| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Veterinary Pathobiology and Bond Life Sciences Center, University of Missouri, Columbia, Missouri 65211,1 Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas 66506,2 Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, South Carolina 292083
Received 15 May 2007/ Accepted 2 July 2007
| ABSTRACT |
|---|
|
|
|---|
Sterne that carries a deletion of the bclB gene. The mutant was found to possess structural defects in the exosporium layer of the spore (visualized by electron microscopy, immunofluorescence, and flow cytometry) resulting in an exosporium that is more fragile than that of a wild-type spore and is easily lost. Immunofluorescence studies also indicated that the mutant strain produced spores with increased levels of the BclA glycoprotein accessible to the antibodies on the surface. The resistance properties of the mutant spores were unchanged from those of the wild-type spores. A bclB mutation did not affect spore germination or kinetics of spore survival within macrophages. BclB plays a key role in the formation and maintenance of the exosporium structure in B. anthracis. | INTRODUCTION |
|---|
|
|
|---|
The first spore surface glycoprotein discovered in B. anthracis was referred to as BclA (for Bacillus collagen-like protein anthracis) and is the most prominent protein component of the exosporium (41, 42). BclA is the immunodominant antigen located in the filaments of the nap (38). BclA contains an internal tandem repeat region (consisting primarily of GPT repeats containing most of the glycosylation sites) and N -and C-terminal regions (41). These repeats are the primary anchor point for rhamnose oligosaccharides within BclA (13). The anthrax spore contains a second collagen-like glycoprotein containing a GXT tandem repeat domain (46). Since spore-specific sugars (rhamnose, 3-O-methyl rhamnose, and galactosamine) were shown to be a component of BclA of B. anthracis (13, 15, 31, 47) and are also found in this newly discovered protein, it was named BclB (46).
Since the exosporium is the outermost structure of the spore, it is probable that it plays a major role in interactions with the environment and with the host immune system. The addition of inactivated spores has been shown to increase the degree of immunity against highly virulent strains of B. anthracis in animal models of infection (9). Rhamnose is a major constituent of the B. anthracis glycoproteins (13, 46). The rmlABCD locus, which displays high sequence similarity to rhamnose biosynthetic genes, is adjacent to the bclA determinant (16). Insertional inactivation of the rmlA determinant was shown to decrease adhesion and uptake of the mutant spores by macrophages (8). The exosporium has been proposed to be a semipermeable barrier that excludes potentially harmful large molecules, such as antibodies and hydrolytic enzymes (18, 19, 40). The B. anthracis exosporium also plays a role in limiting access to inducers of cytokine responses in vitro in macrophages (3).
As many as 20 other proteins make up the exosporium and may play a structural or functional role (11, 30, 35, 44). Enzymes associated with the exosporium, including arginase and superoxide dismutase (2, 34, 35), may be involved in protection against macrophage killing by detoxifying superoxide free radicals (35). Other exosporium and coat proteins play a structural role in maintaining the integrity of the exosporium (7, 35, 38, 39). BxpB (also referred to as ExsF) is located in the basal layer of the exosporium and stabilizes the BclA-rich nap (39, 43). The corresponding gene, bxpB, is located in a region near an operon encoding the BclA structural protein and rhamnose biosynthetic genes (16). The bclB determinant maps to an entirely different region of the B. anthracis chromosome. A coat protein, ExsA, also appears to play a role in the integrity of the coat and exosporium (1). Recently, the ExsY protein has been shown to play a significant role in exosporium development. Deletion of the exsY determinant results in the production of spores that lack an exosporium when cultured in liquid medium and possess only a polar fragment, or "cap," of exosporium when cultured on solid media (7). The cap structure contains the BclA nap, but further expansion of the exosporium does not occur in this mutant. The cap structure is unstable, and this may result in its being lost when the spores are produced in shaken liquid cultures (7). Recently, the CotE spore coat protein has been found to play a role in the maturation of the exosporium layer (21).
In this study we examine the role of the BclB protein in exosporium structure and function. We found that a BclB-deficient mutant has a more fragile exosporium layer and is associated with either increased content of BclA or increased accessibility of the BclA protein to antibody binding.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sterne was a gift from S. H. Leppla (National Institutes of Health, Bethesda, MD).
