JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.00599-07v1
189/17/6333    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mardanov, A. V.
Right arrow Articles by Ravin, N. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mardanov, A. V.
Right arrow Articles by Ravin, N. V.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 2007, p. 6333-6338, Vol. 189, No. 17
0021-9193/07/$08.00+0     doi:10.1128/JB.00599-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The Antirepressor Needed for Induction of Linear Plasmid-Prophage N15 Belongs to the SOS Regulon{triangledown}

Andrey V. Mardanov and Nikolai V. Ravin*

Centre "Bioengineering," Russian Academy of Sciences, Moscow, 117312, Russia

Received 18 April 2007/ Accepted 13 June 2007


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The physiological conditions and molecular interactions that control phage production have been studied in only a few families of temperate phages. We investigated the mechanisms that regulate activation of lytic development in lysogens of coliphage N15, a prophage that is not integrated into the host chromosome but exists as a linear plasmid with covalently closed ends. We identified the N15 antirepressor gene, antC, and showed that its product binds to and acts against the main phage repressor, CB. LexA binds to and represses the promoter of antC. Mitomycin C-stimulated N15 induction required RecA-dependent autocleavage of LexA and expression of AntC protein. Thus, a cellular repressor whose activity is regulated by DNA damage controls N15 prophage induction.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Infection of a host cell by a temperate phage can develop in two ways: lytically, when progeny phages are produced and released from the host cell, or lysogenically, when the phage genome is integrated into the chromosome or maintained as a plasmid. The expression of phage genes required for virion production and cell lysis is strongly repressed in the latter case. Although the lysogenic state is usually very stable, temperate phages generally retain the ability to switch from lysogeny to lytic development in the process of prophage induction. For example, exposure of the host cell to UV light or other DNA-damaging agents challenging cell survival can stimulate prophage induction.

In the lambdoid phage family prophage induction is achieved by inactivation of the main CI repressor; depletion of CI leads to a genetic switch from lysogeny to lytic development. Inactivation of CI is linked to the SOS response system (38): DNA damage leads to conversion of the RecA protein to an activated form that promotes inactivation of lambda CI repressor by autoproteolysis (15, 19, 20, 32). Activated RecA also catalyzes the self-cleavage of host cell-encoded LexA protein, a transcriptional repressor of a number of "SOS-response" genes, including RecA and LexA itself (20).

An alternative mechanism of prophage induction is exemplified by coliphage 186. This phage relies on antirepressor tum, whose expression is under host LexA control (1, 16). UV treatment enables synthesis of Tum (16), which then binds to and affects the activity of the 186 repressor, resulting in induction of lytic growth (33). A similar regulatory pathway is thought to govern expression of a tum homolog in the Salmonella enterica phage Fels-2 (2). In Vibrio cholerae phage CTX{phi} the control of expression of genes required for virion production is achieved by cooperative action of the RstR repressor and the host LexA protein. SOS induction of CTX{phi} production depends on RecA-stimulated autocleavage of LexA (24).

Temperate phage N15 belongs to the lambdoid phage family in that it shares with lambda many head and tail genes, as well as some main regulatory circuits (CB/Cro regulatory unit, control of late operons by Q-mediated antitermination, etc.). However, unlike lambda, phage N15 in the lysogenic state is not integrated into the Escherichia coli chromosome but is maintained as a linear plasmid with covalently closed hairpin ends (for a review, see reference 26). N15 carries a locus, immB, which was found to be structurally and functionally similar to lambdoid phage immunity regions (21). ImmB contains gene cB encoding the primary repressor protein, which shows low homology (15% identity and 18% similarity) to {lambda}CI. The cB gene is flanked by a complex array of divergent operator-promoter sites. The two operators left of cB overlap the promoter of replication gene, repA, implying that binding of CB at these operators regulates transcription of repA. The three operators rightward of cB overlap the predicted promoter of cB itself and the predicted promoters of the "late" operon containing cro and Q. It was proposed (21) that CB, by binding to these operators, represses both its own transcription and transcription of cro, Q and late genes.

