516) as part of a block of four adjacent open reading frames, gidA, gidB, parA, and parB, which are predicted to be transcribed counterclockwise (Fig. 1). The DNA sequence suggests the possibility of translational coupling of gidB to gidA (the last nucleotide of the stop codon for gidA is the A in an ATG codon for gidB) and parB to parA (the ribosome binding site [RBS] for parB overlaps the stop codon for parA [TAAGGAACCCGCATG]), whereas there is 18 nucleotides between the last nucleotide of gidB and the start of parA (Fig. 1A). In this paper we show that parA insertional and nonsense mutant strains are viable and that such mutants exhibit not only strong defects in chromosome segregation but also a variety of physiological changes. A lack of ParA leads to instability of ParB. The observed defects of parA mutants cannot be easily complemented by plasmid parA, parB, or parA parB alleles as even a slight excess of either or both Par proteins causes defects in chromosome segregation, the rate of growth, and cell motility.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 1. Organization of the oriC region of the P. aeruginosa genome. The gene designations used and the coordinates for open reading frames (box arrows with gene names) in the gid-par operon are those used for the P. aeruginosa PAO1 genome sequence (accession no. NC_002516). The positions of primers used for PCR are indicated by solid arrows.


arrow
MATERIALS AND METHODS
 
Bacterial strains and growth conditions. The Escherichia coli strains used were K-12 strain DH5{alpha} [F {phi}80dlacZ{Delta}M15 recA1 endA1 gyrA96 thi-1 hsdR17(rK mK+) supE44 relA1 deoR {Delta}(lacZYA-argF)U196], B strain BL21 [F ompT hsdSB(rB mB) gal dcm ({lambda} DE3)] (Novagen Inc.), and S17-1 (recA pro hsdR RP4-2-Tc::Mu-Km::Tn7) (58). P. aeruginosa PAO1161 (leu r m+) was kindly provided by B. M. Holloway (Monash University, Australia). PAO1161parA::smh (leu r parA40::smh) was isolated by insertion of an Smr cassette (15) into the unique BamHI site in the parA gene. PAO1161parAstop (leu r parAstop) is a derivative with two stop codons after the ATG initiation codon in parA. PAO1161Rifr was isolated during growth on 125 µg ml–1 rifampin. Pseudomonas putida strain KT2442 (gfp Rifr) was kindly provided by K. Smalla. Bacteria were generally grown in L broth (31) at 37°C or 30°C. Some experiments were performed in M9 medium (53). L agar (L broth with 1.5% [wt/vol] agar) was supplemented with antibiotics when appropriate as follows: benzylpenicillin (sodium salt), 150 µg ml–1 in liquid media and 300 µg ml–1 in agar plates for penicillin resistance in E. coli; kanamycin sulfate, 50 µg ml–1 for kanamycin resistance in E. coli; streptomycin sulfate, 30 µg ml–1 for streptomycin resistance in E. coli, 60 µg ml–1 in P. putida, and 200 µg ml–1 in P. aeruginosa; chloramphenicol, 10 µg ml–1 for chloramphenicol resistance in E. coli and 100 µg ml–1 in P. aeruginosa; and carbenicillin, 300 µg ml–1 for carbenicillin resistance in P. aeruginosa. The L agar used for blue/white screening contained 0.1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) at 40 µg ml–1.

Plasmid DNA isolation, analysis, and cloning and manipulation of DNA. Plasmid DNA was isolated by standard procedures (53). Digestion of plasmid DNA with restriction enzymes was carried out under conditions recommended by the suppliers, and preparations were run on 0.8 to 2.0% (wt/vol) agarose gels.

Plasmids for transcriptional fusions with regulated expression were constructed as follows (Table 1). For expression of cloned open reading frames, either the high-copy-number Pnr vector pGBT30 (27), based on the pMB1 replicon with lacIq and tacp followed by the multiple cloning site from pUC18, or IncQ-based broad-host-range plasmid pGBT400 (28) was used. To use the RBS sequence associated with tacp, the ATG codon of the inserted open reading frame must directly follow the EcoRI site. To create parA deletion alleles, the unique restriction sites in parA were blunt ended and ligated either with the "EcoRI" oligonucleotide, introducing an EcoRI recognition site followed by a ATG codon in phase with the rest of parA coding sequence, or with the "SalI" oligonucleotide, introducing a SalI recognition site and stop codons in all three frames. This produced truncated forms of ParA proteins that also contained additional amino acids at the deletion points. For example, the parA1-40 allele (obtained after modification of a BamHI site) encoded ParA1-40 with two additional C-terminal amino acids, Leu and Thr. The SalI-PstI fragments of pGBT30 derivatives with the parA alleles and all upstream control elements were also recloned into the pBBR1-MCS1 replicon carrying a Cmr cassette (35).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Plasmids used in this work

A plasmid for ParA purification (pKLB8.1) was constructed by inserting the parA allele into a derivative of pET28a Kmr (59) (Novagen Inc.) modified with the help of the synthetic oligomer so that a His6 tag and thrombin cleavage site almost directly precede the EcoRI site (42). Standard PCRs (46) were performed with pairs of the following primers (coordinates in the accession no. NC_002516 sequence): parA1 (CCGAATTCATGGCTAAGGTATTCGC) (coordinates 6256642 to 6256626), parA2 (CCGTCGACCCCAGTCCACGTTTCTTG) (coordinates 6255819 to 6255836), parA3 (CCGAATTCCTGCTGATACTGCGGCGC) (coordinates 6256687 to 6256670), parB1 (CCGAATTCATGGCAGCCAAGAAACGTGG) (coordinates 6255844 to 6255825), parB2 (CCGTCGACCCGACTACCCGCTACAACCC) (coordinates 6254944 to 6254963), gidB1 (CCGAATTCATGTCTGCGGTAACCCA) (coordinates 6257305 to 6257289), parAp1 (GGATCCCGAACTGAAGCTGGCCAA) (coordinates 6256952 to 6256936), parAstop1 (CAGGGATAACCATGTGATAAGGAATTCGCGATCGCCA) (coordinates 6256653 to 6256618), parAstop2 (CGATCGCGAATTCCTTATCACATGGTTATCCCTGTTC) (coordinates 6256615 to 6256656), EcoRI (CATGAATTCATG), EcoRIG (GCATGAATTCATGC), EcoRIGC (GCCATGAATTCATGGC), and SalI (TGACCTAGTCGACTAGGTCA) (the underlining indicates restriction enzyme recognition sites, and the boldface type indicates start and stop codons).

The PCR to amplify parA was performed with a hot start denaturation step (98°C for 5 min) and 35 cycles of denaturation (94°C for 30 s), annealing (52°C for 30 s), and elongation (72°C for 90 s). The reaction ended with a final elongation step (72°C for 7 min). PCR products were usually cloned into the pGEM-T vector (Promega) and later recloned into appropriate vectors. All PCR-derived clones were analyzed by DNA sequencing to check their fidelity.

