JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.00762-07v1
189/18/6704    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, B. M.
Right arrow Articles by Stewart, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, B. M.
Right arrow Articles by Stewart, G. C.
Journal of Bacteriology, September 2007, p. 6704-6713, Vol. 189, No. 18
0021-9193/07/$08.00+0     doi:10.1128/JB.00762-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The BclB Glycoprotein of Bacillus anthracis Is Involved in Exosporium Integrity{triangledown}

Brian M. Thompson,1,2 Lashanda N. Waller,3 Karen F. Fox,3 Alvin Fox,3 and George C. Stewart1*

Department of Veterinary Pathobiology and Bond Life Sciences Center, University of Missouri, Columbia, Missouri 65211,1 Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas 66506,2 Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, South Carolina 292083

Received 15 May 2007/ Accepted 2 July 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Anthrax is a highly fatal disease caused by the gram-positive, endospore-forming, rod-shaped bacterium Bacillus anthracis. Spores, rather than vegetative bacterial cells, are the source of anthrax infections. Spores of B. anthracis are enclosed by a prominent loose-fitting structure called the exosporium. The exosporium is composed of a basal layer and an external hair-like nap. Filaments of the hair-like nap are made up largely of a single collagen-like glycoprotein called BclA. A second glycoprotein, BclB, has been identified in the exosporium layer. The specific location of this glycoprotein within the exosporium layer and its role in the biology of the spore are unknown. We created a mutant strain of B. anthracis {Delta}Sterne that carries a deletion of the bclB gene. The mutant was found to possess structural defects in the exosporium layer of the spore (visualized by electron microscopy, immunofluorescence, and flow cytometry) resulting in an exosporium that is more fragile than that of a wild-type spore and is easily lost. Immunofluorescence studies also indicated that the mutant strain produced spores with increased levels of the BclA glycoprotein accessible to the antibodies on the surface. The resistance properties of the mutant spores were unchanged from those of the wild-type spores. A bclB mutation did not affect spore germination or kinetics of spore survival within macrophages. BclB plays a key role in the formation and maintenance of the exosporium structure in B. anthracis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bacillus anthracis is a gram-positive, rod-shaped bacterium that causes anthrax, principally in ruminants, and is a major concern as both a zoonotic human pathogen and an agent of bioterrorism (reviewed in reference 25). Anthrax is acquired following contact with B. anthracis spores, which are the infectious form of this organism. The exosporium of B. anthracis and the other members of the Bacillus cereus group of spore-forming bacteria is the most external protein layer enclosing the spore. It consists of an inner basal layer and outer nap region having a hair-like appearance (4, 11, 20, 24, 29). The filaments of the hair-like nap are apparently formed by a single collagen-like glycoprotein called BclA (38-42), whereas the basal layer is composed of a number of different proteins in tight and loose associations (35, 39). In the past few years, the protein constituents of the exosporium have begun to be elucidated, but there have been few studies of the role of these proteins in the function of the exosporium (2, 34, 35, 38, 44).

The first spore surface glycoprotein discovered in B. anthracis was referred to as BclA (for Bacillus collagen-like protein anthracis) and is the most prominent protein component of the exosporium (41, 42). BclA is the immunodominant antigen located in the filaments of the nap (38). BclA contains an internal tandem repeat region (consisting primarily of GPT repeats containing most of the glycosylation sites) and N -and C-terminal regions (41). These repeats are the primary anchor point for rhamnose oligosaccharides within BclA (13). The anthrax spore contains a second collagen-like glycoprotein containing a GXT tandem repeat domain (46). Since spore-specific sugars (rhamnose, 3-O-methyl rhamnose, and galactosamine) were shown to be a component of BclA of B. anthracis (13, 15, 31, 47) and are also found in this newly discovered protein, it was named BclB (46).

Since the exosporium is the outermost structure of the spore, it is probable that it plays a major role in interactions with the environment and with the host immune system. The addition of inactivated spores has been shown to increase the degree of immunity against highly virulent strains of B. anthracis in animal models of infection (9). Rhamnose is a major constituent of the B. anthracis glycoproteins (13, 46). The rmlABCD locus, which displays high sequence similarity to rhamnose biosynthetic genes, is adjacent to the bclA determinant (16). Insertional inactivation of the rmlA determinant was shown to decrease adhesion and uptake of the mutant spores by macrophages (8). The exosporium has been proposed to be a semipermeable barrier that excludes potentially harmful large molecules, such as antibodies and hydrolytic enzymes (18, 19, 40). The B. anthracis exosporium also plays a role in limiting access to inducers of cytokine responses in vitro in macrophages (3).

As many as 20 other proteins make up the exosporium and may play a structural or functional role (11, 30, 35, 44). Enzymes associated with the exosporium, including arginase and superoxide dismutase (2, 34, 35), may be involved in protection against macrophage killing by detoxifying superoxide free radicals (35). Other exosporium and coat proteins play a structural role in maintaining the integrity of the exosporium (7, 35, 38, 39). BxpB (also referred to as ExsF) is located in the basal layer of the exosporium and stabilizes the BclA-rich nap (39, 43). The corresponding gene, bxpB, is located in a region near an operon encoding the BclA structural protein and rhamnose biosynthetic genes (16). The bclB determinant maps to an entirely different region of the B. anthracis chromosome. A coat protein, ExsA, also appears to play a role in the integrity of the coat and exosporium (1). Recently, the ExsY protein has been shown to play a significant role in exosporium development. Deletion of the exsY determinant results in the production of spores that lack an exosporium when cultured in liquid medium and possess only a polar fragment, or "cap," of exosporium when cultured on solid media (7). The cap structure contains the BclA nap, but further expansion of the exosporium does not occur in this mutant. The cap structure is unstable, and this may result in its being lost when the spores are produced in shaken liquid cultures (7). Recently, the CotE spore coat protein has been found to play a role in the maturation of the exosporium layer (21).

In this study we examine the role of the BclB protein in exosporium structure and function. We found that a BclB-deficient mutant has a more fragile exosporium layer and is associated with either increased content of BclA or increased accessibility of the BclA protein to antibody binding.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Growth conditions. Bacillus anthracis strain {Delta}Sterne was a gift from S. H. Leppla (National Institutes of Health, Bethesda, MD). {Delta}Sterne is a plasmid-free derivative of the Sterne veterinary vaccine strain. The bclA deletion mutant strain, CTL292 (13), was a generous gift from Charles Turnbough (University of Alabama—Birmingham). Bacteria were cultured on brain heart infusion agar (BHIA) or in tryptic soy broth (TSB) or tryptic soy agar (TSA) plates at 37°C. Sporulation was induced by growth on nutrient agar plates at 30°C, as the cells sporulate efficiently under these conditions. Generally, sporulation was essentially complete (>95%) by 72 h. The degree of sporulation was assessed by phase-contrast microscopy. Spores were harvested from the plates, washed three times in phosphate-buffered saline (PBS), and stored at room temperature (RT). Washing the spores three times in PBS was sufficient to remove the vast majority of vegetative cell debris when monitored by light microscopy.