Like lambda, the N15 prophage may be induced by exposure of lysogenic cells to DNA-damaging agents such as UV light or mitomycin C. However, the amino acid sequence of CB does not contain the site of RecA-stimulated autocleavage, an Ala-Gly or Cys-Gly dipeptide sequence located within a "linker" region that joins the N-terminal DNA-binding domain (DBD) and C-terminal dimerization/autocleavage domain (7). Unlike CI and other cleavable repressors, CB also lack the pair of strictly conserved residues S149/K192 responsible (35) for RecA-mediated autocleavage (21). These observations suggest that the mechanism of N15 prophage induction may differ from that of other lambdoid phages.

Here we identified the N15 antirepressor gene, antC, and show that its product binds to and acts against the main phage repressor, CB. The promoter of antC is repressed by LexA protein. Induction of the N15 prophage requires RecA-dependent autocleavage of LexA, resulting in expression of AntC protein. In this way, a cellular SOS response controls N15 prophage induction.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Media, chemicals, enzymes, and synthetic oligonucleotides. Bacteria were grown in LB liquid medium or on LB agar plates at 37°C, unless otherwise indicated. Antibiotics were added as appropriate, at the following concentrations: ampicillin, 100 mg/ml; chloramphenicol, 30 mg/ml; kanamycin, 50 mg/ml; and mitomycin C (1 µg/ml). Pfu polymerase (Promega), T4 DNA ligase, and T4 polynucleotide kinase (all from New England Biolabs) and restriction enzymes (Promega and New England Biolabs) were used in accordance with the recommendations of the manufacturers. All PCR amplifications were carried out with Pfu DNA polymerase (Promega). The synthetic oligonucleotides used were as follows: 471-F, CTGAATTCATGGTATACGATTCAATGACAGAT; 471-R, GCAAGCTTATTCGCCAGCCTGCCGA; P471-1, AATTCGGTTGTATCGTTTGCGGATTTCCCTGTGTTTATATACAGTATTAAATAACG; P471-2, GATCCGTTATTTAATACTGTATATAAACACAGGGAAATCCGCAAACGATACAA CCG; P471-3, AATTCGGTTGTATCGTTTGCGGATTTCCAAATGTTTATATACAGTATTAAATAACG; P471-4, GATCCGTTATTTAATACTGTATATAAACATTTGGAAATCCGCAAACGATACAACCG; cB-2h1, GCGGTGACCATTAAGGGTATGAAAACACGAG; cB-2h2, CGCTCGAGTCATCTACCCTCAACCATGAAC; 471-2h1, CGCTCGAGGTATACGATTCAATGACAGAT; and 471-2h2, CGAGATCTTTATTCGCCAGCCTGCCGA.

Bacterial strains, bacteriophages, and plasmids. The following E. coli strains were used: MC1061 [hsdR araD139 {Delta}(araABC-leu)7679 {Delta}(lac)X74 galU galK rpsL thi] (4), DH10B [araD139 {Delta}(araABC-leu)7697 {Delta}(lac)X74 galU galK rpsL deoR {phi}80::lacZ{Delta}M15 endA1 nupG recA1 mcrA {Delta}(mrr hsdRMS mcrBC)] (12), JL1434 [lexA71::Tn5 (Def)sulA211 {Delta}(lacIPOZYA)169/F'lacIq lacZ{Delta}M15::Tn9] (18), and its derivative, SU202 (9). Bacteriophage N15 was described by Ravin and Shulga (29). The coordinates of the N15 genome are from the complete N15 sequence (GenBank AF064539).

(i) Plasmids used for expression of N15 genes. Plasmids pCA15 and pCA12 were used for expression of CB repressor and AntA antirepressor, respectively (25). Plasmid pBAD-471 was used for the controlled expression of antC; it was constructed by inserting the N15 antC gene, as a PCR fragment amplified with the primers 471-F and 471-R, between the EcoRI and HindIII sites of expression vector pBAD24 (13). The expression of AntA and AntC was induced by adding arabinose to the growth medium to 0.1% (wt/vol).

(ii) Plasmids used for ß-galactosidase reporter experiments. An N15 fragment containing the putative P471 promoter overlapped by a LexA binding site was constructed by annealing the synthetic oligonucleotides P471-1 and P471-2. The duplex was inserted between the EcoRI and BamHI sites of the transcription reporter plasmid pRS551 (34), upstream of lacZ gene, resulting in plasmid pNR271. Reporter plasmid pNR272 carrying mutations in a potential LexA binding site was constructed in a similar way except that oligonucleotides P471-3 and P471-4 were used instead of P471-1 and P471-2.