Sterne is a plasmid-free derivative of the Sterne veterinary vaccine strain. The bclA deletion mutant strain, CTL292 (13), was a generous gift from Charles Turnbough (University of Alabama—Birmingham). Bacteria were cultured on brain heart infusion agar (BHIA) or in tryptic soy broth (TSB) or tryptic soy agar (TSA) plates at 37°C. Sporulation was induced by growth on nutrient agar plates at 30°C, as the cells sporulate efficiently under these conditions. Generally, sporulation was essentially complete (>95%) by 72 h. The degree of sporulation was assessed by phase-contrast microscopy. Spores were harvested from the plates, washed three times in phosphate-buffered saline (PBS), and stored at room temperature (RT). Washing the spores three times in PBS was sufficient to remove the vast majority of vegetative cell debris when monitored by light microscopy. Isolation of chromosomal DNA. B. anthracis strains were cultured in 10 ml TSB with appropriate antibiotic selection at 37°C. The cells were harvested by centrifugation, washed with 10 ml TE buffer (0.01 mM Tris-HCl, 0.001 EDTA, pH 8.0), and the cell pellets were frozen at –25°C for several hours to overnight and then thawed, resuspended with 0.1 ml TE, and incubated at 37°C for 30 min to induce autolysis with the addition of RNase A (25 µg) and N-lauryl sarcosine (0.8%). Proteinase K (25 µg) was added, and the sample was incubated at 60°C for 1 h. The sample was cooled on ice and sequentially extracted with TE-saturated phenol and chloroform. The DNA was either dialyzed against distilled water at 4°C or precipitated with ethanol and resuspended in sterile distilled water.
Mutant strain construction.
A precise in-frame deletion of the bclB determinant was created utilizing the splicing by overlapping extension (SOE) procedure (26, 27). Primers bclB 5pK (GGTACCGCAGAAGGAAAATTAAGTTCG), bclB 3pS (GTCGACACTAATTCATCTCGCTTTAAC), bclB soeFB (AACAAAGGATCCCTCATTCCACATTTTTGTTTCCTAATTAAC), and bclBsoeRB (CAAAAATGTGGAATGAGGGATCCTTTGTTACAATGTTAATAGG) were obtained from Integrated DNA Technologies, Inc. (Coralville, IA) and used to amplify a DNA fragment consisting of the 1-kb sequence immediately upstream of the bclB open reading frame and the 1-kb sequence immediately downstream of this determinant. Flanking the PCR fragment are unique KpnI and SalI sites incorporated into the outer primers and a unique BamHI site at the position of the deleted bclB determinant. The PCR fragment was cloned into pUC19 to create pGS3623. The cloned PCR fragment was verified by DNA sequence analysis at the University of Missouri DNA Core Facility. The
Kan2 cassette (33) was inserted as a BamHI fragment into the unique BamHI site of the SOE product to produce pGS3624. The gram-positive replication region and erythromycin resistance marker from pUTE583 (12) were subcloned into pGS3624 to create the mutagenic shuttle plasmid pGS3632. Passage of the pGS3632 plasmid was accomplished through the dam-negative Escherichia coli host GM48 and electroporated into the
Sterne strain of B. anthracis by the method of Green et al. (22). Allele replacement mutants were obtained by the method of Saile and Koehler (37). Electrotransformants were screened for resistance to kanamycin (50 µg/ml) and sensitivity to the vector-encoded erythromycin resistance (5 µg/ml). DNA was isolated from clones with the correct phenotype and screened by PCR for the presence of the plasmid backbone (using primers pute5p [CGATACCGTCGACCTCG] and pute3p [AACAAAAGCTGGGTACC]), an intact bclA region (primers bclA5pXm [AACCCGGGCTGAAGGCAATGTATC] and bclA3pS [AGCGTCGACCAATTCTCTCCTCTAG]), and the bclB region (primers bclB5pK [GGTACCGCAGAAGGAAAATTAAGTTCG] and bclB3pS [GTCGACACTAATTCATCTCGCTTTAAC]). Sequence analysis of the amplified DNA fragment from strain MUS1692 confirmed its identity as the deletion allele.