Isolation of chromosomal DNA. B. anthracis strains were cultured in 10 ml TSB with appropriate antibiotic selection at 37°C. The cells were harvested by centrifugation, washed with 10 ml TE buffer (0.01 mM Tris-HCl, 0.001 EDTA, pH 8.0), and the cell pellets were frozen at –25°C for several hours to overnight and then thawed, resuspended with 0.1 ml TE, and incubated at 37°C for 30 min to induce autolysis with the addition of RNase A (25 µg) and N-lauryl sarcosine (0.8%). Proteinase K (25 µg) was added, and the sample was incubated at 60°C for 1 h. The sample was cooled on ice and sequentially extracted with TE-saturated phenol and chloroform. The DNA was either dialyzed against distilled water at 4°C or precipitated with ethanol and resuspended in sterile distilled water.

Mutant strain construction. A precise in-frame deletion of the bclB determinant was created utilizing the splicing by overlapping extension (SOE) procedure (26, 27). Primers bclB 5pK (GGTACCGCAGAAGGAAAATTAAGTTCG), bclB 3pS (GTCGACACTAATTCATCTCGCTTTAAC), bclB soeFB (AACAAAGGATCCCTCATTCCACATTTTTGTTTCCTAATTAAC), and bclBsoeRB (CAAAAATGTGGAATGAGGGATCCTTTGTTACAATGTTAATAGG) were obtained from Integrated DNA Technologies, Inc. (Coralville, IA) and used to amplify a DNA fragment consisting of the 1-kb sequence immediately upstream of the bclB open reading frame and the 1-kb sequence immediately downstream of this determinant. Flanking the PCR fragment are unique KpnI and SalI sites incorporated into the outer primers and a unique BamHI site at the position of the deleted bclB determinant. The PCR fragment was cloned into pUC19 to create pGS3623. The cloned PCR fragment was verified by DNA sequence analysis at the University of Missouri DNA Core Facility. The {Omega}Kan2 cassette (33) was inserted as a BamHI fragment into the unique BamHI site of the SOE product to produce pGS3624. The gram-positive replication region and erythromycin resistance marker from pUTE583 (12) were subcloned into pGS3624 to create the mutagenic shuttle plasmid pGS3632. Passage of the pGS3632 plasmid was accomplished through the dam-negative Escherichia coli host GM48 and electroporated into the {Delta}Sterne strain of B. anthracis by the method of Green et al. (22). Allele replacement mutants were obtained by the method of Saile and Koehler (37). Electrotransformants were screened for resistance to kanamycin (50 µg/ml) and sensitivity to the vector-encoded erythromycin resistance (5 µg/ml). DNA was isolated from clones with the correct phenotype and screened by PCR for the presence of the plasmid backbone (using primers pute5p [CGATACCGTCGACCTCG] and pute3p [AACAAAAGCTGGGTACC]), an intact bclA region (primers bclA5pXm [AACCCGGGCTGAAGGCAATGTATC] and bclA3pS [AGCGTCGACCAATTCTCTCCTCTAG]), and the bclB region (primers bclB5pK [GGTACCGCAGAAGGAAAATTAAGTTCG] and bclB3pS [GTCGACACTAATTCATCTCGCTTTAAC]). Sequence analysis of the amplified DNA fragment from strain MUS1692 confirmed its identity as the deletion allele.

Resistance properties of the spores. Tests for spore resistance to heat (65°C), UV irradiation (dose of 700 ergs/mm2), and organic solvents (chloroform and ethanol) were conducted essentially by the method of Nicholson and Setlow (32). Spores were additionally tested for resistance to phenol, bleach (sodium hypochlorite), and a quaternary ammonium salt disinfectant (Roccal-D [Upjohn]). To determine the level of resistance to these disinfectants, 50-µl amounts of the spores were added to 0.45 ml of 5% (wt/vol) phenol, bleach (1:32 dilution of bleach [5.25% sodium hypochlorite]), or 1:200 dilution of Roccal-D (stock was 20% alkyl dimethyl benzyl ammonium chloride) in 1.5-ml polypropylene microcentrifuge tubes. The samples were vortexed vigorously and kept at RT. After 10 min, aliquots were removed from each, serially diluted in PBS, and plated on BHIA plates for viable count determinations.

Analysis of glycoproteins by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Ten milligrams (wet weight) of wild-type or BclB-deficient B. anthracis spores were extracted either by boiling the spores in urea buffer (50 mM Tris-HCl, pH 10, 8 M urea, 2% 2-mercaptoethanol) or by boiling the spores in SDS sample buffer (50 mM Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, 2% ß-mercaptoethanol, 0.02% bromophenol blue) for 10 min. The extracted spores were centrifuged at 10,000 x g for 10 min at RT. The supernatant was removed and used to load individual lanes of a 4 to 20% gradient Tris-HCl protein gel (Bio-Rad) and electrophoresed in Tris-glycine-SDS buffer. Gels were stained with either the Gelcode Blue staining kit (Pierce, Rockford, IL) or Coomassie brilliant blue.

Western blot analyses. The bclA and bclB open reading frames were PCR amplified and cloned into the pQE30 plasmid (QIAGEN). His-tagged proteins were expressed in E. coli and purified using the His spin protein purification kit (Zymo Research). Anti-BclA and anti-BclB antisera were prepared in rabbits using Ribi adjuvant (Corixa). Western blots were conducted using goat anti-rabbit immunoglobulin G conjugated to alkaline phosphatase as the secondary antibody, and the immunoreactive proteins were identified using the AP Conjugate Substrate kit (Bio-Rad). Quantitative analyses of Western blot data were obtained using the Multi-Gauge analytical software (Fujifilm).

Epifluorescence microscopy. Five milligrams of spores (wet weight) were resuspended in StartingBlock (Pierce) and incubated at RT for 45 min with occasional mixing. The spores were then pelleted and resuspended in StartingBlock. Rabbit polyclonal antiserum (1:250 dilution) against BclA or BclB was added and incubated at RT for 45 min with occasional mixing. The spores were then washed three times in StartingBlock and incubated with fluorescein isothiocyanate (FITC)-protein A conjugate (Sigma Chemical Co.) and incubated for 45 min at RT with occasional mixing. The spores were washed three times with StartingBlock, resuspended in PBS, and examined by epifluorescence microscopy using a Nikon E600 microscope.

Scanning electron microscopy (SEM). B. anthracis spores were fixed overnight at 4°C in 20 volumes of modified Karnowsky's fixative (2% paraformaldehyde, 2.5% glutaraldehyde, 1.7 mM CaCl2 in 0.1 M cacodylate buffer [pH 7.4]). After the spores were fixed, they were washed twice in 0.1 M cacodylate buffer (pH 7.4) and postfixed in 1% osmium tetroxide in 0.1 M cacodylate buffer overnight at 4°C. The cells were washed twice in double-distilled water, they were resuspended in double-distilled water, mounted on coverslips coated with poly-L-lysine, and dehydrated in a series of alcohol solutions (25, 50, 70, 95, and 100%). Dehydrated samples were treated for 5 min with hexamethyldisilazane (Electron Microscopy Sciences, Fort Washington, PA), dried, mounted, and sputter coated with gold (S150A sputter coater). Samples were viewed in a Hitachi H-300 electron microscope with a 3010 scanning image accessory.