(iii) Plasmids and strain used for E. coli two-hybrid assays. Cb sequences to be fused to lexA+1-87 were amplified by PCR using oligonucleotide primers cB-2h1 and cB-2h2 and substituted for the BstEII-XhoI fragment of pMS604 (9) that carries the fos sequence. Fusion of antC to lexA4081-87 involved PCR amplification with the primers 471-2h1 and 471-2h2 and replacement of the jun sequences in pDL804 (9). The SU202 strain (9) constructed for the E. coli two-hybrid assay is based on JL1434; it carries an integrated hybrid (op408/op+) sfiA promoter/operator fused to lacZ and an F'lacIq plasmid to allow the regulated production of the LexA- and LexA408-DBD chimeric proteins.

(iv) Bacteriophage N15Cm471. Bacteriophage N15Cm471 is an N15 mutant carrying an insertion mutation in antC. To construct it, we first cloned the 5.9-kb EcoRI/HindIII fragment of N15 DNA between the EcoRI and HindIII sites of pBAD24, yielding plasmid pBAD-5.9kb. The chloramphenicol resistance genes, cat, was then excised as a SmaI fragment from plasmid pKRP10 (31) and inserted into pBAD-5.9kb at the NdeI site located within antC. Phage N15 was plated on MC1061 strain carrying this plasmid. Recombinant phages, N15Cm471, carrying a cat gene insertion in antC were selected upon lysogenization of MC1061 cells and plating on LB agar plates supplemented with chloramphenicol.

E. coli two-hybrid analysis. SU202 strains cotransformed with derivatives of pMS604 and pDP804 that carry lexA::cB/AntC fusion genes were grown in the presence of 5 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) to induce fusion protein synthesis as described previously (9). In this and other experiments ß-galactosidase activity was determined by the method of Miller (23).


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Sequence analysis of the LexA-controlled operon. Inspection of phage N15 genome sequence (30) revealed two potential binding sites for E. coli LexA protein (Fig. 1). The first one, already noted by S. Casjens (5), is located upstream of N15 gene 26, which encodes a homolog of the UmuD' protein, a subunit of an error-prone DNA polymerase that participates in the repair of DNA damage during the SOS response (37). The second sequence, 5'-CCCTGTGTTTATATACAGTA, is located between genes 47 and 48. It is an excellent match to the consensus E. coli LexA binding site (5'-taCTGtatatatataCAGta; uppercase nucleotides are universally present, and lowercase nucleotides are not absolutely conserved) (10, 17). The heterology index of this site, calculated as proposed by Lewis et al. (17), is 6.76, which indicates a tightly repressed site. We also identified a potential promoter sequence oriented from left to right (Fig. 1). However, published annotation of the N15 genome (30) shows no potential genes between this potential promoter and the next, counter-oriented gene, 48.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

  		FIG. 1. N15 prophage map and organization of SOS-operon. (A) Prophage map. Arrows above and below the solid line represent genes translated rightward and leftward, respectively; the rounded ends indicate the covalently closed telomeric structures (telL and telR), and the double arrow indicates the cos site (please note that GenBank AF064539 coordinates and gene numbering are based on the mature viral DNA and start from this latter point). Solid rectangles indicate potential LexA binding sites. (B) Enlarged map of the SOS operon. P471, putative promoter of orf471 (antC); Term, predicted transcriptional terminator (30). The solid arrows indicate DNA fragments inserted into the promoter reporter vector pRS551 to yield the plasmids pNR471 and pNR472 (the white rectangle indicates mutant LexA box). (C) Nucleotide sequence of the antC promoter region, corresponding to bp 39501 to 39650 of the N15 phage. Arrows show the –35 and –10 sites of the putative promoter, P471. SD, Shine-Dalgarno sequence. The predicted LexA binding site is shaded, conserved nucleotides are underlined, and mutations present in pNR472 are indicated. (D) Comparison of amino acid sequences of antirepressors. Alignment was generated by using CLUSTALX (1.81). Residues found in at least three sequences are shown on a gray background.

 
Careful analysis of the coding potential of the region between genes 47 and 48 revealed one open reading frame, which we shall term orf 471, preceded by a potential ribosome-binding site. This potential gene is followed by a putative terminator that separates it from the next operon oriented in the opposite direction and comprising N15 genes 49 and 48. The predicted 75-amino-acid protein product shows limited homology (22% identity and 35% similarity) to phage N15 antirepressor AntA, which was identified previously (25). However, we found no detectable similarity between these proteins and LexA-controlled Tum antirepressor protein of phage 186.

