Journal of Bacteriology, October 2007, p. 6743-6750, Vol. 189, No. 19
0021-9193/07/$08.00+0 doi:10.1128/JB.00889-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
,
Faculty of Life Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, United Kingdom,1 Génétique Moléculaire, Génomique, Microbiologie, UMR 7156 Université Louis Pasteur—CNRS, F-67083 Strasbourg, France,2 Faculty of Medicine, University of Liverpool, Liverpool L69 3GA, United Kingdom3
Received 7 June 2007/ Accepted 25 July 2007
|
|
|---|
|
|
|---|
Studies of the sulfate starvation response in P. aeruginosa have concentrated on the well-characterized isolate PAO1 (18, 34). However, P. aeruginosa strains isolated from the cystic fibrosis lung are often genetically significantly different from strain PAO1 (55). They are also exposed to a very different set of sulfur-containing molecules, since they colonize the bronchiolar lumen as microcolonies attached to mucus components such as the sulfated respiratory mucin (28, 44). A number of reports have shown that the level of mucin sulfation is enhanced in cystic fibrosis patients (7, 29, 57), and this may well be a defense response in itself, since mucin sulfation is known to prevent degradation of the mucin by bacterial enzymes (48). Mucin sulfatase activities have been found in anaerobic bacteria such as Bacteroides and Prevotella spp. (36, 48), but mucin desulfation has also been reported for several clinical isolates of P. aeruginosa (20). In the P. aeruginosa strains, mucin sulfation seems to be independent of the characterized arylsulfatase activity, suggesting that cells may react differently to exposure to mucin as a sulfur source than to sulfate limitation alone.
This study was initiated to address the questions of which sets of genes are regulated by sulfur supply in P. aeruginosa and whether these are altered in a cystic fibrosis patient isolate on exposure to mucin. Here, we report that under sulfate-limited conditions, a cystic fibrosis P. aeruginosa isolate was able to utilize mucin as the sole sulfur source, although P. aeruginosa PAO1 did not do so. Under these conditions, P. aeruginosa cells showed three groups of transcriptional responses, including a complex sulfate starvation response, a specific response to mucin as the sulfur source, and a more general response to mucin exposure.
|
|
|---|
P. aeruginosa K1040M was constructed from P. aeruginosa 1040 (met-9011 pvd-9 tonB1::Hg) (58) by replacement of the methionine auxotrophy by transduction using phage E79-tv2 grown on strain PAO1. This strain was grown in iron-supplemented medium as previously described (58). Other cystic fibrosis P. aeruginosa isolates used included three epidemic strains (C3373, LES400, and LESB58 [42]) and a selection of other isolates from the University of Liverpool laboratory collection (strains 49211, 49244, 59032, 59039, 59070, and 59079).
Preparation of mucin. The human colon adenocarcinoma cell line LS174T, a cell type which forms well-differentiated goblet cells, was obtained from the European Collection of Animal Cell Cultures (Porton Down, United Kingdom). The presence of O-sulfate esters on LS174T secretory mucins has been demonstrated previously in [35S]sulfate incorporation studies (5). For production of human mucin LS174T, cells were grown as monolayers in Dulbecco's modified Eagle's medium supplemented with 4 mM glutamine, 10% (vol/vol) fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin in 5% CO2-95% air at 37°C. The medium was harvested 2 to 7 days after confluence was achieved, and the mucin was purified by gel filtration over Sepharose CL-2B minicolumns (5 by 1.5 cm), eluting with phosphate-buffered saline (pH 7.4) containing 0.01% (wt/vol) thimerosal. Mucin-containing fractions were desalted over PD10-Sephadex GM25 columns, lyophilized, and stored at 4°C. Pig gastric mucin (type III) was obtained from Sigma.