For immunogold labeling, spores were attached to coverslips coated with poly-L-lysine and allowed to adhere for 30 min. They were rinsed in PBS with 50 mM NH4Cl and then in a PBS blocking solution (1% bovine serum albumin [BSA] and 1% goat serum) for 5 min. Anti-BclA rabbit polyclonal antibodies were diluted in PBS blocking solution (1:50) and added to the coverslips for 30 min at RT. The coverslips were washed in PBS plus 0.1% BSA twice for 5 min each time. Fifteen-nanometer colloidal gold-conjugated goat anti-rabbit immunoglobulin G antibodies (Aurion) were diluted 1:20 in PBS plus 0.01% fish gelatin and applied to the spores for 30 min at RT. Three washes in PBS were performed, followed by fixation in 2% glutaraldehyde in PBS for 1 h. The coverslips were then washed twice in PBS buffer and three times in distilled water. The spores were then dehydrated and treated as described above except they were sputter coated with carbon.

TEM. To the buffer-washed spores, 1 ml of a 2% glutaraldehyde- 0.1 M sodium cacodylate solution containing 0.1% ruthenium red (Electron Microscopy Sciences, Fort Washington, PA) was added and incubated for 1 h at 37°C. Each pellet was then washed in cacodylate buffer and fixed for 3 h at RT in a 1% osmium tetroxide (Electron Microscopy Sciences)-0.1 M sodium cacodylate solution containing 0.1% ruthenium red. A negative control was treated identically, but ruthenium red was omitted from these two steps. Spores were washed in buffer and embedded in 3% agar (EM Science, Gibbstown, NJ). Dehydration involved sequential treatment with 25, 50, 75, 95, and 100% acetone. Polymerization was carried out at 60°C in Epon/araldite resin. Sections were cut at 85-nm thickness and put on 200-mesh carbon-coated copper grids and then stained with a 2% uranyl acetate solution (Electron Microscopy Sciences) for 40 min at 37°C. The sections were then treated with Sato's triple lead for 3 min, washed in ultrapure water, and stained again for 18 min in 5% uranyl acetate, followed by one final wash and were observed by transmission electron microscopy (TEM) with a JEOL 1200EX electron microscope.

Immunogold labeling of embedded spores was performed after fixation of spores in a 2% glutaraldehyde and 2% formaldehyde PBS solution. After dehydration and embedding as described above, the cut grid sections were blocked in a 1% BSA solution for 30 min. The grids were washed three times in PBS, and the primary antibodies were added to the grids at a concentration of 1:25 in incubation buffer (Aurion). One hour later, the grids were washed six times in incubation buffer and incubated with 1:25 goat anti-rabbit secondary conjugate with 15-nm colloidal gold and allowed to bind for 2 hours. After a series of washes in PBS, the grids were postfixed in 2% glutaraldehyde on 0.1 M PBS for 5 min and finished with washes in PBS and distilled water.

Macrophage infection assays. A total of 105 to 106 RAW 264.7 macrophages was dispensed into 24-well tissue culture plates (Falcon) and incubated overnight in Dulbecco's modified Eagle medium (DMEM) with glucose plus 10% heat-inactivated (65°C for 1 h) fetal bovine serum (FBS). Endospores were diluted in DMEM with 10% FBS and then immediately added to wells at a multiplicity of infection of 1:1 or 10:1 spores:macrophages. To maximize the number of endospores interacting with macrophages, the plate was centrifuged at 1,000 rpm for 5 min in a Sorvall 6000D tabletop centrifuge (Sorvall Instruments) equipped with a Sorvall H100B rotor that was prewarmed to 37°C. After centrifugation, the plates were incubated for an additional 30 min at 37°C in an H2O-saturated atmosphere with 5% CO2 to allow for germination and outgrowth of endospores. The culture medium was aspirated from each well, the macrophages were washed, the medium was replaced with fresh medium supplemented with 50 µg/ml gentamicin and incubated for 30 min at 37°C to eliminate any unphagocytosed germinated endospores and extracellular vegetative cells. The medium was removed, and the cells were washed twice with fresh antibiotic-free DMEM and resuspended in fresh prewarmed medium. Intracellular bacterial numbers were then quantified by dilution plating after macrophages from triplicate wells were lysed with distilled water (lysis was observed by light microscopy). The bacteria were serially diluted in PBS and plated on BHIA plates directly (total viable counts) or after heating for 30 min at 65°C (ungerminated spore counts).

Spore analysis by flow cytometry. Spores were reacted with antibody and labeled with FITC-protein A conjugate as described above for epifluorescence microscopy. The spores were washed three times with StartingBlock and two times with PBS and processed on a FACScan flow cytometer using a 488-nm argon laser (Becton Dickinson Biosciences). Data were analyzed using Cell Quest analysis software (Becton Dickinson). For the ethanol-treated spores, the spores were resuspended in 50% ethanol for 10 min, pelleted, resuspended in StartingBlock, and then exposed to antiserum and FITC-protein A conjugate as described above.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Electron microscopic examination of the spores lacking the BclB glycoprotein. A precise deletion of the bclB determinant was introduced into B. anthracis {Delta}Sterne-1 to create strain MUS1692. The bclB-inactivated strain sporulated with kinetics and efficiencies comparable to those of the wild-type parental strain (data not shown). The morphology of the mutant spores was evaluated by TEM. TEM revealed that the {Delta}bclB spores comprised a mixed population of spores. Many of the spores were morphologically identical to the parental strain spores (Fig. 1A). However, spores with damaged exosporia are evident. The majority of these have ruptures of the exosporium layer, usually at one pole of the elliptical spore (Fig. 1B, C, and F). In addition, empty exosporia are evident in the mutant spore preparation (Fig. 1B, D, and E) but are not present in the spores prepared from the wild-type parental strain. A large amount of debris that visually resembles exosporium material is abundant in spore preparations from the mutant strain, but not from the wild-type parent. Ruthenium red staining of the spores, which allows visualization of the glycoprotein outer nap layer of the exosporium (45), revealed that the surface glycoprotein, thought to be predominantly BclA (42), is present in both the mutant and wild-type spores. This dye also stained the debris material, supporting the idea that this material was shed exosporia.


Figure 1
View larger version (171K):
[in this window]
[in a new window]

 
FIG. 1. Transmission electron micrographs of spores from the {Delta}Sterne strain (A) (magnification, 20,000 diameters) and the bclB-negative strain (B to F). In panel B (magnification, x15,000), defects typical of a BclB-negative phenotype are illustrated, including an exosporium-less spore (asterisk), ruptured exosporium (arrowhead), and empty exosporium (arrow). Panel C (magnification, x20,000) shows damaged exosporia, and panels D (magnification, x30,000) and E (magnification, x12,000) show empty exosporia. Panel F is a higher-magnification view (magnification, x60,000) of a spore displaying typical damage to the exosporium which appears to be sloughing off the spore (arrowhead). Panels G to I depict immunogold labeling of the spores. The arrows point to some representative 15-nm gold particles. Panel G (magnification, x65,000) illustrates {Delta}Sterne spores immunolabeled with anti-BclB antibodies. Use of a control antisera is shown in panel H (magnification, x65,000), with the nonspecific antibody binding to the spore core. Panel I (magnification, x50,000) shows the bclB-negative spores labeled with anti-BclA antibodies. {Delta}Sterne spores labeled with anti-BclA appeared identical to the bclB-negative spores (data not shown).