Site-directed mutagenesis by PCR. The primers for site-directed mutagenesis by PCR (parAstop1 and parAstop2) introduced the stop codons TGA and TAA into parA immediately after ATG and included an EcoRI recognition site to help identify the mutagenized allele. The PCRs were performed using Stratagene's QuikChange site-directed mutagenesis method with pGMB85, a pAKE600 derivative with a gidB1-parA2 PCR fragment cloned between EcoRI-SalI sites, as the template. The products of PCR amplification were treated with DpnI and used for transformation. The clones with an additional EcoRI site introduced were further verified by DNA sequencing.

Sequencing and computer sequence analysis. DNA sequencing was performed using a Pharmacia A.L.F. automatic sequencer (IBB, PAS, Warsaw, Poland) and dye terminator kits supplied by the manufacturer. DNA and amino acid sequence analysis was carried out using the GCG Wisconsin package, version 8.0. Sequences were compared to GenBank/EMBL databases and studied using the programs BlastN and BlastP (NCBI).

Bacterial transformation and conjugation. Competent cells of E. coli and P. putida were prepared by the standard CaCl2 method (53). P. aeruginosa transformation was done by method of Irani and Rowe (25). Bacterial conjugation was done on solid medium for 12 h at 37°C. A filter with a mixture of donor, recipient, and transconjugants was washed with L broth, and dilutions were plated on the selective media.

Motility assays. For the P. aeruginosa swimming assay tryptone plates (1% tryptone, 0.5% NaCl, 0.3% agar) were inoculated with a sterile toothpick and incubated for 24 h at 30°C or 37°C. For the swarming test, plates containing 0.5% Bacto agar and supplemented with 5 g of dextrose/liter and 8 g of nutrient broth/liter were inoculated with a sterile toothpick and incubated for 24 to 48 h at 30°C or 37°C. For the twitching assay thin (3-mm) L-agar plates were inoculated to the bottom with a sterile toothpick and incubated for 48 h at 30°C or 37°C (51). All sets of plates were standardized by using the same volume of medium.

Purification of His6-tailed ParA. Exponentially growing BL21({lambda}DE3)(pKLB8.1) was induced with 0.2 mM IPTG at a density of approximately 2 x 108 CFU ml–1 and grown for an additional 2 to 3 h with shaking at 30°C. The bacteria in a 500-ml culture were harvested by centrifugation and sonicated in 50 mM Na phosphate buffer (pH 8.0)-1 M NaCl. A cell lysate-Ni2+-nitrilotriactic acid agarose mixture was stirred for 60 min at 4°C and then transferred to a column. The resin was allowed to settle, the flowthrough was collected, and the column was washed twice with 5 ml of ParA wash buffer (50 mM Na phosphate buffer [pH 8.0], 1 M NaCl, 40 mM imidazole). Six 0.5-ml portions of ParA elution buffer (50 mM Na phosphate buffer [pH 8.0], 1 M NaCl, 50 to 300 mM imidazole) were applied to the column and collected separately. The purification procedure was monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a Pharmacia PHAST gel system.

Preparation of anti-ParA antiserum. Purified His6-ParA protein (1 mg ml–1) was injected into a rabbit. The blood collected from the rabbit was allowed to clot at room temperature before antiserum was removed. The simple method for partially purifying antibodies from antibodies cross-reacting with E. coli proteins was applied (29). This method increased significantly the specificity of anti-ParA and anti-ParB antibodies (5).

Protein analysis. The polypeptides were separated by standard SDS-PAGE (53). For Western blotting the proteins were electroblotted for 1 to 2 h onto nitrocellulose membranes (Protran BA-85; Schleicher & Schuell) using a semidry transfer unit (Bio-Rad). The nitrocellulose membranes were blocked in blocking solution (5% nonfat dry milk in Tris-buffered saline, which contained 20 mM Tris-HCl [pH 7.5], 500 mM NaCl, and 300 mM KCl) and then incubated for 2 h with antibodies diluted 1:10,000 in blocking solution. The membranes were washed repeatedly in Tris-buffered saline with 0.05% (vol/vol) Tween 20 (TTBS) and then probed for 1 h with the secondary antibody (goat anti-rabbit class II alkaline phosphatase-conjugated antibodies) diluted 1:15,000 in TTBS with 5% milk. Then the membranes were washed three times in TTBS, and color was developed as recommended by Promega. The band intensity on Western blots was determined using Image Quant (Molecular Dynamics).

Introduction of mutant alleles into the PAO1161 backbone by reverse genetics. The parA gene was amplified together with upstream sequences using primers parAp1 and parA2 and cloned as an EcoRI-SalI fragment into the suicide vector pAKE600 (13) after removal of the BamHI site to obtain pKLB60.2. The pAKE600 plasmid, based on the pMB1 replicon, is not able to propagate in Pseudomonas but carries oriTRK2, so it can be mobilized into different hosts using a helper strain with a functional cognate conjugation system. It also carries sacB of Bacillus subtilis determining sensitivity to sucrose (13). The unique BamHI site in parA was used as the site for insertion of an Smr cassette (smh) from pHP{Omega}45 (15) into pKLB60.2. This 2-kb cassette is surrounded by short HindIII-BamHI linkers (15 nucleotides) with stop codons in all three phases to eliminate the possibility of translational fusions in the insertion site regardless of the cassette orientation. Insertion of the Smr cassette 120 bp from the start of parA leads to production of a truncated gene product consisting of the first 41 amino acids of ParA extended by a 3-amino-acid tail consisting of Val, Ile, and Asp. The pKLB60.2 plasmid was transformed into E. coli S17-1 (with an integrated truncated copy of the RK2 IncP-1{alpha} backbone) and then mobilized into P. aeruginosa PAO1161Rifr. The pAKE600 derivative pABB610 with the mutant allele parAstop was also transformed into E. coli S17-1 and mobilized into PAO1161Rifr. Putative exconjugants-cointegrates were selected on L agar with rifampin and carbenicillin (streptomycin for an insertional parA mutant). After double restreaking Rifr Cbr (Smr) colonies were used to inoculate L broth containing 10% (wt/vol) sucrose and streptomycin to facilitate selection of recombinants with the suicide vector removed from PAO1161. Survivors were plated on L agar with 10% (wt/vol) sucrose and checked for the Cbs phenotype. Sucr Cbs colonies were analyzed by colony PCR to verify the allele exchange either by sizing (parA::smh) or by digesting the PCR products with EcoRI (allele parAstop). Protein extracts of putative PAO1161parA mutants were analyzed by Western blotting with anti-ParA antibody to confirm knockout of the parA gene.

DAPI staining. Cells were placed on slides covered with 0.01% poly-L-lysine (Sigma). The typical volumes used were 5 µl for a culture in mid-log phase and 1 µl diluted in 4 µl of LB medium for a culture in stationary phase. The bacteria were allowed to adhere to the poly-L-lysine layer for 5 min. Nonbound bacteria were washed out by rinsing a slide twice with PSB buffer (10 mM Na phosphate [pH 7.4], 15 mM KCl, 150 mM NaCl). Cells were then fixed using 3.7% formaldehyde and stained with DAPI (4',6'-diamidino-2-phenylindole) (5 µg ml–1) for 15 min. From this point onward slides were kept in the dark. Cells were analyzed using a Nikon Eclipse EC 800 microscope. Phase-contrast images were collected with the Lucia G software, whereas DNA stained with DAPI was visualized with the Lucia G/F software. Overlays of images were obtained with the Lucia G/F software (Nikon).