RNA preparation and reverse transcriptase-PCR. Cells used for the preparation of RNA were grown to exponential phase (optical density at 600 nm, 0.2), harvested at 4°C, and immediately frozen in liquid nitrogen. Total RNA was prepared with an RNeasy mini kit and an RNase-free DNase set from QIAGEN (Hilden, Germany), by following the protocol of the manufacturer. For each growth condition, RNA was prepared from three or four independent batch cultures harvested at the same optical density at 600 nm (within 0.05 optical units).
The quality of RNA preparations was routinely checked on 1% agarose gels (39), and by reverse transcriptase-PCR of the sbp gene PA0283 (reverse primer, CGACGATCTCGAAGTTTTCC; forward primer, ATCGACGAACTGCACAAGC). Reverse transcriptase-PCR was performed by a two-step protocol, using 1 µg of RNA and the First Strand cDNA synthesis kit (MBI-Fermentas). The same PCR setup was used to check RNA preparations for the absence of contaminating DNA prior to reverse transcription.
DNA microarray hybridization. Frozen batches of RNA were thawed and used only once. Reverse transcription of RNA, cDNA fragmentation, and hybridization followed the protocol recommended and provided by Affymetrix (Santa Clara, CA). Briefly, reverse transcription of 5 to 10 µg of P. aeruginosa RNA was performed using 750 ng of random hexamer primer mix and Superscript III transcriptase (Invitrogen). The cDNA product was purified with the QIAquick PCR purification kit (QIAGEN). Purified cDNA (3 µg) was then fragmented for 6 min at 37°C using DNase I, and the fragmented cDNA was biotin labeled and hybridized for 16 h at 50°C to an Affymetrix P. aeruginosa chip (P. aeruginosa genome array; Affymetrix). Microarrays were further processed in accordance with the recommended protocol of Affymetrix. Experiments were performed with either threefold or fourfold biological replication. Hybridization of genomic DNA was carried out similarly, after fragmentation of genomic DNA samples using the protocol provided by Affymetrix.
Analysis of microarray data.
Image analysis of the scanned arrays for the presence and absence of RNA transcripts was done using the MAS 5 software package with the following parameter settings:
1 of 0.04,
2 of 0.06,
of 0.015, TGT value of 400, and norm factor of 1.0. Array images were checked visually for any irregularities in hybridization using dChip 1.3 (30, 59). Array data were normalized using the GC-RMA algorithm (56), and the data were then further analyzed using the microarray software package Genespring GX 7.3 (Agilent). Genes whose levels of expression were significantly influenced by sulfur source (P < 0.05) were identified with Genespring GX, using a Benjamini-Hochberg multiple-testing correction and a false detection rate of 5%. Significance analysis of the microarray results was performed using the SAM algorithm (49), with false detection rates of <5%.
Validation of microarray results with quantitative reverse transcriptase-PCR. The accuracy of the microarray data was verified by quantitative reverse transcriptase-PCR analysis of 10 selected genes displaying high and low levels of change in the microarray analysis (see Table S1 in the supplemental material). PCR amplification was performed using an ABI Prism 7000 cycler (Applied Biosystems) with two-step TaqMan reverse transcription and a SYBR green PCR master mix kit (Applied Biosystems) and 100 ng of template RNA, in accordance with the protocol of the manufacturer. The calibration curves for each primer pair were constructed with purified PCR product as the template. Experiments were repeated three times for each of the biological triplicates of the corresponding microarrays.
Microarray data accession number. Lists of induced and repressed genes can be found in the supplemental material. The gene expression data are available from the Gene Expression Omnibus (GEO) under accession number GSE8408.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Growth rates of P. aeruginosa with different sulfur sourcesa (h–1)
|
P. aeruginosa sulfate starvation response—upregulation of gene families. Expression levels of specific P. aeruginosa genes are expected to change when mucin rather than sulfate is supplied as the sole sulfur source, primarily because many genes are upregulated in the absence of sulfate as part of the sulfate starvation response (34). However, changes were also expected to include specific mucin-induced genes and changes in gene expression due to growth rate effects, since growth with mucin is considerably slower than with sulfate (Table 1). To avoid these growth rate effects, we compared gene expression in sulfate-grown cells with that in cells grown with cyclamate (N-cyclohexylsulfamate) as an alternative sulfur source. Cyclamate allows a growth rate comparable to that observed with sulfate (Table 1) and acts as a synthetic, chemically defined surrogate for N-linked mucin. In addition, the use of cyclamate-grown cells facilitates a comparison with previous proteomic studies of P. aeruginosa PAO1 (34). The sulfate starvation responses of P. aeruginosa strains PAO1 and E601 were examined by isolating the total RNA of each strain from exponential-phase batch cultures grown with sulfur supplied as cyclamate, sulfate, or cyclamate and sulfate together, followed by GeneChip analysis. Cells were harvested at the same optical density in order to minimize growth-phase-dependent effects.