 
Over two hundred spores from the {Delta}Sterne-1 and MUS1692 strains were examined from electron micrographs, and the numbers of spores with an intact exosporium were calculated (Table 1). In a typical spore preparation, 95% of the wild-type spores appeared to have normal architecture, whereas only 60% of the BclB-negative spores had normal architecture. The remainder of the BclB-negative spores displayed a damaged exosporium. The defect was either minor, with the damage usually at one pole of the spore, or severe with the spore either devoid or largely devoid of an exosporium layer. In addition, free exosporia are evident in the spore fields from the bclB mutant but are not observed in spore preparations from the wild-type spores. It appears that a consequence of a lack of BclB production is the assembly of spores with a more fragile exosporium layer.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Distribution of spore ultrastructural types identified by electron microscopya

 
To determine the distribution of the BclB protein in the spore, immunogold labeling of the TEM samples was performed using goat anti-rabbit antibodies labeled with 15-nm colloidal gold particles. Anti-BclB antibodies bound to the exosporium (average of seven particles/spore exosporium) and to the spore coat and spore cytoplasm (Fig. 1G, average of 20 particles/spore core and cortex). Further analysis of the controls, where preimmune sera (Fig. 1H) or sera raised to a nonbacillus immunogen was used (data not shown), showed a low level of nonspecific binding in the cytoplasm and spore coat. Nonspecific binding was consistently found but was always localized to the spore core and inner spore coat layers and was not seen in the exosporium (average of 10 particles/spore core and cortex; average of 0 particles/spore exosporium). Similar findings were reported with rabbit polyclonal antiserum raised against the Cot{alpha} protein where apparent antigen-independent immunogold labeling over the spore cytoplasm was also observed (28). The results support the observation that the immunogold labeling of the exosporium is specifically showing binding to the BclB protein. The presence of an increased amount of immunogold label in the coat and core of the wild-type spores compared to the spores treated with control sera may suggest the presence of BclB in those parts of the spore as well, and not just the exosporium.

To further characterize the exosporium of the bclB mutant spores and also to determine whether the debris present in the BclB-negative spore samples was exosporium, immunogold labeling was performed with polyclonal anti-BclA sera. In both the {Delta}Sterne spores and the BclB-negative spores, significant binding of the immunogold particles was found in the nap layer of the exosporium of the spores (Fig. 1I and data not shown). In both strains stained with anti-BclA and anti-BclB antibodies, an increase in the labeling of the spore coat and cytoplasm was seen compared to the controls (average of 26 particles/spore exosporium; average of 18 particles/spore core and cortex). Although other studies have not shown the presence of BclA in the spore coat and cytoplasm (6, 39), the use of a polyclonal antiserum (instead of monoclonal antibodies used in other studies) may explain the differences seen in these micrographs, as more epitopes can be recognized by the multivalent sera. In addition, the ruthenium red-stained exosporium-like debris found in the bclB mutant also reacted with the anti-BclA antibodies, further suggesting that the debris is shed exosporia (data not shown).

Changes in the outer surfaces of the BclB-negative spores were confirmed by SEM (Fig. 2). The majority of spores from the {Delta}Sterne strain (Fig. 2A) exhibited a smooth raisin-like surface with characteristic ridges similar to those observed by atomic force microscopy (10, 48). Many of the bclB-negative spores displayed a rougher, dimpled appearance (Fig. 2B). A subpopulation of the BclB-negative spores contained ridges and had a distinctly wild-type appearance. This rougher appearance could represent the changed appearance of the disorganized exosporium layer itself in the bclB mutant, or alternatively, it may signify a disruption of the exosporium layer and visualization of the underlying spore coat layers. The sloughed-off material in the bclB mutant may well be exosporium (Fig. 2C). The presence of ridges on the spores was reported to signify the lack of an exosporium (10). To determine whether the exosporium was still present in the bclB-negative mutant spores, immunogold labeling of the spores using rabbit anti-BclA polyclonal sera was used. Since the BclA protein is surface exposed in the exosporium layer, loss of the exosporium would eliminate binding of the anti-BclA antibodies. Immunolabeling demonstrated that the bclB-negative spores, despite their changed appearance, retained the exosporium as shown by the presence of surface-exposed BclA (Fig. 2D and E). There was a greater amount of debris associated with the mutant spores than was seen with the wild-type spores, presumably shed exosporium fragments. To further validate the presence of BclB in the exosporium of spores as was observed by TEM, immunolabeling of wild-type spores for visualization by SEM was accomplished using anti-BclB sera. The presence of immunogold label on the spore surface further supported BclB being present in the exosporium (Fig. 2F). However, BclB was labeled at a reduced level compared to BclA.


Figure 2
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 2. Scanning electron micrographs of the spores from {Delta}Sterne (A) and BclB-deficient spores (B to F). The appearance of material sloughing off mutant spores is marked in panel C by the white arrows. Immunogold labeling of BclB-negative spores with anti-BclA antiserum (E) with the white arrows denoting some of the sites where 15-nm gold beads are evident. The black arrow in panel E points to gold bead labeling localized to sloughed-off exosporium. Panel D is the same image as panel E without the backscatter overlay showing the gold beads. Panel F depicts {Delta}Sterne spores labeled with anti-BclB antibodies. Arrows denote some of the sites of surface-bound antibodies. Bars, 1 µm.

 
Resistance properties of the mutant spores. The BclB-deficient spores were compared to the wild-type spores for resistance to heat (65°C), UV irradiation (700 ergs/mm2), organic solvents (chloroform and 5% phenol), and disinfectants (bleach [1:32 dilution] and 95% ethanol). No significant differences were observed in the resistance properties of the mutant versus wild-type spores, consistent with the resistance properties of the spores being associated with the spore coat layer and the small, acid-soluble spore proteins (36), and the exosporium layer not substantially contributing to these resistance properties.