Electron microscopy. Cells from L-agar plates were deposited with a toothpick on a drop of water. Formvar (0.5%)-coated 75-mesh grids were placed on top of the drop for 15 s to allow adhesion of the cells. Grids were stained for 20 s with freshly prepared 1% phosphotungstic acid and 1.5% glutaraldehyde and washed twice for 10 s in a drop of water. The grids were air dried and examined with an LEO912AB transmission electron microscope.


arrow
RESULTS
 
ParA is a cytosolic protein produced at a low level. The parA coding region (primers parA1 and parA2) (Fig. 1) was cloned under control of T7p in a pET28 derivative (pKLB8.1). ParA was overproduced as an N-His6-tagged protein and used to raise polyclonal antibodies. Using the anti-ParA antibodies, ParA was detected in P. aeruginosa lysates (Fig. 2A). To monitor the fate of ParA in actively growing versus nongrowing cells of P. aeruginosa, samples of 2 x 109 cells from PAO1161 cultures were collected at different time points. The sonicates were cleared by centrifugation to determine the distribution of ParA between the soluble and insoluble fractions, the proteins were separated by SDS-PAGE, and the level of ParA was estimated using ImageQuant by comparison with dilutions of purified ParA protein run on the same gel (Fig. 2B). The calculated level of ParA was in the range from 500 to 700 molecules per cell in actively dividing cells and was up to fivefold lower in late stationary phase. In logarithmically growing bacteria ParA was found only in the soluble fraction under both high and low osmotic conditions during lysis (Fig. 2C), and the same result was obtained for bacteria in transition-phase and stationary-phase cultures (data not shown).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 2. ParA intracellular level in P. aeruginosa and location of ParA in the soluble or insoluble fraction. (A) Extracts from logarithmic-phase cultures of P. aeruginosa, E. coli, and their plasmid transformants with tacp-parA (induced with 0.5 mM IPTG). Lane 1, DH5{alpha}(pKLB1 tacp-parA) (108 cells); lane 2, DH5{alpha}(pKLB40.1 tacp-parA) (108 cells); lane 3, PAO1161(pKLB40.1 tacp-parA) (108 cells); lane 4, PAO1161 (109 cells); lane 5, DH5{alpha} (1010 cells) (negative control). pKLB1 is a high-copy-number plasmid, whereas pKLB40.1 is a medium-copy-number plasmid. (B) Intracellular level of ParA. Overnight cultures of PAO1161 were diluted 103-fold and grown at 37°C with shaking. Samples from five cultures, designated cultures 1 to 5, were collected at hourly intervals, diluted, plated to estimate the number of CFU ml–1, and frozen. Extracts of 5 x 109 viable cells from culture 1 (lanes 1) and of 2 x 109 cells from cultures 2 to 5 (lanes 2 to 5) were prepared, separated by SDS-PAGE, and analyzed by Western blotting with anti-ParA antibodies. The amount of ParA was estimated by comparison with diluted samples of purified His6-ParA whose concentrations were known run on the same gel. (C) Distribution of ParA. The cells from a logarithmically growing culture (OD600, ~0.6) were sonicated in 50 mM Na phosphate buffer (pH 8.0) in the presence of different NaCl concentrations and then separated into cell debris and supernatant by centrifugation at 15,000 rpm for 30 min. The pellet was resuspended in a volume of sonication buffer equivalent to the volume of the removed soluble fraction. The total sonicate (lane T), soluble extract (lane S), and cell debris (lane D) corresponding to 2 x 109 cells were subjected to SDS-PAGE and analyzed by Western blotting.

Overproduction of ParA causes strong growth defects in Pseudomonas species. The parA gene was recloned under control of tacp and lacIq in broad-host-range Strr IncQ expression vector pGBT400 to create pKLB40.1. Growth of PAO1161(pKLB40.1) with selection for the plasmid but without induction or in the presence of different concentrations of IPTG was monitored by determining the optical density at 600 nm (OD600), as well as by plating to estimate the number of CFU ml–1. At chosen time points DAPI-stained cells were imaged by fluorescence microscopy (Fig. 3). PAO1161(pGBT400), which was used as a control, was not affected by the presence of 1 mM IPTG. Even after overnight growth of PAO1161(pKLB40.1) without IPTG and dilution to an OD600 similar to that of PAO1161(pGBT400) the presence of multiple copies of parA caused a 10-fold decrease in the number of CFUn ml–1, suggesting a loss of viability (Fig. 3A). The "toxic" effect of ParA was also observed in E. coli DH5{alpha}(pKLB40.1) grown without IPTG (Fig. 3C). Growth of PAO1161(pKLB40.1) in the presence of IPTG and overproduction of ParA caused growth inhibition, whose severity directly correlated with the concentration of the inducer. There was an interesting relationship between the increase in the IPTG concentration and the formation of filamentous cells (Fig. 3B). In the absence of inducer PAO1161(pKLB40.1) showed up to 2% anucleate cells and more cells with visibly distorted nucleoids, although the cells were normal size. IPTG concentrations of 0.2 mM to 0.5 mM led to formation of very long filaments, while at a higher concentration of IPTG (1 mM) the cultures did not grow and the cells were not filamentous, were roughly twice the normal size, and apparently often did not separate after division. This indicates that a slight excess of ParA in the cells interferes with chromosome segregation and that a further increase in the ParA concentration blocks cell division but not elongation of the cell (inhibition of septum synthesis but not lateral cell wall synthesis?), whereas a very high ParA level inhibited bacterial growth (Fig. 3A and B). The effect of ParA overproduction was also analyzed in E. coli and P. putida. In E. coli the presence of an increased inducer concentration did not correlate with growth inhibition. Since large inclusion bodies were observed in E. coli cells (data not shown), it may be that at higher expression levels ParA becomes insoluble more rapidly, eliminating its toxicity. Strong growth inhibition was also observed in P. putida transformant KT2241(pKLB40.1) (Fig. 3C). However, in contrast to P. aeruginosa, microscopic observations did not show filamentous cells at any IPTG concentration (data not shown). Therefore, the effect of ParA overproduction in Pseudomonas species is severe and suggests that there is an interaction with a cellular component that is essential for growth.


Figure 3
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 3. Effects of ParA overproduction in different species. (A) Growth of P. aeruginosa in the presence of elevated ParA levels. An overnight culture of PAO1161(pKLB40.1) was diluted into fresh medium with an antibiotic and different concentrations of IPTG and grown at 37°C. PAO1161(pGBT400) grown in the presence of 1 mM IPTG was used as the control. Growth was monitored by determining the OD600, and at hourly intervals samples of the cultures were diluted and plated to estimate the number of CFU ml–1. The inset shows the results for a Western blot of 109 cells of PAO1161(pGBT400) grown in the presence of 1 mM IPTG (track C) and PAO1161(pKLB40.1) grown in the absence of IPTG and in the presence of different IPTG concentrations. The ParA degradation products are visible (brace). (B) Micrographs of P. aeruginosa cells. After 5 to 6 h of growth with different concentrations of IPTG samples of PAO1161(pKLB40.1) were DAPI stained and photographed. The images correspond to overlays of phase-contrast and fluorescence micrographs. The arrows indicate anucleate cells. (C) Growth of E. coli and P. putida. Overnight cultures of pKLB40.1 transformants of E. coli DH5{alpha}, P. putida KT2442, and P. aeruginosa PAO1161 (for comparison) were diluted 103-fold and grown with different IPTG concentrations. At hourly intervals the cultures were diluted and plated to estimate the number of CFU ml–1. The control data are data for E. coli DH5{alpha}(pGBT400) grown with 0.5 mM IPTG. For clarity only results for cultures grown with 0.5 mM IPTG are shown, and DH5{alpha}(pKLB40.1) was grown without IPTG as this strain appeared to grow more slowly than it did after parA induction by IPTG.