Resistance properties of the spores. Tests for spore resistance to heat (65°C), UV irradiation (dose of 700 ergs/mm2), and organic solvents (chloroform and ethanol) were conducted essentially by the method of Nicholson and Setlow (32). Spores were additionally tested for resistance to phenol, bleach (sodium hypochlorite), and a quaternary ammonium salt disinfectant (Roccal-D [Upjohn]). To determine the level of resistance to these disinfectants, 50-µl amounts of the spores were added to 0.45 ml of 5% (wt/vol) phenol, bleach (1:32 dilution of bleach [5.25% sodium hypochlorite]), or 1:200 dilution of Roccal-D (stock was 20% alkyl dimethyl benzyl ammonium chloride) in 1.5-ml polypropylene microcentrifuge tubes. The samples were vortexed vigorously and kept at RT. After 10 min, aliquots were removed from each, serially diluted in PBS, and plated on BHIA plates for viable count determinations.
Analysis of glycoproteins by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Ten milligrams (wet weight) of wild-type or BclB-deficient B. anthracis spores were extracted either by boiling the spores in urea buffer (50 mM Tris-HCl, pH 10, 8 M urea, 2% 2-mercaptoethanol) or by boiling the spores in SDS sample buffer (50 mM Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, 2% ß-mercaptoethanol, 0.02% bromophenol blue) for 10 min. The extracted spores were centrifuged at 10,000 x g for 10 min at RT. The supernatant was removed and used to load individual lanes of a 4 to 20% gradient Tris-HCl protein gel (Bio-Rad) and electrophoresed in Tris-glycine-SDS buffer. Gels were stained with either the Gelcode Blue staining kit (Pierce, Rockford, IL) or Coomassie brilliant blue.
Western blot analyses. The bclA and bclB open reading frames were PCR amplified and cloned into the pQE30 plasmid (QIAGEN). His-tagged proteins were expressed in E. coli and purified using the His spin protein purification kit (Zymo Research). Anti-BclA and anti-BclB antisera were prepared in rabbits using Ribi adjuvant (Corixa). Western blots were conducted using goat anti-rabbit immunoglobulin G conjugated to alkaline phosphatase as the secondary antibody, and the immunoreactive proteins were identified using the AP Conjugate Substrate kit (Bio-Rad). Quantitative analyses of Western blot data were obtained using the Multi-Gauge analytical software (Fujifilm).
Epifluorescence microscopy. Five milligrams of spores (wet weight) were resuspended in StartingBlock (Pierce) and incubated at RT for 45 min with occasional mixing. The spores were then pelleted and resuspended in StartingBlock. Rabbit polyclonal antiserum (1:250 dilution) against BclA or BclB was added and incubated at RT for 45 min with occasional mixing. The spores were then washed three times in StartingBlock and incubated with fluorescein isothiocyanate (FITC)-protein A conjugate (Sigma Chemical Co.) and incubated for 45 min at RT with occasional mixing. The spores were washed three times with StartingBlock, resuspended in PBS, and examined by epifluorescence microscopy using a Nikon E600 microscope.
Scanning electron microscopy (SEM). B. anthracis spores were fixed overnight at 4°C in 20 volumes of modified Karnowsky's fixative (2% paraformaldehyde, 2.5% glutaraldehyde, 1.7 mM CaCl2 in 0.1 M cacodylate buffer [pH 7.4]). After the spores were fixed, they were washed twice in 0.1 M cacodylate buffer (pH 7.4) and postfixed in 1% osmium tetroxide in 0.1 M cacodylate buffer overnight at 4°C. The cells were washed twice in double-distilled water, they were resuspended in double-distilled water, mounted on coverslips coated with poly-L-lysine, and dehydrated in a series of alcohol solutions (25, 50, 70, 95, and 100%). Dehydrated samples were treated for 5 min with hexamethyldisilazane (Electron Microscopy Sciences, Fort Washington, PA), dried, mounted, and sputter coated with gold (S150A sputter coater). Samples were viewed in a Hitachi H-300 electron microscope with a 3010 scanning image accessory.
For immunogold labeling, spores were attached to coverslips coated with poly-L-lysine and allowed to adhere for 30 min. They were rinsed in PBS with 50 mM NH4Cl and then in a PBS blocking solution (1% bovine serum albumin [BSA] and 1% goat serum) for 5 min. Anti-BclA rabbit polyclonal antibodies were diluted in PBS blocking solution (1:50) and added to the coverslips for 30 min at RT. The coverslips were washed in PBS plus 0.1% BSA twice for 5 min each time. Fifteen-nanometer colloidal gold-conjugated goat anti-rabbit immunoglobulin G antibodies (Aurion) were diluted 1:20 in PBS plus 0.01% fish gelatin and applied to the spores for 30 min at RT. Three washes in PBS were performed, followed by fixation in 2% glutaraldehyde in PBS for 1 h. The coverslips were then washed twice in PBS buffer and three times in distilled water. The spores were then dehydrated and treated as described above except they were sputter coated with carbon.