Gene 471 encodes an antirepressor protein. The expression of orf 471 cloned in pBAD471 had no obvious effects on nonlysogenic host cells. However, N15 formed clear plaques when plated on a MC1061/pBAD471 indicator expressing orf 471, suggesting an effect of orf 471 expression on lysogenization.

To test this, a culture of MC1061(N15)/pBAD471 was grown in LB to mid-exponential phase and divided in two; incubation of one was continued in the presence of 0.1% glucose (repression) and of the other with 0.1% arabinose (induction of orf 471). Viable cells were assayed by plating onto LB agar with 0.1% glucose, and the titer of free phage was determined by plating on MC1061 indicator. Expression of orf 471 led to induction of a lytic cycle in an N15 lysogenic culture, as evidenced by cell lysis and substantial phage production after about 90 min. About 60 phage were produced per induced cell, which is approximately equivalent to the N15 burst size upon infection of a nonlysogenic host (50 to 100) (22). No cell lysis and phage production was found without orf 471 induction in glucose-grown strain. Thus, expression of orf 471 activates lytic development. Because of its role, and taking into account the previous definition of genes 31 and 30 as antirepressors antA and antB (25), we named gene 471 antC. Similar results were obtained for DH10B(N15)/pBAD471 lysogene, indicating that RecA activity is not required for the activation of lytic development by AntC.

AntC counteracts CB-mediated control of N15 replication. It has been shown (21, 27) that N15 replication and prophage copy number are controlled by the primary phage repressor, CB. Here we analyzed the effect of antC expression on the copy number of the N15-based circular miniplasmid pNC10 (28) comprising only N15 repA and cB genes and a kanamycin resistance gene. Plasmids pBAD471 and pNC10 were introduced into E. coli strain MC1061. A culture of the resulting strain was grown to mid-exponential phase, and then expression of antC was activated by adding arabinose to the medium up to 0.1%; the culture was then further incubated for 2 h. Plasmid DNA was isolated at different times after induction of antC using an alkali lysis method and analyzed by agarose gel electrophoresis (Fig. 2). A similar experiment was performed for plasmid pCA12 encoding antirepressor AntA. The increase in the intensity of the pNC10-specific band compared to the pBAD471-specific band demonstrates that AntC, as well as AntA, activate replication of pNC10.


Figure 2
View larger version (61K):
[in this window]
[in a new window]

  		FIG. 2. Antirepressors AntA and AntC activate replication of the circular N15 based miniplasmid pNC10. Plasmid DNAs from E. coli strains carrying pNC10 and an antirepressor-producing plasmid were isolated and analyzed by agarose gel electrophoresis. Lane 1, molecular weight marker (phage {lambda} DNA digested with HindIII); lanes 2, 3, and 4, DNA isolated from DH10B/pNC10+pCA12 at 0, 60, and 180 min after activation of antirepressor expression; lanes 5, 6, and 7, DNA isolated from DH10B/pNC10+pBAD471 at 0, 60, and 180 min after activation of antirepressor expression.

 
AntC interacts with CB in two-hybrid system. To test the possible AntC-CB interactions directly, we turned to an E. coli two-hybrid system. The system is based on the ability of a LexA heterodimer, containing one wild-type (Lex+) and one mutant (LexA408) DBD, to repress transcription from a promoter (psfiA) regulated by the corresponding hybrid operator (op408/op+). Homodimers do not bind strongly enough to repress. After replacement of the LexA+ and LexA408 dimerization domains by the peptides being tested, the fusion proteins are produced together, and their capacity to interact is assessed by observing reduction in the expression of a sfiA::lacZ fusion controlled by the hybrid operator (9).