Mapping of the "inhibition" domain in ParA. To identify which part of ParA is responsible for the observed growth inhibition and the morphological changes caused when the protein is overproduced, parA mutant alleles were cloned in an IncQ tacp-parA expression vector (Fig. 4). After transformation into PAO1161, IPTG-induced overproduction of truncated proteins was confirmed by Western blotting, and the effect was assessed by plating the diluted cultures on L-agar plates (CFU ml–1) (Fig. 4) and by microscopic observation. Overproduction of two N-terminally truncated derivatives (ParA14-262 and ParA40-262) caused an up-to-3-h lag, but after this period the cultures grew normally. In contrast, the C-terminally truncated forms, ParA1-151 and even ParA1-85, retained their strong inhibitory effect, although none of the cultures exhibited the morphological changes observed in the case of overproduction of the intact ParA protein (data not shown). No inhibitory effect was observed when ParA1-40 was overproduced in P. aeruginosa. Therefore, the inhibitory effect of excess ParA is related mainly to the presence of the N-terminal 85 amino acids, and the N-terminal tip (1 to 14 amino acids) plays an important role in this inhibition.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 4. Mapping of the part of ParA causing the growth inhibition of P. aeruginosa when it is overproduced. The diagram on the left shows the parA alleles cloned under tacp in pGBT400 derivatives. The highly conserved Walker-type ATPase motifs in parA are indicated. The deletions of parA were constructed by modification of the restriction sites or by use of PCR (parA14-262). On the right growth curves for PAO1161 transformants overproducing ParA derivatives are shown. PAO1161(pGBT400) was used as the control strain (vector). Symbols: {diamond}, PAO1161(pKLB40.3); {square}, PAO1161(pKLB40.5); {blacktriangleup}, PAO1161(pKLB40.1); {triangleup}, PAO1161(pKLB40.8); {blacksquare}, PAO1161(pKLB40.15); {circ}, PAO1161(pJMB508).

Mutation of parA is not lethal but leads to the multiple phenotypes. To inactivate ParA, the wild-type parA gene in PAO1161 was replaced first with insertional mutant parA::smh by allelic exchange (13). The allelic exchange was confirmed by PCR and by Western blotting with anti-ParA polyclonal antibodies. The allelic exchange occurred frequently (four parA mutants among six Cbs clones tested), suggesting that the mutation is not lethal for the bacteria. However, the defects caused by this mutation described below meant that suppressor mutations would be favored, so stocks of the mutant culture were stored in glycerol at –80°C and all further experiments were done with cultures from freshly plated colonies or inoculated directly from the stock.

The parA mutant grew on L broth at 37°C with a division time ({tau}parA) that was slightly longer than the division time of the wild-type parental strain ({tau}WT) (36 min for the mutant versus 29 min for PAO1161). Growth at a lower temperature or in M9 medium showed more clearly the differences between the parA mutant and wild-type strains. During growth at 30°C {tau}parA was 84 min, whereas {tau}WT was 44 min, and in minimal medium at 37°C {tau}parA was 181 min, compared to a {tau}WT of 114 min (Fig. 5A). Fluorescence microscopy after DAPI staining revealed the presence of 6 to 7% anucleate cells (Fig. 5B). The parA mutant cells from a logarithmically grown culture were slightly bigger than the cells of the parental strain (lengths, 2.27 ± 0.3 µm and 2.00 ± 0.3 µm, respectively, for a sample of approximately 500 cells each).


Figure 5
View larger version (63K):
[in this window]
[in a new window]

 
FIG. 5. Growth defects of the parA mutants. (A) Growth curves of PAO1161 (wt), PAO1161parA::smh (parA::smh), and PAO1161parA+ revertant (parA+) grown at different temperatures on rich medium (L broth) (open and shaded symbols) and minimal medium (M9) (solid symbols). (B) Micrographs of P. aeruginosa cells taken from logarithmically growing cultures in L broth at 37°C. The images correspond to overlays of phase-contrast and fluorescence (DAPI-stained) photographs. The arrows indicate anucleate cells. (C) Growth curves of PAO1161(pBBR1-MCS1), PAO1161(pJMB503 tacp-parA), and PAO1161(pABB33 tacp-parA parB) grown on rich medium at 37°C without IPTG. (D) Growth curves of PAO1161parA::smh(pBBR1-MCS1), PAO1161parA::smh(pJMB503 tacp-parA), and PAO1161parA::smh(pABB33 tacp-parA parB) grown on rich medium at 37°C without IPTG.

Although overproduction of ParA1-40 with two extra residues, Leu and Thr, at the C terminus did not cause growth defects in PAO1161(pJMB508) grown with the IPTG inducer (Fig. 4), a slightly different version of ParA (ParA1-41 extended with Val, Ileu, and Asp) produced from parA inactivated by insertion of an Smr cassette into the BamHI site might have exerted the "toxicity." Therefore, the modified parA allele from the pAKE600 derivative used for allele exchange (pKLB60.3) was cloned under tacp into pBBR-MCS1 and introduced into PAO1161. The growth of the resulting strain, PAO1161(pJMB509), was not affected by the IPTG induction of tacp (data not shown), excluding the possibility that the presence of the truncated form of ParA in mutant PAO1161parA::smh (when not overproduced) might have caused all the observed disturbances in cell growth and chromosome segregation.

An independent parA mutant was constructed, in which two stop codons followed the ATG initiation codon and insertion of an extra nucleotide (GC replaced by TGA) changed the reading frame. Such an allele was introduced into PAO1161Rifr, and analysis of PAO1161parAstop revealed a lower growth rate and production of up to 7% anucleate cells in actively dividing cells (Fig. 5B). Since both types of parA mutants showed exactly the same phenotypes (see below), this definitely excluded the possibility of negative interference of the N terminus of ParA in the insertional mutant.