TEM. To the buffer-washed spores, 1 ml of a 2% glutaraldehyde- 0.1 M sodium cacodylate solution containing 0.1% ruthenium red (Electron Microscopy Sciences, Fort Washington, PA) was added and incubated for 1 h at 37°C. Each pellet was then washed in cacodylate buffer and fixed for 3 h at RT in a 1% osmium tetroxide (Electron Microscopy Sciences)-0.1 M sodium cacodylate solution containing 0.1% ruthenium red. A negative control was treated identically, but ruthenium red was omitted from these two steps. Spores were washed in buffer and embedded in 3% agar (EM Science, Gibbstown, NJ). Dehydration involved sequential treatment with 25, 50, 75, 95, and 100% acetone. Polymerization was carried out at 60°C in Epon/araldite resin. Sections were cut at 85-nm thickness and put on 200-mesh carbon-coated copper grids and then stained with a 2% uranyl acetate solution (Electron Microscopy Sciences) for 40 min at 37°C. The sections were then treated with Sato's triple lead for 3 min, washed in ultrapure water, and stained again for 18 min in 5% uranyl acetate, followed by one final wash and were observed by transmission electron microscopy (TEM) with a JEOL 1200EX electron microscope.
Immunogold labeling of embedded spores was performed after fixation of spores in a 2% glutaraldehyde and 2% formaldehyde PBS solution. After dehydration and embedding as described above, the cut grid sections were blocked in a 1% BSA solution for 30 min. The grids were washed three times in PBS, and the primary antibodies were added to the grids at a concentration of 1:25 in incubation buffer (Aurion). One hour later, the grids were washed six times in incubation buffer and incubated with 1:25 goat anti-rabbit secondary conjugate with 15-nm colloidal gold and allowed to bind for 2 hours. After a series of washes in PBS, the grids were postfixed in 2% glutaraldehyde on 0.1 M PBS for 5 min and finished with washes in PBS and distilled water.
Macrophage infection assays. A total of 105 to 106 RAW 264.7 macrophages was dispensed into 24-well tissue culture plates (Falcon) and incubated overnight in Dulbecco's modified Eagle medium (DMEM) with glucose plus 10% heat-inactivated (65°C for 1 h) fetal bovine serum (FBS). Endospores were diluted in DMEM with 10% FBS and then immediately added to wells at a multiplicity of infection of 1:1 or 10:1 spores:macrophages. To maximize the number of endospores interacting with macrophages, the plate was centrifuged at 1,000 rpm for 5 min in a Sorvall 6000D tabletop centrifuge (Sorvall Instruments) equipped with a Sorvall H100B rotor that was prewarmed to 37°C. After centrifugation, the plates were incubated for an additional 30 min at 37°C in an H2O-saturated atmosphere with 5% CO2 to allow for germination and outgrowth of endospores. The culture medium was aspirated from each well, the macrophages were washed, the medium was replaced with fresh medium supplemented with 50 µg/ml gentamicin and incubated for 30 min at 37°C to eliminate any unphagocytosed germinated endospores and extracellular vegetative cells. The medium was removed, and the cells were washed twice with fresh antibiotic-free DMEM and resuspended in fresh prewarmed medium. Intracellular bacterial numbers were then quantified by dilution plating after macrophages from triplicate wells were lysed with distilled water (lysis was observed by light microscopy). The bacteria were serially diluted in PBS and plated on BHIA plates directly (total viable counts) or after heating for 30 min at 65°C (ungerminated spore counts).