Western blot analysis of the mutant and wild-type spores. Two chemical methods have been described for extracting exosporium proteins from intact spores of B. anthracis. The simplest method is to boil the spores in SDS-PAGE buffer. The second method involves extraction of the spores with 8 M urea buffer. Although both methods have been shown to be efficient at extracting BclA from the spores, we found that only the urea extraction reliably yielded the BclB protein from the wild-type spores (Fig. 3A, lane 3), while the SDS treatment resulted in lower recovery rates of BclB (data not shown). The BclB-reactive species were absent when the extracts were made from spores of strain MUS1692 (Fig. 3A, lane 2), confirming the identity of the immunoreactive species in the {Delta}Sterne spores as BclB. The Western blot results further suggest that the BclB protein is present in the exosporium or on the surface of the spore coat in spores of B. anthracis but in a configuration that is less extractable from the spore then by simple SDS treatment. The BclB protein extracted from spores migrates on SDS-polyacrylamide gels as a high-molecular-weight species. High-molecular-weight heteromers have been observed in spore extracts of B. anthracis and have been shown to consist of many exosporium-associated proteins that interact with BclA, BxpB, and ExsF (6, 38, 41). The migration properties of BclB suggest that this protein may be part of similar complexes. When anti-BclA antiserum was utilized to probe the spore lysates, the amount of BclA present in extracts from the bclB mutant spores was consistently greater (average of 2.3-fold ± 0.8-fold, based on six independent experiments) than the reactive material extracted from the wild-type spores.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 3. (A) Western blot of spore extracts using rabbit anti-BclB polyclonal antiserum. Samples of protein size standard markers (lane 1), urea extract from strain MUS1692 (lane 2), and urea extract from strain {Delta}Sterne (lane 3) were used. (B) Western blot of spore extracts using rabbit anti-BclA polyclonal antiserum. Samples of protein size standard markers (lane 1), SDS spore extract from strain MUS1692 (lane 2), and SDS spore extract from strain {Delta}Sterne (lane 3) were used.

 
The BclB protein is exposed on the exosporium surface of B. anthracis spores. Anti-BclA and anti-BclB antibodies were utilized to determine whether the BclB protein is expressed on the surfaces of unfixed spores. Spores were incubated with anti-BclA or anti-BclB antiserum followed by incubation with FITC-labeled protein A. The spores were then extensively washed and examined by epifluorescence microscopy. Results are shown in Fig. 4. Anti-BclA antibodies reacted strongly with the surfaces of the {Delta}Sterne and BclB-negative spores, consistent with the known surface location of this glycoprotein (Fig. 4D and F). The anti-BclA sera did not react with the BclA deletion strain CTL292 (Fig. 4E). A fainter, but reproducible, signal was evident when anti-BclB antiserum was incubated with wild-type spores (Fig. 4G) but not with the bclB mutant spores (Fig. 4I). This suggests that the BclB protein is, at least in part, surface exposed in the spores of B. anthracis.


Figure 4
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 4. BclB is surface exposed in B. anthracis. Purified spores were treated with anti-BclA antiserum (D to F, M, and N) or anti-BclB antiserum (G to I) and then with FITC-protein A conjugate. Phase-contrast images are shown adjacent to the fluorescence images (A to C and J to L). Panels M and N are merged anti-BclA fluorescence and phase-contrast images to more clearly show the loss of fluorescence at one pole of certain spores. Spores were from the {Delta}Sterne strain (A, D, G, and J), the bclA mutant strain CTL292 (B, E, H, and K), or the bclB mutant strain MUS1692 (C, F, I, L, M, and N). Image magnifications are x1,000. White arrowheads denote an increased concentration of the BclB protein at the pole of the spore. White arrows denote spores missing BclA or exosporium at the cap or pole.

 
Anti-BclA antibodies react strongly to the surfaces of both the wild-type and bclB mutant spores (Fig. 4D and F). Some spores in each population react strongly in this assay, whereas others display a uniform, but less intense, staining pattern. This pattern was consistently observed with antibodies in excess, suggesting saturation of antibody binding sites on the spores was not responsible for the staining differences observed. Because anti-BclA antiserum was raised against recombinant BclA, the antibodies do not recognize the carbohydrate moieties of the glycoprotein. Thus, differences in glycosylation may explain the staining differences observed with individual spores. The Western blot results described above consistently indicated that the bclB mutant spores contained either more BclA or a more easily extracted BclA configuration than did spores of the wild-type strain (Fig. 3).

If BclB were present in the basal layer of the exosporium, binding of the anti-BclB antibodies could be hindered by the presence of the hair-like nap blocking access to the BclB epitopes. When the basal layer protein BxpB (16) was identified, binding of the anti-BxpB antibodies was greatly increased when a bclA mutant strain was used. We used the BclA-deficient strain CLT292 to examine binding of anti-BclB antibodies (Fig. 4H). When the CTL292 spores were analyzed for the presence of BclB, a minor increase was seen in the binding of anti-BclB antibodies. More notably, the anti-BclB antibodies concentrated at a point at the pole of the spore (Fig. 4H). This polar concentration was not evident with the {Delta}Sterne spores (Fig. 4G).

In agreement with the findings of the bclB mutant by TEM and SEM, there was evidence of damage to the exosporium layer of the mutant when examined by immunofluorescence (Fig. 4M and N). When the BclB-deficient spores were treated with anti-BclA antiserum, approximately 30 to 40% of the spores exhibited a lack of BclA-staining at one pole. This lack of BclA at one pole was most likely due to the damage of the exosporium layer at the pole, as we observed by TEM. These spores appear to be devoid of the exosporium polar cap. There was also evidence of the exosporium being sloughed off and some spores devoid of staining altogether (Fig. 4M and N and data not shown).

The fluorescence micrographs provided only a qualitative assessment of surface exposure of the BclA and BclB proteins. For a quantitative determination of BclA and BclB protein exposure on the spore surface, spores were subjected to analysis by flow cytometry utilizing the anti-BclA and anti-BclB antisera. The results of these analyses are shown in Fig. 5. The results further demonstrated that BclB is surface exposed in the {Delta}Sterne spores and is absent in the spores prepared from the bclB deletion strain (Fig. 5A and B). Furthermore, the flow cytometry analysis indicated that the level of BclA detectable on the surfaces of the bclB mutant spores was increased relative to that of the wild-type spores, consistent with the Western blot results (Fig. 5C and D). The mean fluorescence intensity for the spore samples with anti-BclA antibodies was higher with the BclB-deficient spores (mean fluorescence intensity of 187 ± 14.3 versus 106 ± 11.2). The amount of BclB exposed on the surfaces of the spores was substantially less than that of BclA, with a mean fluorescence intensity of 42 ± 7.2. Loss of the BclB glycoprotein and its associated sugars from the exosporium may have resulted in a compensatory increase in the presence of the BclA glycoprotein or in a change in the structure of the exosporium which allows greater access of the BclA epitopes to the anti-BclA antibodies.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 5. Flow cytometry histograms. Paraformaldehyde-fixed spores stained with polyclonal rabbit antibodies and analyzed by flow cytometry. In all figures, the gray curve represents a spore control that was treated without the primary antibody. The percent positive is marked for each sample, as well as the mean fluorescence intensity of all positive samples (signified by PMF). (A) The black line represents a spore control treated without the FITC-protein A conjugate. The green line represents the BclB-negative mutant treated with anti-BclB antiserum. N/A, not available. (B) The purple line represents {Delta}Sterne spores treated with anti-BclB antiserum. (C) The green line represents the BclB-negative mutant with anti-BclA antiserum. (D) The purple line represents {Delta}Sterne spores treated with anti-BclA antiserum. (E) The green line represents the BclB-negative mutant spores treated with anti-BclA antiserum after dehydration in 50% ethanol and rehydration. (F) The purple line represents {Delta}Sterne spores treated with anti-BclA antiserum after dehydration in 50% ethanol and rehydration.