Wild-type P. aeruginosa forms regular-shaped bulging colonies with smooth edges. Colonies of PAO1161 parA showed morphological differences compared to colonies of the parental strain, independent of whether there was an insertion or a nonsense mutation. The colony edges were not smooth, and the surface was wrinkled (Fig. 6A). This suggested that parA inactivation changes motility, cell adhesion, or cell-cell interactions. P. aeruginosa has three different motile activities, described as swimming, swarming, and twitching (33), which are observed in aqueous environments and low-agar (<0.4%) medium, on semisolid surfaces (0.4 to 1.0% agar), and at surface interfaces, respectively. PAO1161 and the PAO1161parA mutants were grown on different test plates to compare their motility properties. Figure 6B demonstrates that the parA mutants are clearly impaired in swarming function, slightly altered in swimming, but normal in twitching. Swarming requires flagella and type IV pili, as well as cell-to-cell signaling (33). Since both swarming and twitching are dependent on type IV pili, it seems unlikely that the parA defect in swarming is related to the activity of type IV pili. Electron microscopic visualization of wild-type PAO1161 cells and PAO1161parA::smh mutant cells demonstrated the presence of flagella in both strains (Fig. 7). Among normally stained cells of the parA mutant up to 10% "ghost" cells appeared, which corresponded to anucleate cells observed with DAPI staining. As the flagellum plays a vital role in the swimming activity and swimming is not completely eliminated in the parA mutant, this was an expected result. The findings also suggest that there is a partial defect either in flagellum movement or in cell signaling.


Figure 6
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 6. Colony formation and motilities of PAO1161 derivatives. (A) Colony morphology of PAO1161, PAO1161parA::smh, PAO1161parAstop, and PAO1161(pJMB503 tacp-parA). (B) Motility of PAO1161 and its derivatives tested on special media. The tests were performed with PAO1161 (wt), the PAO1161parA::smh mutant (parA::smh), two revertants of the PAO1161parA::smh mutant (rev1 and rev2), PAO1161parAstop (parAstop), and transformants of PAO1161(pBBR1-MCS1) (wt/v), PAO1161(pJMB503) (wt/parA), PAO1161(pABB33) (wt/parAB), PAO1161parA::smh(pBBR1-MCS1) (parA::smh/v), and PAO1161parA::smh(pJMB503) (parA::smh/parA). The inset for the swarming test shows the results after 24 h; one of the plates is also shown after 48 h.


Figure 7
View larger version (139K):
[in this window]
[in a new window]

 
FIG. 7. Electron microscopy of Pseudomonas cells (courtesy of L. Dziewit). (A) Photographs of PAO1161Rifr cells taken from L-agar plates. (B) PAO1161parA::smh cells. The "ghost" cells (indicated by arrows) appeared with a frequency up to 10%. Magnifications, x8,000 for PAO1161 and x16,000 for PAO1161parA::smh. Bars = 1,000 nm.

ParB is less stable in parA mutants. As parA and parB translational signals overlap, it was important to see how the mutations in parA influenced the production of ParB. Wild-type and parA mutant cultures were diluted into fresh medium, samples containing the same number of cells (2 x 109 cells) were collected every hour, and the extracts were analyzed by SDS-PAGE followed by Western blotting (Fig. 8A). Immediately after dilution of the cultures, the levels of ParB in the PAO1161parA::smh and PAO1161parAstop mutants were similar to the level observed for the wild-type strain, indicating that the synthesis of ParB is not impaired in parA mutants, but subsequent sampling of logarithmically growing cultures showed only the presence of ParB degradation products. Addition of a cocktail of protease inhibitors before sonication did not protect ParB in the extracts of the parA mutant, indicating that degradation takes place before rather than after lysis. This clearly demonstrates that although the synthesis of ParB is not impaired in the parA mutants, ParB is more prone to degradation.


Figure 8
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 8. ParB depletion in the parA mutants. (A) Western blot of samples from PAO1161parA::smh, PAO1161parAstop, and PAO1161 cultures with anti-ParB antibodies. The cultures were diluted 50-fold into fresh medium, samples were collected at different OD600 values, and the extracts from 109 cells were loaded on the gel. The brackets indicate the positions of the ParB degradation products. Purified His6-ParB was run as the control. (B) Western blot of extracts from PAO1161, PAO1161parA::smh, and PAO1661parA+ "revertant" cultures with anti-ParB antibodies. The samples were collected at different OD600 values, and the extracts were loaded on the gel (normalized to 109 cells). Purified His6-ParB was run as a control.

Complementation tests. The several unrelated phenotypes observed for the PAO1161parA mutants demonstrated the possibility that the mutation in parA may be accompanied by secondary mutations in other parts of the genome. A complementation analysis could not be conducted with pKLB40.1, a tacp-parA expression plasmid based on the IncQ replicon, as it had "toxic effects" on PAO1161 (Fig. 3A and B). The parA gene plus its natural RBS sequence and the parA and parB genes with their own RBS signals were inserted into the low-copy-number pBBR1-MCS1 lacIq tacp expression vector to obtain pJMB503 and pABB33, respectively. The level of parA expression from uninduced pJMB503 monitored by Western blotting was at least 10-fold lower than the level from pKLB40.1, but it was 2- to 3-fold higher than the level in wild-type strain PAO1161. Neither introduction of pJMB503 (parA alone) nor introduction of pABB33 (parA parB) into PAO1161parA complemented the observed mutant phenotypes (lower growth rate, anucleate cell formation, impaired motility). The presence of pJMB503 had a more severe growth retardation effect on PAO1161parA::smh than the presence of pABB33 (Fig. 5D). The same two plasmids introduced into wild-type strain PAO1161 caused defects similar to those observed previously for PAO1161parA mutants. Thus, PAO1161(pJMB503) grew on L broth at 37°C (Fig. 5C) with a slightly longer division time than PAO1161(pBBR1-MCS1) (mean generation times, 34 min and 29 min, respectively) and formed approximately 2% anucleate cells without IPTG induction and up to 5% such cells after induction with 0.5 mM IPTG. Much stronger inhibition was observed at 30°C and on minimal medium (data not shown). Colonies of PAO1161 after transformation with pJMB503 or pABB33 were wrinkled like parA mutant colonies (Fig. 6A). Motility tests of PAO1161(pJMB503) and PAO1161(pABB33) showed the same defects in swarming and swimming as those of PAO1161parA mutants (Fig. 6B).

To find an alternative way to confirm the role of the parA mutation in the observed phenotypes, allelic exchange was used to replace the mutated parA allele by the wild-type sequence (13). The genotype of the parA+ "revertant" was verified by PCR, and the production of full-length ParA by the parA+ strain was demonstrated by Western blotting (data not shown). The growth rates of the revertants under different conditions (media, temperature) were the same as that of PAO1161 (Fig. 5A). Microscopic observations did not detect anucleate cells (Fig. 5B). Reversion of the parA::smh mutation restored motilities to normal (Fig. 6B). The independent revertants produced by allelic exchange showed that the stability of ParB returned to normal (Fig. 8B). These results confirmed that the growth defects observed with the parA mutant were linked to the parA allele and were not due to secondary mutations elsewhere in the genome.


arrow
DISCUSSION
 
Our Western blotting indicates that ParA is produced at a level of 500 to 700 molecules per exponentially growing bacterium, and since in vivo (5) and glutaraldehyde cross-linking in vitro (K. Lasocki, unpublished data) studies suggest that ParA forms dimers, this means that there are about 300 ParA dimers per cell. Stationary-phase cultures of PAO1161 show about fivefold less ParA. Data on the intracellular concentration of other chromosomally encoded ParA homologues are not yet available, with the exception of data for MinD, which belongs to the same family of Walker-type ATPases but to a distinct clade (22). The amount of MinD was estimated to be 3,000 molecules per cell by quantitative immunoblotting, and the MinD was shown to be associated with the inner membrane by immunogold labeling but was recovered entirely in the soluble fraction of broken cells (9). The majority of ParA in sonicated cells is also recovered in the soluble fraction, although we cannot exclude the possibility that it is loosely bound to the membranes and released during cell disruption. However, like other representatives of the family, ParA lacks the amphipathic helix (39) that is involved in membrane binding of MinD (24). Further studies should determine whether ParA oscillates from pole to pole and if the estimated number of molecules is sufficient to be organized into the helical filaments that other representatives of the ParA family seem to form (2, 3, 10, 11, 43, 44, 52, 57).