Spore analysis by flow cytometry. Spores were reacted with antibody and labeled with FITC-protein A conjugate as described above for epifluorescence microscopy. The spores were washed three times with StartingBlock and two times with PBS and processed on a FACScan flow cytometer using a 488-nm argon laser (Becton Dickinson Biosciences). Data were analyzed using Cell Quest analysis software (Becton Dickinson). For the ethanol-treated spores, the spores were resuspended in 50% ethanol for 10 min, pelleted, resuspended in StartingBlock, and then exposed to antiserum and FITC-protein A conjugate as described above.
| RESULTS |
|---|
|
|
|---|
Sterne-1 to create strain MUS1692. The bclB-inactivated strain sporulated with kinetics and efficiencies comparable to those of the wild-type parental strain (data not shown). The morphology of the mutant spores was evaluated by TEM. TEM revealed that the
bclB spores comprised a mixed population of spores. Many of the spores were morphologically identical to the parental strain spores (Fig. 1A). However, spores with damaged exosporia are evident. The majority of these have ruptures of the exosporium layer, usually at one pole of the elliptical spore (Fig. 1B, C, and F). In addition, empty exosporia are evident in the mutant spore preparation (Fig. 1B, D, and E) but are not present in the spores prepared from the wild-type parental strain. A large amount of debris that visually resembles exosporium material is abundant in spore preparations from the mutant strain, but not from the wild-type parent. Ruthenium red staining of the spores, which allows visualization of the glycoprotein outer nap layer of the exosporium (45), revealed that the surface glycoprotein, thought to be predominantly BclA (42), is present in both the mutant and wild-type spores. This dye also stained the debris material, supporting the idea that this material was shed exosporia.
|
Sterne-1 and MUS1692 strains were examined from electron micrographs, and the numbers of spores with an intact exosporium were calculated (Table 1). In a typical spore preparation, 95% of the wild-type spores appeared to have normal architecture, whereas only 60% of the BclB-negative spores had normal architecture. The remainder of the BclB-negative spores displayed a damaged exosporium. The defect was either minor, with the damage usually at one pole of the spore, or severe with the spore either devoid or largely devoid of an exosporium layer. In addition, free exosporia are evident in the spore fields from the bclB mutant but are not observed in spore preparations from the wild-type spores. It appears that a consequence of a lack of BclB production is the assembly of spores with a more fragile exosporium layer.
|
protein where apparent antigen-independent immunogold labeling over the spore cytoplasm was also observed (28). The results support the observation that the immunogold labeling of the exosporium is specifically showing binding to the BclB protein. The presence of an increased amount of immunogold label in the coat and core of the wild-type spores compared to the spores treated with control sera may suggest the presence of BclB in those parts of the spore as well, and not just the exosporium.
To further characterize the exosporium of the bclB mutant spores and also to determine whether the debris present in the BclB-negative spore samples was exosporium, immunogold labeling was performed with polyclonal anti-BclA sera. In both the
Sterne spores and the BclB-negative spores, significant binding of the immunogold particles was found in the nap layer of the exosporium of the spores (Fig. 1I and data not shown). In both strains stained with anti-BclA and anti-BclB antibodies, an increase in the labeling of the spore coat and cytoplasm was seen compared to the controls (average of 26 particles/spore exosporium; average of 18 particles/spore core and cortex). Although other studies have not shown the presence of BclA in the spore coat and cytoplasm (6, 39), the use of a polyclonal antiserum (instead of monoclonal antibodies used in other studies) may explain the differences seen in these micrographs, as more epitopes can be recognized by the multivalent sera. In addition, the ruthenium red-stained exosporium-like debris found in the bclB mutant also reacted with the anti-BclA antibodies, further suggesting that the debris is shed exosporia (data not shown).
Changes in the outer surfaces of the BclB-negative spores were confirmed by SEM (Fig. 2). The majority of spores from the
Sterne strain (Fig. 2A) exhibited a smooth raisin-like surface with characteristic ridges similar to those observed by atomic force microscopy (10, 48). Many of the bclB-negative spores displayed a rougher, dimpled appearance (Fig. 2B). A subpopulation of the BclB-negative spores contained ridges and had a distinctly wild-type appearance. This rougher appearance could represent the changed appearance of the disorganized exosporium layer itself in the bclB mutant, or alternatively, it may signify a disruption of the exosporium layer and visualization of the underlying spore coat layers. The sloughed-off material in the bclB mutant may well be exosporium (Fig. 2C). The presence of ridges on the spores was reported to signify the lack of an exosporium (10). To determine whether the exosporium was still present in the bclB-negative mutant spores, immunogold labeling of the spores using rabbit anti-BclA polyclonal sera was used. Since the BclA protein is surface exposed in the exosporium layer, loss of the exosporium would eliminate binding of the anti-BclA antibodies. Immunolabeling demonstrated that the bclB-negative spores, despite their changed appearance, retained the exosporium as shown by the presence of surface-exposed BclA (Fig. 2D and E). There was a greater amount of debris associated with the mutant spores than was seen with the wild-type spores, presumably shed exosporium fragments. To further validate the presence of BclB in the exosporium of spores as was observed by TEM, immunolabeling of wild-type spores for visualization by SEM was accomplished using anti-BclB sera. The presence of immunogold label on the spore surface further supported BclB being present in the exosporium (Fig. 2F). However, BclB was labeled at a reduced level compared to BclA.