The result of applying this system to AntC and CB interaction is shown in Table 1. Coproduction of hybrid peptides consisting of the LexA-DBD and LexA408-DBD linked to AntC and CB, respectively, resulted in strong (>10-fold) repression of transcription from psfiA. LexA+ 1-87:AntA peptide exerted no significant repression in the absence of a LexA408 1-87:CB and vice versa (<1.7-fold). These data imply that AntC antirepressor and CB repressor can associate in vivo.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Two-hybrid analysis of CB-AntC interaction

 
Expression of AntC is driven by a LexA-controlled promoter. To ascertain whether the putative P471 promoter located upstream of antC is in fact active and whether LexA controls it, we constructed transcriptional reporters consisting of the corresponding N15 DNA fragment fused to lacZ (Fig. 1). The pNR271 fusion carries the wild-type sequence, while pNR272 carries the promoter region with mutations in the putative LexA-binding site. These plasmids were placed into lexA wild-type and mutant E. coli strains, and expression of the lacZ reporter was measured with or without SOS induction by mitomycin C. The results presented in Table 2 show that the P471 promoter is active. Disruption of the LexA binding site in P471 results in an 11.4-fold-higher level of lacZ expression in the presence of LexA protein (strain MC1061), while in the absence of LexA (strain JL1434) both reporters are derepressed. These data support the hypothesis that LexA represses the P471 promoter through binding to the target site within P471. We also found that the levels of lacZ expression in pNR271 and pNR272 fusions were not reduced by CB in spite of the presence of a potential CB repressor binding site in the vicinity of P471 (30).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Control of the P471 promoter by host LexA protein

 
In addition, if P471 is controlled by LexA, repression should be lifted if the host's SOS response is activated. As predicted, the presence of mitomycin C caused a 5.3-fold increase in lacZ expression in the host with wild-type lexA (MC1061/pNR271). Finally, in the recA mutant strain DH10B, in which LexA cleavage cannot be activated by SOS induction signals owing to the absence of RecA, the level of lacZ expression from pNR271 was ~8-fold lower than in MC1061/pNR271 and was not increased by mitomycin C treatment. It is likely that the higher level of lacZ expression in MC1061 than in DH10B in the absence of mitomycin C results from sporadic RecA-dependent SOS induction in a substantial fraction of the host cells. Consequently, P471 appears to be very well repressed by LexA. These experiments clearly show that the transcription of N15 gene antC from the P471 promoter is controlled by the host's LexA repressor.

AntC expression is required for SOS induction of N15 prophage. The results presented above demonstrate that induction of the SOS response leads to derepression of the LexA-controlled promoter of antC gene. Since expression of antC results in activation of phage N15 lytic development in lysogens, this pathway may explain inducibility of N15 prophage by UV and other DNA-damaging agents. However, an alternative "lambda-like" mechanism, based on the autolytic cleavage of CB repressor facilitated by activated RecA, cannot be ruled out. In order to determine the actual contribution of AntC to the SOS induction of N15 lysogens, we constructed an N15 mutant carrying an insertion mutation in antC.

This phage, N15Cm471, appeared to be undistinguishable from wild-type N15 in terms of plaque morphology, efficiency of lysogenization, and burst size upon infection of MC1061 cells (data not shown). However, unlike wild-type N15, the N15Cm471 prophage cannot be induced by mitomycin C (Table 3). Moreover, the frequency of "spontaneous" induction of N15Cm471 prophage, characterized by the titer of phage produced by the MC1061(N15Cm471) lysogens, is 4 orders of magnitude lower than that observed for wild-type N15 in MC1061(N15) and is comparable to that found in the recA mutant strain DH10B(N15). The much higher level of phage production in MC1061(N15) than in DH10B(N15) even in the absence of overt DNA damage (Table 3) may result from the sporadic SOS induction in a substantial fraction of the host cells. Thus, expression of antC antirepressor upon inactivation of LexA is the main mechanism of SOS induction of N15 lysogens.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Mitomycin C-stimulated phage production depends on AntC

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
N15 antirepressor genes. We identified in the phage N15 genome a new antirepressor gene involved in the control of lysogeny. Expression of this gene (antC) from a plasmid is sufficient to prevent lysogenization by an infecting phage and to induce lytic development in N15 lysogens. This indicates that antC acts as an antirepressor that can prevent establishment of lysogeny and alleviate immunity in a lysogen.