The presence of ParA in P. aeruginosa is not essential for cell viability, in line with previous observations for P. putida, B. subtilis, or Streptomyces coelicolor (21, 26, 32, 40, 55). It was suggested for P. putida (21, 40) that Par proteins in nondifferentiating bacteria may be essential only for the segregation of chromosomes under conditions where there is no further DNA replication (termination of replication rounds in nondividing cells entering stationary phase). In the P. aeruginosa parA mutant even the actively growing population produces up to 7% anucleate cells, indicating a role for Par proteins in the proper segregation of the chromosomes at all stages of growth. Thus, our data on the parA mutant of P. aeruginosa clearly demonstrate that even closely related species, like P. putida and P. aeruginosa, may have evolved different mechanisms of control of nucleoid segregation and that homologous proteins (83% identity and 92% of similarity between ParAs in the two species) do not necessarily have to retain identical biological functions. In contrast to the hardly detectable phenotype of the parA mutation in P. putida (appearance of anucleate cells only in the stationary cultures), the defect in parA of P. aeruginosa is much more pronounced. The inactivation of parA by either insertion or nonsense mutation in P. aeruginosa leads to a decrease in the ParB level as a result of increased ParB degradation rather than a defect in its synthesis. As there is no information about stability of ParB in analyzed parA mutants of P. putida, we cannot exclude the option that the differences observed between two species are due to different effects on ParB of the parA mutations analyzed. However, in P. aeruginosa the division time is strongly affected by ParA deficiency, especially at a lower temperature or with a limiting supply of nutrients (when the cell cycle is extended by G phase). This is consistent with a more crucial role for ParA (and/or ParB) in chromosome distribution and separation when these processes proceed to completion without overlapping rounds of replication. On the other hand, it may mean that in the absence of ParA (and/or ParB), compensatory mechanisms slow down the cell division process until the nucleoids are properly separated. However, if this were the case, without a corresponding reduced accumulation of mass the cell size should increase, which is not observed.

The defects in motility of PAO1161parA might be linked to the loss of important regulatory functions of ParA, disturbance of the ATP pool on which flagellar movement relies (important in swarming and swimming), or direct or indirect interaction with other cell components involved in different cell processes (e.g., cell-to-cell communication). As we have not detected any DNA binding activity of ParA in the presence of either ATP or ADP (data not shown) and ParA has only weak ATPase activity (Lasocki, unpublished), we are in favor of the last option. One obvious cell component that ParA interacts with is its ParB counterpart (5). ParB as a DNA binding protein recognizes with different affinities the parS sequences present in 10 locations in the P. aeruginosa chromosome (5) and is capable of spreading on DNA. Therefore, it is possible that ParB fulfils its regulatory role by controlling expression of operons adjacent to its binding sites. The proper folding of ParB may depend on the presence of ParA, or the formation of a ParA-ParB complex may protect ParB against proteolytic degradation. The introduction of ParB expressed from pABB33 in trans into PAO1161parA did not alleviate the observed defects, and indeed an excess of ParA and ParB in PAO1161(pABB33) led to phenotypes similar to those of the PAO1161parA mutant. Thus, it seems that a deficiency in ParA or an excess of either or both Par proteins results in abnormalities, while the interdependence of ParA and ParB levels makes it difficult to determine whether the phenotype observed is a primary or secondary effect of the mutation studied. Further work to identify single amino acid substitutions that cause loss of ParA function but do not affect ParB stability should help to determine what is due to loss of ParA and what is due to ParB.


arrow
ACKNOWLEDGMENTS
 
We gratefully acknowledge the technical assistance with electron microscopy of Lukasz Dziewit from the University of Warsaw.

This work was supported by Wellcome Trust grant 067068/Z/02/Z awarded to G.J.-B. and C.M.T.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: The Institute of Biochemistry and Biophysics, PAS, 02-106 Warsaw, Pawinskiego 5A, Poland. Phone: 48 22 823 71 92. Fax: 48 22 658 46 36. E-mail: gjburdzy{at}ibb.waw.pl Back

{triangledown} Published ahead of print on 1 June 2007. Back

{dagger} Present address: Department of Pathology, Tufts University School of Medicine, Boston, MA 02111. Back