|
Western blot analysis of the mutant and wild-type spores.
Two chemical methods have been described for extracting exosporium proteins from intact spores of B. anthracis. The simplest method is to boil the spores in SDS-PAGE buffer. The second method involves extraction of the spores with 8 M urea buffer. Although both methods have been shown to be efficient at extracting BclA from the spores, we found that only the urea extraction reliably yielded the BclB protein from the wild-type spores (Fig. 3A, lane 3), while the SDS treatment resulted in lower recovery rates of BclB (data not shown). The BclB-reactive species were absent when the extracts were made from spores of strain MUS1692 (Fig. 3A, lane 2), confirming the identity of the immunoreactive species in the
Sterne spores as BclB. The Western blot results further suggest that the BclB protein is present in the exosporium or on the surface of the spore coat in spores of B. anthracis but in a configuration that is less extractable from the spore then by simple SDS treatment. The BclB protein extracted from spores migrates on SDS-polyacrylamide gels as a high-molecular-weight species. High-molecular-weight heteromers have been observed in spore extracts of B. anthracis and have been shown to consist of many exosporium-associated proteins that interact with BclA, BxpB, and ExsF (6, 38, 41). The migration properties of BclB suggest that this protein may be part of similar complexes. When anti-BclA antiserum was utilized to probe the spore lysates, the amount of BclA present in extracts from the bclB mutant spores was consistently greater (average of 2.3-fold ± 0.8-fold, based on six independent experiments) than the reactive material extracted from the wild-type spores.
|
Sterne and BclB-negative spores, consistent with the known surface location of this glycoprotein (Fig. 4D and F). The anti-BclA sera did not react with the BclA deletion strain CTL292 (Fig. 4E). A fainter, but reproducible, signal was evident when anti-BclB antiserum was incubated with wild-type spores (Fig. 4G) but not with the bclB mutant spores (Fig. 4I). This suggests that the BclB protein is, at least in part, surface exposed in the spores of B. anthracis.
|
If BclB were present in the basal layer of the exosporium, binding of the anti-BclB antibodies could be hindered by the presence of the hair-like nap blocking access to the BclB epitopes. When the basal layer protein BxpB (16) was identified, binding of the anti-BxpB antibodies was greatly increased when a bclA mutant strain was used. We used the BclA-deficient strain CLT292 to examine binding of anti-BclB antibodies (Fig. 4H). When the CTL292 spores were analyzed for the presence of BclB, a minor increase was seen in the binding of anti-BclB antibodies. More notably, the anti-BclB antibodies concentrated at a point at the pole of the spore (Fig. 4H). This polar concentration was not evident with the
Sterne spores (Fig. 4G).
In agreement with the findings of the bclB mutant by TEM and SEM, there was evidence of damage to the exosporium layer of the mutant when examined by immunofluorescence (Fig. 4M and N). When the BclB-deficient spores were treated with anti-BclA antiserum, approximately 30 to 40% of the spores exhibited a lack of BclA-staining at one pole. This lack of BclA at one pole was most likely due to the damage of the exosporium layer at the pole, as we observed by TEM. These spores appear to be devoid of the exosporium polar cap. There was also evidence of the exosporium being sloughed off and some spores devoid of staining altogether (Fig. 4M and N and data not shown).