 
A brief 10-min exposure of spores from the bclB-deficient mutant to 50% ethanol followed by rehydration in PBS resulted in a shift in the staining with the anti-BclA antibodies (Fig. 5E), whereas this treatment had a negligible effect on the wild-type spores (Fig. 5F). The treatment of the mutant spores resulted in a small subpopulation of the spores showing increased fluorescence and a dramatic increase in the amount of material smaller in size than intact spores. This BclA-reactive material appeared in a small-size fraction, presumably representing free exosporium that had been stripped off of the mutant spores (lower left quadrant of Fig. 5E). Either the stress associated with the dehydration-rehydration cycle or an effect of the solvent on the altered exosporium of the BclB-negative spores resulted in the physical removal of the exosporium material and its BclA nap from the spores.

The alcohol treatment may likely have accounted for the more dramatic change in appearance in the BclB-negative spores examined by SEM. A series of alcohol dehydration steps were involved in preparing the spores for SEM.

Spore-macrophage interactions. The presence of the exosporium on the outermost part of the spore leads it to potentially play a role in the initial interactions with the host, including phagocytosis by host macrophages, as well as outgrowth and escape from the phagosomes (13, 22). The structural changes of the exosporium in the bclB mutant and the loss of this spore-associated glycoprotein may result in a change in the kinetics of survival of the mutated spores in macrophages. To assay uptake and infectivity of the bclB mutant spores versus {Delta}Sterne spores in vitro, RAW 264.7 murine macrophages were infected at multiplicity of infections of 10:1 and 1:1 (spores to macrophage) and treated with gentamicin to kill off any free vegetative cells, and samples were taken at timed intervals and plated for viable and heat-resistant colony (ungerminated spore) counts. Greater than 99% of all spores added to the tissue culture medium were susceptible to heat at 1 h, indicating that germination efficiently occurred in this FBS-containing environment (data not shown). At the first assayed time point of 1 h in the macrophage assays, no significant difference was found between uptake efficiencies of the BclB-negative mutant spores versus {Delta}Sterne spores. Examination of viable CFU at 1, 2, 4, and 24 h revealed no difference in viable counts between bclB mutant and {Delta}Sterne spores. A representative experiment is shown in Fig. 6. Both strains were killed off with equal efficiency, with essentially no viable cells remaining at 24 h.


Figure 6
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 6. Plate counts of lysates of RAW cells infected with spores of the {Delta}Sterne strain ({blacklozenge}) or the bclB mutant spores (•). Values are expressed relative to the initial time point (1 h after infection). Typical results of a 1:1 experiment are shown. Ratios of 1:1 and 10:1 (spores:macrophages) were utilized with the same results.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Much of what we know about spore maturation was learned from studies with Bacillus subtilis and its well-defined genetic systems. However, B. subtilis does not possess a distinct exosporium layer or BclA- or BclB-like proteins. Thus, no information is available from the B. subtilis literature to extrapolate to the assembly of this outermost spore layer in B. anthracis. The exosporium is a prominent spore feature of organisms of the B. cereus family, a group comprised of animal and insect pathogens. Therefore, the exosporium layer may be important for spore interactions with host cells.

BclB has many similarities to the well-characterized exosporium glycoprotein BclA. Like BclA, it also contains an internal collagen-like tandem repeat (GITGVTGAT). As in BclA, the repeated threonines in the BclB repeat are the likely sites of glycosylation, and the BclB-associated sugars rhamnose, 3-O-methyl rhamnose, and galactosamine have been identified. Recent microarray data showed that both bclA and bclB are transcribed simultaneously during sporulation (5). The bclA and bclB determinants are both preceded by {sigma}K-like promoter sequences, and expression of these genes initiates late in sporulation (5). Both glycoprotein determinants are expressed in conjunction with the rhamnose determinants in the operon adjacent to bclA, also containing a {sigma}K-like promoter element. This expression pattern is consistent with expression from promoters regulated by this late mother cell-specific sigma factor and is consistent with the placement of BclB in the outer spore layers.

By SEM, the bclB mutant appears to have a more dimpled appearance, with a decrease in the presence of the pronounced ridges found in the wild-type spores. Chada and coworkers utilized atomic force microscopy to characterize spore surfaces and suggested that the presence of ridges in spores signifies the loss of the exosporium layer (10). By using anti-BclA sera, our immunogold-labeled spores appeared to be encased within an exosporium as evidenced by the presence of the surface-exposed BclA. The presence of the BclA-containing exosporium was independent of the appearance of the ridges on the spore surface. Loss of the BclB protein has an impact on both the integrity and stability of the exosporium, as well as modifying the appearance of the exosporium by SEM.

Examination of material extracted from spores further supports our conclusion that BclB is associated with the exosporium. Other exosporium-associated proteins when extracted and subjected to SDS-PAGE analysis have been found to comigrate with BclA in a heterogenous band of >200 kDa. The presence of BclB migrating in similarly sized complexes further suggests its association in similar complexes. The decreased yield of BclB from spores suggests that it is present at a lower concentration than BclA or is more securely anchored than BclA.

We have found that BclB is surface exposed on the spores of B. anthracis. By immunofluorescence we have shown a consistent binding of our anti-BclB antibodies to the surfaces of spores. The intensity of the binding is less than that observed with anti-BclA antibodies. The heterogeneity of the fluorescence of the spores with anti-BclA antibodies could be explained by the differing accessibilities of the antibodies to the protein backbone epitopes of BclA due to the differing glycosylation patterns or may support a nonuniform assembly of the exosporium as recently reported (40).

The length of the surface filaments on the exosporium surface correlates with BclA repeat number and bclA-negative spores possess no visible hair-like nap layer, indicating that the nap is largely composed of this protein (38, 41). Immunofluorescence studies reported herein indicate that the BclB glycoprotein is also surface exposed on the spore and plays a role in the structural integrity of the exosporium layer as indicated by the increased fragility of this layer in spores lacking this protein. The fact that the bclA mutant spores are devoid of a noticeable nap does not rule out the possible presence of BclB in the nap. The lower content of BclB expressed on the exosporium may not produce visible filaments without the presence of BclA. Loss of BclB and its associated sugars could leave architectural voids within the exosporium nap layer that are selectively filled with BclA and may lead to an increase in BclA incorporation and the relative increase in BclA as seen on Western blots and immunofluorescence. Alternatively, loss of BclB could also open up gaps in the nap that better allow antibodies access to BclA epitopes or could orient the BclA protein in a way that can be more easily extracted from the exosporium.