arrow
REFERENCES
 
    1
  1. Adachi, S., K. Hori, and S. Hiraga. 2006. Subcellular positioning of F plasmid mediated by dynamic localization of SopA and SopB. J. Mol. Biol. 356:850-863.[CrossRef][Medline]
  2. 2
  3. Autret, S., and J. Errington. 2003. A role for division-site-selection protein MinD in regulation of internucleoid jumping of Soj (ParA) protein in Bacillus subtilis. Mol. Microbiol. 47:159-169.[CrossRef][Medline]
  4. 3
  5. Barilla, D., M. F. Rosenberg, U. Nobbmannn, and F. Hayes. 2005. Bacterial DNA segregation dynamics mediated by the polymerizing protein ParF. EMBO J. 24:1453-1464.[CrossRef][Medline]
  6. 4
  7. Bartosik, A. A., and G. Jagura-Burdzy. 2005. Bacterial chromosome segregation. Acta Biochim. Pol. 52:1-34.[Medline]
  8. 5
  9. Bartosik, A. A., K. Lasocki, J. Mierzejewska, C. M. Thomas, and G. Jagura-Burdzy. 2004. ParB of Pseudomonas aeruginosa: interactions with its partner ParA and its target parS and specific effects on bacterial growth. J. Bacteriol. 186:6983-6998.[Abstract/Free Full Text]
  10. 6
  11. Bignell, C. R., and C. M. Thomas. 2001. The bacterial ParA-ParB partitioning proteins. J. Biotechnol. 91:1-34.[CrossRef][Medline]
  12. 7
  13. Bork, P., C. Sander, and A. Valencia. 1992. An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp70 heat shock proteins. Proc. Natl. Acad. Sci. USA 89:7290-7294.[Abstract/Free Full Text]
  14. 8
  15. Cervin, M. A., G. B. Spiegelman, B. Raether, K. Ohlsen, M. Perego, and J. A. Hoch. 1998. A negative regulator linking chromosome segregation to developmental transcription in Bacillus subtilis. Mol. Microbiol. 29:85-95.[CrossRef][Medline]
  16. 9
  17. de Boer, P. A., R. E. Crossley, A. R. Hand, and L. I. Rothfield. 1991. The MinD protein is a membrane ATPase required for the correct placement of the Escherichia coli division site. EMBO J. 10:4371-4380.[Medline]
  18. 10
  19. Doubroyinski, K., and M. Howard. 2005. Stochastic model for Soj relocation dynamics in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 102:9808-9813.[Abstract/Free Full Text]
  20. 11
  21. Ebersbach, G., and K. Gerdes. 2004. Bacterial mitosis: partitioning protein ParA oscillates in spiral-shaped structures and positions plasmids at mid-cell. Mol. Microbiol. 52:385-398.[CrossRef][Medline]
  22. 12
  23. Edgar, R., D. K. Chattoraj, and M. Yarmolinsky. 2001. Pairing of P1 plasmid partition sites by ParB. Mol. Microbiol. 42:1363-1370.[CrossRef][Medline]
  24. 13
  25. El-Sayed, A. K., J. Hothersall, and C. M. Thomas. 2001. Quorum-sensing-dependent regulation of biosynthesis of the polyketide antibiotic mupirocin in Pseudomonas fluorescens NCIMB 10586. Microbiology 147:2127-2139.[Abstract/Free Full Text]
  26. 14
  27. Errington, J., H. Murray, and L. J. Wu. 2005. Diversity and redundancy in bacterial chromosome segregation mechanisms. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360:497-505.[Abstract/Free Full Text]
  28. 15
  29. Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene 52:147-154.[CrossRef][Medline]
  30. 16
  31. Figge, R. M., J. Easter, Jr., and J. W. Gober. 2003. Productive interaction between the chromosome partitioning proteins, ParA and ParB, is required for the progression of the cell cycle in Caulobacter crescentus. Mol. Microbiol. 47:1225-1237.[CrossRef][Medline]
  32. 17
  33. Funnell, B. E. 2005. Partition-mediated plasmid pairing. Plasmid 53:119-125.[CrossRef][Medline]
  34. 18
  35. Gal-Mor, O., I. Borovok, Y. Av-Gay, G. Cohen, and Y. Aharonowitz. 1998. Gene organization in the trxA/B-oriC region of the Streptomyces coelicolor chromosome and comparison with other eubacteria. Gene 217:83-90.[CrossRef][Medline]
  36. 19
  37. Gerdes, K., J. Møller-Jensen, and R. Bugge Jensen. 2000. Plasmid and chromosome partitioning: surprises from phylogeny. Mol. Microbiol. 37:455-466.[CrossRef][Medline]
  38. 20
  39. Glaser, P., M. E. Sharpe, B. Raether, M. Perego, K. Ohlsen, and J. Errington. 1997. Dynamic, mitotic-like behaviour of a bacterial protein required for accurate chromosome partitioning. Genes Dev. 11:1160-1168.[Abstract/Free Full Text]
  40. 21
  41. Godfrin-Estevenon, A.-M., F. Pasta, and D. Lane. 2002. The parAB gene products of Pseudomonas putida exhibit partitioning activity in both P. putida and Escherichia coli. Mol. Microbiol. 43:39-49.[CrossRef][Medline]
  42. 22
  43. Hayes, F. 2000. The partition system of multidrug resistance plasmid TP228 includes a novel protein that epitomizes an evolutionarily distinct subgroup of the ParA superfamily. Mol. Microbiol. 37:528-541.[CrossRef][Medline]
  44. 23
  45. Hayes, F., and D. Barilla. 2006. The bacterial segrosome: a dynamic nucleoprotein machine for DNA trafficking and segregation. Nat. Rev. Microbiol. 4:133-143.[CrossRef][Medline]
  46. 24
  47. Hu, Z., and J. Luthenhaus. 2003. A conserved sequence at the C-terminus of MinD is required for binding to the membrane and targeting MinC to the septum. Mol. Microbiol. 47:345-355.[CrossRef][Medline]
  48. 25
  49. Irani, V. R., and J. J. Rowe. 1997. Enhancement of transformation in Pseudomonas aeruginosa PAO1 by Mg2+ and heat. BioTechniques 22:54-56.[Medline]
  50. 26
  51. Ireton, K., N. W. T. Gunther, and A. D. Grossman. 1994. spo0J is required for normal chromosome segregation as well as the initiation of sporulation in Bacillus subtilis. J. Bacteriol. 176:5320-5329.[Abstract/Free Full Text]
  52. 27
  53. Jagura-Burdzy, G., J. P. Ibbotson, and C. M. Thomas. 1991. The korF region of broad-host-range plasmid RK2 encodes two polypeptides with transcriptional repressor activity. J. Bacteriol. 173:826-833.[Abstract/Free Full Text]
  54. 28
  55. Jagura-Burdzy, G., K. Kostelidou, J. Pole, D. Khare, A. Jones, D. R. Williams, and C. M. Thomas. 1999. IncC of broad-host-range plasmid RK2 modulates KorB transcriptional repressor activity in vivo and operator binding in vitro. J. Bacteriol. 181:2807-2815.[Abstract/Free Full Text]
  56. 29
  57. Jagura-Burdzy, G., and C. M. Thomas. 1995. Purification of KorA protein from broad host range plasmid RK2: definition of a hierarchy of KorA operators. J. Mol. Biol. 253:39-50.[CrossRef][Medline]
  58. 30
  59. Jensen, R. B., R. Lurz, and K. Gerdes. 1998. Mechanism of DNA segregation in prokaryotes: replicon pairing by parC of plasmid R1. Proc. Natl. Acad. Sci. USA 95:8550-8555.[Abstract/Free Full Text]
  60. 31
  61. Kahn, M. R., R. Kolter, C. M. Thomas, D. Figurski, R. Meyer, E. Remault, and D. R. Helinski. 1979. Plasmid cloning vehicles derived from plasmids ColE1, F, R6K, and RK2. Methods Enzymol. 68:268-280.[Medline]
  62. 32
  63. Kim, H. J., M. J. Calcutt, F. J. Schmidt, and K. F. Chater. 2000. Partitioning of the linear chromosome during sporulation of Streptomyces coelicolor A3(2) involves an oriC-linked parAB locus. J. Bacteriol. 182:1313-1320.[Abstract/Free Full Text]
  64. 33
  65. Kohler, T., L. K. Curty, F. Barja, C. van Delden, and J. C. Pechere. 2000. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J. Bacteriol. 182:5990-5996.[Abstract/Free Full Text]
  66. 34