The fluorescence micrographs provided only a qualitative assessment of surface exposure of the BclA and BclB proteins. For a quantitative determination of BclA and BclB protein exposure on the spore surface, spores were subjected to analysis by flow cytometry utilizing the anti-BclA and anti-BclB antisera. The results of these analyses are shown in Fig. 5. The results further demonstrated that BclB is surface exposed in the
Sterne spores and is absent in the spores prepared from the bclB deletion strain (Fig. 5A and B). Furthermore, the flow cytometry analysis indicated that the level of BclA detectable on the surfaces of the bclB mutant spores was increased relative to that of the wild-type spores, consistent with the Western blot results (Fig. 5C and D). The mean fluorescence intensity for the spore samples with anti-BclA antibodies was higher with the BclB-deficient spores (mean fluorescence intensity of 187 ± 14.3 versus 106 ± 11.2). The amount of BclB exposed on the surfaces of the spores was substantially less than that of BclA, with a mean fluorescence intensity of 42 ± 7.2. Loss of the BclB glycoprotein and its associated sugars from the exosporium may have resulted in a compensatory increase in the presence of the BclA glycoprotein or in a change in the structure of the exosporium which allows greater access of the BclA epitopes to the anti-BclA antibodies.
|
The alcohol treatment may likely have accounted for the more dramatic change in appearance in the BclB-negative spores examined by SEM. A series of alcohol dehydration steps were involved in preparing the spores for SEM.
Spore-macrophage interactions.
The presence of the exosporium on the outermost part of the spore leads it to potentially play a role in the initial interactions with the host, including phagocytosis by host macrophages, as well as outgrowth and escape from the phagosomes (13, 22). The structural changes of the exosporium in the bclB mutant and the loss of this spore-associated glycoprotein may result in a change in the kinetics of survival of the mutated spores in macrophages. To assay uptake and infectivity of the bclB mutant spores versus
Sterne spores in vitro, RAW 264.7 murine macrophages were infected at multiplicity of infections of 10:1 and 1:1 (spores to macrophage) and treated with gentamicin to kill off any free vegetative cells, and samples were taken at timed intervals and plated for viable and heat-resistant colony (ungerminated spore) counts. Greater than 99% of all spores added to the tissue culture medium were susceptible to heat at 1 h, indicating that germination efficiently occurred in this FBS-containing environment (data not shown). At the first assayed time point of 1 h in the macrophage assays, no significant difference was found between uptake efficiencies of the BclB-negative mutant spores versus
Sterne spores. Examination of viable CFU at 1, 2, 4, and 24 h revealed no difference in viable counts between bclB mutant and
Sterne spores. A representative experiment is shown in Fig. 6. Both strains were killed off with equal efficiency, with essentially no viable cells remaining at 24 h.
|
| DISCUSSION |
|---|
|
|
|---|
BclB has many similarities to the well-characterized exosporium glycoprotein BclA. Like BclA, it also contains an internal collagen-like tandem repeat (GITGVTGAT). As in BclA, the repeated threonines in the BclB repeat are the likely sites of glycosylation, and the BclB-associated sugars rhamnose, 3-O-methyl rhamnose, and galactosamine have been identified. Recent microarray data showed that both bclA and bclB are transcribed simultaneously during sporulation (5). The bclA and bclB determinants are both preceded by
K-like promoter sequences, and expression of these genes initiates late in sporulation (5). Both glycoprotein determinants are expressed in conjunction with the rhamnose determinants in the operon adjacent to bclA, also containing a
K-like promoter element. This expression pattern is consistent with expression from promoters regulated by this late mother cell-specific sigma factor and is consistent with the placement of BclB in the outer spore layers.
By SEM, the bclB mutant appears to have a more dimpled appearance, with a decrease in the presence of the pronounced ridges found in the wild-type spores. Chada and coworkers utilized atomic force microscopy to characterize spore surfaces and suggested that the presence of ridges in spores signifies the loss of the exosporium layer (10). By using anti-BclA sera, our immunogold-labeled spores appeared to be encased within an exosporium as evidenced by the presence of the surface-exposed BclA. The presence of the BclA-containing exosporium was independent of the appearance of the ridges on the spore surface. Loss of the BclB protein has an impact on both the integrity and stability of the exosporium, as well as modifying the appearance of the exosporium by SEM.
Examination of material extracted from spores further supports our conclusion that BclB is associated with the exosporium. Other exosporium-associated proteins when extracted and subjected to SDS-PAGE analysis have been found to comigrate with BclA in a heterogenous band of >200 kDa. The presence of BclB migrating in similarly sized complexes further suggests its association in similar complexes. The decreased yield of BclB from spores suggests that it is present at a lower concentration than BclA or is more securely anchored than BclA.