The loss of the BclB glycoprotein from the exosporium and possibly from other sites within mutant spores leads to a more fragile exosporium layer. Examination of the BclB-negative spores by TEM and by immunofluorescence demonstrated that often this fragility is at one pole of the spore. BclB was found to localize in greater amounts at one pole of the cells in the CTL292 bclA deletion strain, suggesting that BclB accumulates at the pole of the spore or potentially in the cap structure described by Boydston et al. and Steichen et al. (6, 40). If the BclB protein has a structural role at the pole of the exosporium, lack of BclB at this site may lead to the polar damage seen in the TEM and immunofluorescence micrographs. Stress of the exosporium may lead to breakage at the pole. The exosporium cap has been reported to be a weakened spot in the exosporium where newly germinated cells emerge (40). BclB may play a role in strengthening or anchoring the cap, and lack of BclB could lead to a weaker cap that pops off more easily. When BclB-negative spores were stained with anti-BclA sera, many of the spores exhibited no staining at one pole. We interpreted this as a lack of exosporium at the pole and not a lack of antibody staining, consistent with the damage seen in the TEM micrographs. The percentage of spores with damage seen by TEM is roughly equal to the percentage of mutant spores seen by immunofluorescence without polar staining or a cap. Without the exosporium at the cap or pole, the exosporia may slough off, as is evident by TEM. These sloughed-off exosporia may be more susceptible to extraction, leading to the increased amount of BclA found in the BclB-negative spores by Western blotting.

The effects of ethanol exposure and presumably the dehydration/rehydration process may underscore the significant role of BclB in the architecture of the exosporium. Since BclB may play also play a role in the flexibility of the exosporium, the {Delta}bclB mutant may lose this flexibility causing increased breakage of the exosporium when stressed by the dehydration/rehydration of the spore.

BclB plays a role in the structural integrity of the exosporium. The influence of BclB on the incorporation of the BclA protein and on the overall architecture of the spore, directly or indirectly, is one of the keys in the formation or maintenance of a rigid and complete exosporium structure in B. anthracis.


    ACKNOWLEDGMENTS
 
The work was supported by an NIH grant AI05943 awarded to G. C. Stewart and A. Fox. Lashanda Waller was supported by an NIH minority supplement.

We thank Bob Price and Jeff Davis (USC School of Medicine Instrumentation Facility), Randy Tindall (University of Missouri EM Core Facility) for aid in the electron microscopic imaging, C. L. Turnbough (University of Alabama—Birmingham) for the CTL292 strain, T. M. Koehler (University of Texas—Houston Health Science Center) for plasmid pUTE583, Dan Hassett (University of Missouri) for help with the flow cytometry, Chris Lorson (University of Missouri) for help with the fluorescence microscopy, and Bob Livingston (University of Missouri) for the RAW 264.7 cells.


    FOOTNOTES
 
* Corresponding author. Mailing address: 471E Bond Life Sciences Center, 1201 Rollins Road, University of Missouri, Columbia, MO 65211. Phone: (573) 884-2866. Fax: (573) 884-9395. E-mail: stewartgc{at}missouri.edu Back