Several "antirepressor" systems have been found in temperate bacteriophages. For example, lambdoid phages encode a cro gene that prevents expression of the main phage repressor at the transcription initiation level (for reviews, see references 3 and 11); "secondary immunity" loci such as the immI region of P1 and the lambdoid phage P22 code for an antirepressor (Ant) that, at least in the case of P22, can interfere with the activity of the primary repressor by directly binding to it (36). We found that expression of antC counteracts the repression of promoters controlled by the primary N15 repressor, CB, resulting in activation of the replication of N15-based minplasmids and, probably, the expression of late gene clusters. Using a bacterial two-hybrid system we showed that AntC interacts with CB in vivo. Thus, the most plausible mechanism of "antirepression" is the formation of an AntC-CB complex unable to bind CB operators in N15 DNA.

In addition to antC, the N15 genome comprises another "antiimmunity" locus, immA, including antirepressor genes antA and antB (25). One of them, antA (gene 30), exhibits limited but detectable homology to antC (Fig. 1) and, like it, prevents establishment and maintenance of lysogeny. The immA anti-immunity operon appears to be expressed only early after infection to commit the phage to the lytic cycle; it is turned off by the short regulatory CA RNA processed from the same transcript in the lysogenic and the late postinfection phases (25). This mechanism is similar to that controlling expression of the antirepressor in phage P1 and of the replication operon in the satellite phage P4 (6, 8).

The newly identified antC gene seems to be involved in another process: the switch from lysogeny to lytic development in the process of prophage induction. Phage N15 mutants in antC can infect E. coli cells, as well as establish stable lysogens, but are deficient in prophage induction. We found that antC expression is controlled by one of the major components of SOS system, the LexA protein. Exposure of the host cell to DNA-damaging agents that challenge cell survival results in RecA-dependent autocleavage of LexA, derepression of antC promoter, synthesis of this antirepressor protein and, finally, activation of lytic development. In this way, the cellular SOS response controls N15 prophage induction.

In the lambdoid phage family prophage induction is achieved by inactivation of the main CI-like repressor through autoproteolysis promoted by the activated form of the RecA protein. The alternative mechanism of prophage induction is used by coliphage 186 carrying the tum antirepressor gene under control of the host LexA protein (1, 16). However, phage 186 does not belong to the lambdoid phage family, and the Tum protein shows no detectable homology to N15 AntC.

Control of phage genes by the host's LexA repressor. Besides antC, another N15 gene, 26, seems to be controlled by LexA since its promoter contains a putative LexA binding site (5). This gene encodes the homologue of the E. coli UmuD' protein, the subunit of an error-prone DNA polymerase that participates in the repair of DNA damage during the SOS response (37). The E. coli UmuD protein is synthesized in an inactive form and is processed by RecA into active peptide, while phage N15 gene 26 product corresponds to an already-processed peptide lacking the amino-terminal 24 amino acids, UmuD'. Interestingly, other known linear phage plasmids, {phi}K02 and pY54, as well as phage P1, also contain umuD'-like genes under the control of the LexA repressor (5, 14, 17).

Analysis of the nucleotide sequences of linear phage plasmids {phi}K02 and pY54 revealed that both phages encode AntC-like antirepressors (gp47 and gp57, respectively) and that these genes may be controlled by LexA. In phage {phi}K02 the LexA binding site directly overlaps gene 47 promoter, while in phage PY54 the LexA operator controls expression of a two-gene operon comprising gene 56 that encodes a DinI-like protein (14) and the antirepressor gene, 57.

The Lex/Ant regulatory system of N15 and other linear phage-plasmids seems to be an alternative to the lambda model of cleavable repressor. A number of genes encoding DinI- and UmuD-like proteins presumably controlled by LexA were identified in temperate phage and plasmid genomes (5), but LexA-controlled antirepressor genes were found only in the nonlambdoid phages 186 and Fels-2. We show here that a phage carrying CI-like repressor can use a Lex/Ant prophage induction mechanism instead of repressor autocleavage. Whether such replacement provides particular benefits to temperate phages, which lysogenize as linear plasmids, or just reflects the common origin of the three phage-plasmids is unclear. However, since the mechanisms of prophage induction have been investigated for relatively few phage families, it is possible that the lambda model of cleavable repressor will turn out to be the exception rather than the rule.


   ACKNOWLEDGMENTS
 
The expert technical assistance of Taisia Strakhova is greatly appreciated. We are grateful to David Lane and Gregory Phillips for providing E. coli strains and plasmids.

This study was supported by Program Molecular and Cellular Biology of RAS, INTAS YS grant 04-83-333201-0786, and RFBR grant 07-04-01078.