We have found that BclB is surface exposed on the spores of B. anthracis. By immunofluorescence we have shown a consistent binding of our anti-BclB antibodies to the surfaces of spores. The intensity of the binding is less than that observed with anti-BclA antibodies. The heterogeneity of the fluorescence of the spores with anti-BclA antibodies could be explained by the differing accessibilities of the antibodies to the protein backbone epitopes of BclA due to the differing glycosylation patterns or may support a nonuniform assembly of the exosporium as recently reported (40).
The length of the surface filaments on the exosporium surface correlates with BclA repeat number and bclA-negative spores possess no visible hair-like nap layer, indicating that the nap is largely composed of this protein (38, 41). Immunofluorescence studies reported herein indicate that the BclB glycoprotein is also surface exposed on the spore and plays a role in the structural integrity of the exosporium layer as indicated by the increased fragility of this layer in spores lacking this protein. The fact that the bclA mutant spores are devoid of a noticeable nap does not rule out the possible presence of BclB in the nap. The lower content of BclB expressed on the exosporium may not produce visible filaments without the presence of BclA. Loss of BclB and its associated sugars could leave architectural voids within the exosporium nap layer that are selectively filled with BclA and may lead to an increase in BclA incorporation and the relative increase in BclA as seen on Western blots and immunofluorescence. Alternatively, loss of BclB could also open up gaps in the nap that better allow antibodies access to BclA epitopes or could orient the BclA protein in a way that can be more easily extracted from the exosporium.
The loss of the BclB glycoprotein from the exosporium and possibly from other sites within mutant spores leads to a more fragile exosporium layer. Examination of the BclB-negative spores by TEM and by immunofluorescence demonstrated that often this fragility is at one pole of the spore. BclB was found to localize in greater amounts at one pole of the cells in the CTL292 bclA deletion strain, suggesting that BclB accumulates at the pole of the spore or potentially in the cap structure described by Boydston et al. and Steichen et al. (6, 40). If the BclB protein has a structural role at the pole of the exosporium, lack of BclB at this site may lead to the polar damage seen in the TEM and immunofluorescence micrographs. Stress of the exosporium may lead to breakage at the pole. The exosporium cap has been reported to be a weakened spot in the exosporium where newly germinated cells emerge (40). BclB may play a role in strengthening or anchoring the cap, and lack of BclB could lead to a weaker cap that pops off more easily. When BclB-negative spores were stained with anti-BclA sera, many of the spores exhibited no staining at one pole. We interpreted this as a lack of exosporium at the pole and not a lack of antibody staining, consistent with the damage seen in the TEM micrographs. The percentage of spores with damage seen by TEM is roughly equal to the percentage of mutant spores seen by immunofluorescence without polar staining or a cap. Without the exosporium at the cap or pole, the exosporia may slough off, as is evident by TEM. These sloughed-off exosporia may be more susceptible to extraction, leading to the increased amount of BclA found in the BclB-negative spores by Western blotting.
The effects of ethanol exposure and presumably the dehydration/rehydration process may underscore the significant role of BclB in the architecture of the exosporium. Since BclB may play also play a role in the flexibility of the exosporium, the
bclB mutant may lose this flexibility causing increased breakage of the exosporium when stressed by the dehydration/rehydration of the spore.
BclB plays a role in the structural integrity of the exosporium. The influence of BclB on the incorporation of the BclA protein and on the overall architecture of the spore, directly or indirectly, is one of the keys in the formation or maintenance of a rigid and complete exosporium structure in B. anthracis.
| ACKNOWLEDGMENTS |
|---|
We thank Bob Price and Jeff Davis (USC School of Medicine Instrumentation Facility), Randy Tindall (University of Missouri EM Core Facility) for aid in the electron microscopic imaging, C. L. Turnbough (University of Alabama—Birmingham) for the CTL292 strain, T. M. Koehler (University of Texas—Houston Health Science Center) for plasmid pUTE583, Dan Hassett (University of Missouri) for help with the flow cytometry, Chris Lorson (University of Missouri) for help with the fluorescence microscopy, and Bob Livingston (University of Missouri) for the RAW 264.7 cells.
| FOOTNOTES |
|---|
Published ahead of print on 20 July 2007. ![]()
| REFERENCES |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||