{triangledown} Published ahead of print on 20 July 2007. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bailey-Smith, K., S. J. Todd, T. W. Southworth, J. Proctor, and A. Moir. 2005. The ExsA protein of Bacillus cereus is required for assembly of coat and exosporium onto the spore surface. J. Bacteriol. 187:3800-3806.[Abstract/Free Full Text]
  2. Baillie, L., S. Hibbs, P. Tsai, G. L. Cao, and G. M. Rosen. 2005. Role of superoxide in the germination of Bacillus anthracis endospores. FEMS Microbiol. Lett. 245:33-38.[CrossRef][Medline]
  3. Basu, S., T. Kang, W. Chen, M. Fenton, L. Baillie, S. Hibbs, and A. Cross. 2007. Bacillus anthracis spore structures in macrophage cytokine responses. Infect. Immun. 75:2351-2358.[Abstract/Free Full Text]
  4. Beaman, T. C., H. S. Pankratz, and P. Gerhardt. 1971. Paracrystalline sheets reaggregated from solubilized exosporium of Bacillus cereus. J. Bacteriol. 107:320-324.[Abstract/Free Full Text]
  5. Bergman, N. H., E. C. Anderson, E. E. Swenson, M. M. Niemeyer, A. D. Miyoshi, and P. C. Hanna. 2006. Transcriptional profiling of the Bacillus anthracis life cycle in vitro and an implied model for regulation of spore formation. J. Bacteriol. 188:6092-6100.[Abstract/Free Full Text]
  6. Boydston, J. A., P. Chen, C. T. Steichen, and C. T. Turnbough, Jr. 2005. Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. J. Bacteriol. 187:5310-5317.[Abstract/Free Full Text]
  7. Boydston, J. A., L. Yue, J. F. Kearney, and C. L. Turnbough, Jr. 2006. The ExsY protein is required for complete formation of the exosporium of Bacillus anthracis. J. Bacteriol. 188:7440-7448.[Abstract/Free Full Text]
  8. Bozue, J. A., N. Parthasarathy, L. R. Phillips, C. K. Cote, P. F. Fellows, I. Mendelson, A. Shafferman, and A. M. Friedlander. 2005. Construction of a rhamnose mutation in Bacillus anthracis affects adherence to macrophages but not virulence in guinea pigs. Microb. Pathog. 38:1-12.[CrossRef][Medline]
  9. Brossier, F., M. Levy, and M. Mock. 2002. Anthrax spores make an essential contribution to vaccine efficacy. Infect. Immun. 70:661-664.[Abstract/Free Full Text]
  10. Chada, V. G. R., E. A. Sanstad, R. Wang, and A. Dirks. 2003. Morphogenesis of Bacillus spore surfaces. J. Bacteriol. 185:6255-6261.[Abstract/Free Full Text]
  11. Charlton, S., A. J. Moir, L. Baillie, and A. Moir. 1999. Characterization of the exosporium of Bacillus cereus. J. Appl. Microbiol. 87:241-245.[CrossRef][Medline]
  12. Chen, Y., F. C. Tenover, and T. M. Koehler. 2004. ß-Lactamase gene expression in a penicillin-resistant Bacillus anthracis strain. Antimicrob. Agents Chemother. 48:4873-4877.[Abstract/Free Full Text]
  13. Daubenspeck, J. M., H. Zeng, P. Chen, S. Dong, C. T. Steichen, N. R. Krishna, D. G. Pritchard, and C. L. Turnbough. 2004. Novel oligosaccharide side-chains of the collagen-like region of BclA, the major glycoprotein of Bacillus anthracis. J. Biol. Chem. 279:30945-30953.[Abstract/Free Full Text]
  14. Reference deleted.
  15. Fox, A., G. Black, K. Fox, and S. Rostovtseva. 1993. Determination of carbohydrate profiles of Bacillus anthracis and Bacillus cereus including identification of O-methyl methylpentoses using gas chromatography-mass spectrometry. J. Clin. Microbiol. 31:887-894.[Abstract/Free Full Text]
  16. Fox, A., G. C. Stewart, L. N. Waller, K. F. Fox, W. M. Harley, and R. L. Price. 2003. Carbohydrates and glycoproteins of Bacillus anthracis and related bacteria. J. Microbiol. Methods 54:143-152.[CrossRef][Medline]
  17. Reference deleted.
  18. Gerhardt, P. 1967. Cytology of Bacillus anthracis. Fed. Proc. 26:1504-1517.[Medline]
  19. Gerhardt, P., and S. H. Black. 1961. Permeability of bacterial spores. II. Molecular variables affecting solute permeation. J. Bacteriol. 82:750-760.[Abstract/Free Full Text]
  20. Gerhardt, P., and E. Ribi. 1964. Ultrastructure of the exosporium enveloping spores of Bacillus cereus. J. Bacteriol. 88:1774-1789.[Abstract/Free Full Text]
  21. Giorno, R., J. Bozue, C. Cote, T. Wenzel, K.-S. Moody, M. Mallozzi, M. Ryan, R. Wang, R. Zielke, J. R. Maddock, A. Friedlander, S. Welkos, and A. Driks. 2007. Morphogenesis of the Bacillus anthracis spore. J. Bacteriol. 189:691-705.[Abstract/Free Full Text]
  22. Green, B. D., L. Battisti, T. M. Koehler, C. B. Thorne, and B. E. Ivins. 1985. Demonstration of a capsule plasmid in Bacillus anthracis. Infect. Immun. 49:291-297.[Abstract/Free Full Text]
  23. Reference deleted.
  24. Hachisuka, Y., K. Kojima, and T. Sato. 1966. Fine filaments on the outside of the exosporium of Bacillus anthracis spores. J. Bacteriol. 91:2382-2384.[Free Full Text]
  25. Hanna, P. 1998. Anthrax pathogenesis and host response. Curr. Top. Microbiol. Immunol. 225:13-35.[Medline]
  26. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlapping extension using the polymerase chain reaction. Gene 77:51-59.[CrossRef][Medline]
  27. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68.[CrossRef][Medline]
  28. Kim, H.-S., D. Sherman, F. Johnson, and A. I. Aronson. 2004. Characterization of a major Bacillus anthracis spore coat protein and its role in spore inactivation. J. Bacteriol. 186:2413-2417.[Abstract/Free Full Text]
  29. Kramer, M. J., and I. L. Roth. 1968. Ultrastructural differences in the exosporium of the Sterne and Vollum strains of Bacillus anthracis. Can. J. Microbiol. 14:1297-1299.[Medline]
  30. Lai, E. M., N. D. Phadke, M. T. Kachman, R. Giorno, S. Vazquez, J. A. Vazquez, J. R. Maddock, and A. Driks. 2003. Proteomic analysis of the spore coats of Bacillus subtilis and Bacillus anthracis. J. Bacteriol. 185:1443-1454.[Abstract/Free Full Text]
  31. Matz, L. L., T. Cabrera Beaman, and P. Gerhardt. 1970. Chemical composition of exosporium from spores of Bacillus cereus. J. Bacteriol. 101:196-201.[Abstract/Free Full Text]
  32. Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination, and outgrowth, p. 391-450. In C. R. Harwood and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley & Sons, Chichester, United Kingdom.
  33. Perez-Casal, J., M. G. Caparon, and J. R. Scott. 1991. Mry, a trans-acting positive regulator of the M protein gene of Streptococcus pyogenes with similarity to the receptor proteins of two-component regulatory systems. J. Bacteriol. 173:2617-2624.[Abstract/Free Full Text]
  34. Raines, K. W., T. J. Kang, S. Hibbs, G. L. Cao, J. Weaver, P. Tsai, L Baillie, A. S. Cross, and G. M. Rosen. 2006. Importance of nitric oxide synthase in the control of infection by Bacillus anthracis. Infect. Immun. 74:2268-2276.[Abstract/Free Full Text]
  35. Redmond, C., L. W. Baillie, S. Hibbs, A. J. Moir, and A. Moir. 2004. Identification of proteins in the exosporium of Bacillus anthracis. Microbiology 150:355-363.[Abstract/Free Full Text]
  36. Riesenman, P. J., and W. L. Nicholson. 2000. Role of the spore coat layers in Bacillus subtilis spore resistance to hydrogen peroxide, artificial UV-C, UV-B, and solar UV radiation. Appl. Environ. Microbiol. 66:620-626.[Abstract/Free Full Text]
  37. Saile, E., and T. M. Koehler. 2002. Control of anthrax toxin gene expression by the transition state regulator abrB. J. Bacteriol. 184:370-380.[Abstract/Free Full Text]
  38. Steichen, C., P. Chen, J. F. Kearney, and C. L. Turnbough, Jr. 2003. Identification of the immunodominant protein and other proteins of the Bacillus anthracis exosporium. J. Bacteriol. 185:1903-1910.[Abstract/Free Full Text]
  39. Steichen, C., J. F. Kearney, and C. L. Turnbough, Jr. 2005. Characterization of the exosporium basal layer protein BxpB of Bacillus anthracis. J. Bacteriol. 187:5868-5876.[Abstract/Free Full Text]
  40. Steichen, C., J. F. Kearney, and C. L. Turnbough, Jr. 2007. Non-uniform assembly of the Bacillus anthracis exosporium and a bottle cap model for spore germination and outgrowth. Mol. Microbiol. 64:359-367.[CrossRef][Medline]
  41. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2002. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol. Microbiol. 45:169-178.[CrossRef][Medline]
  42. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2003. Polymorphism in the collagen-like region of the Bacillus anthracis BclA protein leads to variation in exosporium filament length. J. Bacteriol. 185:1555-1563.[Abstract/Free Full Text]
  43. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2005. Contribution of ExsFA and ExsFB proteins to the localization of BclA on the spore surface and to the stability of the Bacillus anthracis exosporium. J. Bacteriol. 187:5122-5128.[Abstract/Free Full Text]
  44. Todd, S. J., A. J. Moir, M. J. Johnson, and A. Moir. 2003. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. J. Bacteriol. 185:3373-3378.[Abstract/Free Full Text]
  45. Waller, L., K. F. Fox, A. Fox, and R. L. Price. 2004. Ruthenium red staining for ultrastructural visualization of a glycoprotein layer surrounding the spore of Bacillus anthracis and B. subtilis. J. Microbiol. Methods 58:23-30.[Medline]
  46. Waller, L. N., M. J. Stump, K. F. Fox, W. M. Harley, A. Fox, G. C. Stewart, and M. Shahgholi. 2005. Identification of a second collagen-like glycoprotein produced by Bacillus anthracis and demonstration of associated spore-specific sugars. J. Bacteriol. 187:4592-4597.[Abstract/Free Full Text]
  47. Wunschel, D., K. Fox, G. Black, and A. Fox. 1994. Discrimination among the Bacillus cereus group, in comparison to B. subtilis, by structural carbohydrate profiles and ribosomal RNA spacer region PCR. Syst. Appl. Microbiol. 17:625-635.
  48. Zolock, R. A., G. Li, C. Bleckman, L. Burggraf, and D. Fuller. 2006. Atomic force microscopy of Bacillus spore surface morphology. Micron 37:363-369.[CrossRef][Medline]


Journal of Bacteriology, September 2007, p. 6704-6713, Vol. 189, No. 18
0021-9193/07/$08.00+0     doi:10.1128/JB.00762-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.00762-07v1
189/18/6704    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, B. M.
Right arrow Articles by Stewart, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, B. M.
Right arrow Articles by Stewart, G. C.


Home Help