  67. Koonin, E. V. 1993. A superfamily of ATPases with diverse functions containing either classical or deviant ATP-binding motif. J. Mol. Biol. 229:1165-1174.[CrossRef][Medline]
  68. 35
  69. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop II, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176.[CrossRef][Medline]
  70. 36
  71. Lee, M.-J., C.-H. Liu, S.-Y. Wang, C.-T. Huang, and H. Huang. 2006. Characterization of the Soj/Spo0J chromosome segregation proteins and identification of putative parS sequences in Helicobacter pylori. Biochem. Biophys. Res. Commun. 342:744-750.[CrossRef][Medline]
  72. 37
  73. Lee, P. S., and A. D. Grossman. 2006. The chromosome partitioning proteins Soj (ParA) and Spo0J (ParB) contribute to accurate chromosome partitioning, separation of replicated sister origins, and regulation of replication initiation in Bacillus subtilis. Mol. Microbiol. 60:853-869.[CrossRef][Medline]
  74. 38
  75. Lee, P. S., D. C.-H. Lin, S. Moriya, and A. D. Grossman. 2003. Effects of the chromosome partitioning protein Spo0J (ParB) on oriC positioning and replication initiation in Bacillus subtilis. J. Bacteriol. 185:1326-1337.[Abstract/Free Full Text]
  76. 39
  77. Leonard, T. A., P. J. Butler, and J. Lowe. 2005. Bacterial chromosome segregation: structure and DNA binding of the Soj dimer—a conserved biological switch. EMBO J. 24:270-282.[CrossRef][Medline]
  78. 40
  79. Lewis, R. A., C. R. Bignell, W. Zeng, A. C. Jones, and C. M. Thomas. 2002. Chromosome-loss from par mutants of Pseudomonas putida depends on growth medium and phase of growth. Microbiology 148:537-548.[Abstract/Free Full Text]
  80. 41
  81. Lim, G. E., A. I. Derman, and J. Pogliano. 2005. Bacterial DNA segregation by dynamic SopA polymers. Proc. Natl. Acad. Sci. USA 102:17658-17663.[Abstract/Free Full Text]
  82. 42
  83. Lukaszewicz, M., K. Kostelidou, A. A. Bartosik, G. D. Cooke, C. M. Thomas, and G. Jagura-Burdzy. 2002. Functional dissection of the ParB homologue (KorB) from IncP-1 plasmid RK2. Nucleic Acids Res. 30:1046-1055.[Abstract/Free Full Text]
  84. 43
  85. Marston, A. L., and J. Errington. 1999. Dynamic movement of the ParA-like Soj protein of B. subtilis and its dual role in nucleoid organization and developmental regulation. Mol. Cell 4:673-682.[CrossRef][Medline]
  86. 44
  87. Mohl, D. A., and J. W. Gober. 1997. Cell-cycle dependent polar localization of chromosome partitioning proteins in Caulobacter crescentus. Cell 88:675-684.[Medline]
  88. 45
  89. Motallebi-Veshareh, M., D. A. Rouch, and C. M. Thomas. 1990. A family of ATPases involved in active partitioning of diverse bacterial plasmids. Mol. Microbiol. 4:1455-1463.[CrossRef][Medline]
  90. 46
  91. Mullis, K., F. Faloona, S. Scharf, R. Saiki, G. Horn, and H. Erlich. 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 51:263-273.[Abstract/Free Full Text]
  92. 47
  93. Ogasawara, N., and H. Yoshikawa. 1992. Genes and their organization in the replication origin of the bacterial chromosome. Mol. Microbiol. 6:629-634.[Medline]
  94. 48
  95. Ogura, Y., N. Ogasawara, E. J. Harry, and S. Moriya. 2003. Increasing the ratio of Soj to Spo0J promotes replication initiation in Bacillus subtilis. J. Bacteriol. 185:6316-6324.[Abstract/Free Full Text]
  96. 49
  97. Quisel, J. D., and A. D. Grossman. 2000. Control of sporulation gene expression in Bacillus subtilis by the chromosome partitioning proteins Soj (ParA) and Spo0J (ParB). J. Bacteriol. 182:3446-3451.[Abstract/Free Full Text]
  98. 50
  99. Quisel, J. D., D. C. Lin, and A. D. Grossman. 1999. Control of development by altered localization of a transcription factor in B. subtilis. Mol. Cell 4:665-672.[CrossRef][Medline]
  100. 51
  101. Rashid, M. H., and A. Kornberg. 2000. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 97:4885-4890.[Abstract/Free Full Text]
  102. 52
  103. Raskin, D. M., and P. A. de Boer. 1999. Rapid pole-to-pole oscillation of a protein required for directing division to the middle of Escherichia coli. Proc. Natl. Acad. Sci. USA 96:4971-4976.[Abstract/Free Full Text]
  104. 53
  105. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  106. 54
  107. Schumacher, M. A., and B. E. Funnell. 2005. Structures of ParB bound to DNA reveal mechanism of partition complex formation. Nature 438:516-519.[CrossRef][Medline]
  108. 55
  109. Sharpe, M. E., and J. Errington. 1996. The Bacillus subtilis soj-spo0J locus is required for a centromere-like function involved in prespore chromosome partitioning. Mol. Microbiol. 21:501-509.[CrossRef][Medline]
  110. 56
  111. Sharpe, M. E., and J. Errington. 1998. A fixed distance for separation of newly replicated copies of oriC in Bacillus subtilis: implications for co-ordination of chromosome segregation and cell division. Mol. Microbiol. 28:981-990.[CrossRef][Medline]
  112. 57
  113. Shih, Y. L., T. Le, and L. Rothfield. 2003. Division site selection in Escherichia coli involves dynamic redistribution of Min proteins within coiled structures that extend between the two cell poles. Proc. Natl. Acad. Sci. USA 100:7865-7870.[Abstract/Free Full Text]
  114. 58
  115. Simon, R., M. O'Connell, M. Labes, and A. Puhler. 1986. Plasmid vectors for the genetic analysis and manipulation of Rhizobia and other gram-negative bacteria. Methods Enzymol. 118:640-659.[Medline]
  116. 59
  117. Studier, F. W., and B. A. Moffatt. 1981. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130.[CrossRef]
  118. 60
  119. Webb, C. D., A. Teleman, S. Gordon, A. Straight, A. Belmont, D. C.-H Lin, A. D. Grossman, A. Wright, and R. Losick. 1997. Bipolar localization of the replication origin regions of chromosomes in vegetative and sporulating cells of B. subtilis. Cell 88:667-674.[CrossRef][Medline]
  120. 61
  121. Wu, L. J., and J. Errington. 2003. RacA and the Soj-Spo0J system combine to effect polar chromosome segregation in sporulating Bacillus subtilis. Mol. Microbiol. 49:1463-1475.[CrossRef][Medline]
  122. 62
  123. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.[CrossRef][Medline]


Journal of Bacteriology, August 2007, p. 5762-5772, Vol. 189, No. 15
0021-9193/07/$08.00+0     doi:10.1128/JB.00371-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Bartosik, A. A., Mierzejewska, J., Thomas, C. M., Jagura-Burdzy, G. (2009). ParB deficiency in Pseudomonas aeruginosa destabilizes the partner protein ParA and affects a variety of physiological parameters. Microbiology 155: 1080-1092 [Abstract] [Full Text]  
  • Toro, E., Hong, S.-H., McAdams, H. H., Shapiro, L. (2008). Caulobacter requires a dedicated mechanism to initiate chromosome segregation. Proc. Natl. Acad. Sci. USA 105: 15435-15440 [Abstract] [Full Text]  
  • Livny, J., Yamaichi, Y., Waldor, M. K. (2007). Distribution of Centromere-Like parS Sites in Bacteria: Insights from Comparative Genomics. J. Bacteriol. 189: 8693-8703 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lasocki, K.
Right arrow Articles by Jagura-Burdzy, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lasocki, K.
Right arrow Articles by Jagura-Burdzy, G.