   FOOTNOTES
 
* Corresponding author. Mailing address: Centre "Bioengineering," Russian Academy of Sciences, Prosp. 60-let Oktiabria, Bldg.7-1, Moscow 117312, Russia. Phone: (7) 495 1374305. Fax: (7) 495 1350571. E-mail: nravin{at}biengi.ac.ru Back

{triangledown} Published ahead of print on 22 June 2007. Back


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Brumby, A. M., I. Lamont, I. B. Dodd, and J. B. Egan. 1996. Defining the SOS operon of coliphage 186. Virology 219:105-114.[CrossRef][Medline]
  2. Bunny, K., J. Liu, and J. Roth. 2002. Phenotypes of lexA mutations in Salmonella enterica: evidence for a lethal lexA null phenotype due to the Fels-2 prophage. J. Bacteriol. 184:6235-6249.[Abstract/Free Full Text]
  3. Campbell, A., and D. Botstein. 1983. Evolution of the lambdoid phages, p. 365-380. In R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  4. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179-207.[CrossRef][Medline]
  5. Casjens, S. R., E. B. Gilcrease, W. M. Huang, K. L. Bunny, M. L. Pedulla, M. E. Ford, J. M. Hourtz, G. F. Hatfull, and R. W. Hendrix. 2004. The pKO2 linear plasmid prophage of Klebsiella oxytoca. J. Bacteriol. 186:1818-1832.[Abstract/Free Full Text]
  6. Citron, M., and H. Schuster. 1990. The c4 repressors of bacteriophages P1 and P7 are antisense RNAs. Cell 62:591-598.[CrossRef][Medline]
  7. Daniels, D. L., J. L. Schroeder, W. Szybalski, F. Sanger, A. R. Coulson, G. F. Hong, D. F. Hill, G. F. Petersen, and F. R. Blattner. 1983. Complete annotated lambda sequence, p. 519-676. In R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  8. Dehò, G., S. Zangrossi, P. Sabbattini, G. Sironi, and D. Ghisotti. 1992. Bacteriophage P4 immunity controlled by small RNAs via transcription termination. Mol. Microbiol. 6:3415-3425.[Medline]
  9. Dmitrova, M., G. Younes-Cauet, P. Oertel-Buchheit, D. Porte, M. Schnarr, and M. Granger-Schnarr. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205-212.[CrossRef][Medline]
  10. Fernandez De Henestrosa, A. R., T. Ogi, S. Aoyagi, D. Chafin, J. J. Hayes, H. Ohmori, and R. Woodgate. 2000. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 35:1560-1572.[CrossRef][Medline]
  11. Friedman, D., and M. Gottesman. 1983. Lytic mode of lambda development, p. 21-51. In R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  12. Grant, S. G., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645-4649.[Abstract/Free Full Text]
  13. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing arabinose PBAD promoter. J. Bacteriol. 177:4121-4130.[Abstract/Free Full Text]
  14. Hertwig, S., I. Klein, V. Schmidt, S. Beck, J. A. Hammerl, and B. Appel. 2003. Sequence analysis of the genome of the temperate Yersinia enterocolitica phage PY54. J. Mol. Biol. 331:605-622.[CrossRef][Medline]
  15. Kim, B., and J. W. Little. 1993. LexA and {lambda} Cl repressors as enzymes: specific cleavage in an intermolecular reaction. Cell 73:1165-1173.[CrossRef][Medline]
  16. Lamont, I., A. M. Brumby, and J. B. Egan. 1989. UV induction of coliphage 186: prophage induction as an SOS function. Proc. Natl. Acad. Sci. USA 86:5492-5496.[Abstract/Free Full Text]
  17. Lewis, L. K., G. R. Harlow, L. A. Gregg-Jolly, and D. W. Mount. 1994. Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J. Mol. Biol. 241:507-523.[CrossRef][Medline]
  18. Lin, L. L., and J. W. Little. 1989. Autodigestion and RecA-dependent cleavage of Ind- mutant LexA proteins. J. Mol. Biol. 210:439-452.[CrossRef][Medline]
  19. Little, J. W. 1984. Autodigestion of lexA and phage lambda repressors. Proc. Natl. Acad. Sci. USA 81:1375-1379.[Abstract/Free Full Text]
  20. Little, J. W., and D. W. Mount. 1982. The SOS regulatory system of Escherichia coli. Cell 29:11-22.[CrossRef][Medline]
  21. Lobocka, M. B., A. N. Svarchevsky, V. N. Rybchin, and M. B. Yarmolinsky. 1996. Characterization of the primary immunity region of the Escherichia coli linear prophage N15. J. Bacteriol. 178:2902-2910.[Abstract/Free Full Text]
  22. Mardanov, A. V., and N. V. Ravin. 2006. Functional characterization of the repA replication gene of linear plasmid prophage N15. Res. Microbiol. 157:176-183.[Medline]
  23. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  24. Quinones, M., H. H. Kimsey, and M. K. Waldor. 2005. LexA cleavage is required for CTX prophage induction. Mol. Cell 17:291-300.[CrossRef][Medline]
  25. Ravin, N., A. Svarchevsky, and G. Deho. 1999. The anti-immunity system of phage-plasmid N15: identification of the antirepressor gene and its control by a small processed RNA. Mol. Microbiol. 34:980-984.[CrossRef][Medline]
  26. Ravin, N. V. 2003. Mechanisms of replication and telomere resolution of the linear plasmid prophage N15. FEMS Microbiol. Lett. 22:1-6.[CrossRef]
  27. Ravin, N. V., and V. K. Ravin. 1994. An ultrahigh-copy plasmid based on the replicon of the temperate bacteriophage N15. Mol. Gen. Mikrobiol. Virusol. 1:37-39.[Medline]
  28. Ravin, N. V., J. Rech, and D. Lane. 2003. Mapping of functional domains in F plasmid partition proteins reveals a bipartite SopB-recognition domain in SopA. J. Mol. Biol. 329:875-889.[CrossRef][Medline]
  29. Ravin, V., and M. G. Shulga. 1970. The evidence of extrachromosomal location of prophage N15. Virology 40:800-805.[CrossRef][Medline]
  30. Ravin, V., N. Ravin, S. Casjens, M. E. Ford, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic sequence and analysis of the atypical temperate bacteriophage N15. J. Mol. Biol. 299:53-73.[CrossRef][Medline]
  31. Reece, K. S., and G. J. Phillips. 1995. New plasmids carrying antibiotic resistance cassettes. Gene 165:141-142.[CrossRef][Medline]
  32. Sauer, R. T., M. J. Ross, and M. Ptashne. 1982. Cleavage of the lambda and P22 repressors by RecA protein. J. Biol. Chem. 257:4458-4462.[Abstract/Free Full Text]
  33. Shearwin, K. E., A. M. Brumby, and J. B. Egan. 1998. The Tum protein of coliphage 186 is an antirepressor. J. Biol. Chem. 273:5708-5715.[Abstract/Free Full Text]
  34. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vector for protein and operon fusions. Gene 53:85-96.[CrossRef][Medline]
  35. Slilaty, S. N., and J. W. Little. 1987. Lysine-156 and serine-119 are required for LexA repressor cleavage: a possible mechanism. Proc. Natl. Acad. Sci. USA 84:3987-3991.[Abstract/Free Full Text]
  36. Susskind, M. M., and D. Botstein. 1975. Mechanism of action of Salmonella phage P22 antirepressor. J. Mol. Biol. 98:413-424.[CrossRef][Medline]
  37. Tang, M., X. Shen, E. G. Frank, M. O'Donnell, R. Woodgate, and M. F. Goodman. 1999. UmuD'(2)C is an error-prone DNA polymerase, Escherichia coli pol V. Proc. Natl. Acad. Sci. USA 96:8919-8924.[Abstract/Free Full Text]
  38. Walker, G. C. 1987. The SOS response of Escherichia coli, p. 1346-1357. In J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium. American Society for Microbiology, Washington, DC.

Journal of Bacteriology, September 2007, p. 6333-6338, Vol. 189, No. 17
0021-9193/07/$08.00+0     doi:10.1128/JB.00599-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.00599-07v1
189/17/6333    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mardanov, A. V.
Right arrow Articles by Ravin, N. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mardanov, A. V.
Right arrow Articles by Ravin, N. V.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Appl. Environ. Microbiol. Infect. Immun. Eukaryot. Cell
Mol. Cell. Biol. J. Virol. Microbiol. Mol. Biol. Rev.
ALL ASM JOURNALS