Growth with cyclamate in the absence of added sulfate led to the differential upregulation (greater than twofold; P < 0.05) of 132 genes in both of the two strains studied. It is important to note that under these conditions, cells are not starved for sulfur, but the absence of inorganic sulfate leads to the change in gene expression (34). Transcriptomic responses can vary dramatically between different strains of the same species (38), and comparison of these gene lists showed that 155 and 134 genes were upregulated in strain PAO1 and strain E601, respectively, while 67 and 273 genes were downregulated more than twofold in the two strains, respectively (Fig. 1; see Table S3 in the supplemental material). Of the 132 upregulated genes, 43 were strongly upregulated (>10-fold) (Table 2). When differentially regulated genes were classified by metabolic category (Fig. 1), broadly similar patterns were observed for the two strains. The most strongly upregulated groups of genes correspond to hypothetical and conserved hypothetical proteins, but a large group of genes related to transport functions was also upregulated. Interestingly, we detected significant downregulation of genes related to energy metabolism (Fig. 1). Comparison of sulfate-grown cells with those provided with mixed cyclamate and sulfate revealed that only two cyclamate-upregulated genes were not repressed by cyclamate-sulfate (PA2298 and PA2299), suggesting that these may be specifically cyclamate induced.
![]() View larger version (26K): [in a new window] |
FIG. 1. Functional classification of P. aeruginosa genes that displayed greater-than-twofold altered expression (P < 0.05) in the absence of sulfate compared to growth with sulfate as the sulfur source. The responses of P. aeruginosa PAO1 and P. aeruginosa E601 are shown separately. LPS, lipopolysaccharide.
|
|
View this table: [in a new window] |
TABLE 2. Genes whose expression was strongly upregulated (>10-fold) in P. aeruginosa in the absence of sulfate relative to growth with inorganic sulfatea
|
![]() View larger version (23K): [in a new window] |
FIG. 2. (A) Sulfur content of sulfate starvation-regulated genes (see Table S2 in the supplemental material) in P. aeruginosa PAO1. (B) Distribution of SSI genes (see Table S3 in the supplemental material) on the P. aeruginosa genome, showing the presence of five islands that contain enhanced levels of sulfate starvation-regulated genes (sulfur islands I to V). (C) Distribution of genes encoding LSPs in the P. aeruginosa genome. The frequency is given as the number of LSP-encoding genes in a 10-gene window. LSPs were defined as proteins for which the percentage of encoded cysteine and methionine residues (not including fMet) was more than 1.5 standard deviations below the average value for all ORFs in the genome of 2.87%. The islands of SSI genes (I to V) (as described for panel B) are shown for comparison.
|
-ketoglutarate-dependent dioxygenases such as TauD and AtsK (COG2175; five genes). Upregulation of multiple uncharacterized members of these five COGs under sulfate-limited conditions suggests that the encoded proteins catalyze the uptake and desulfurization of a variety of environmentally relevant sulfonates and/or sulfate esters. Interestingly, the cysteine biosynthetic pathway was only weakly upregulated by sulfate limitation in P. aeruginosa, with only the sulfate transporter genes sbp and cysTWA being derepressed more than twofold during growth with cyclamate. This contrasts strongly with the changes observed in E. coli during growth in the absence of sulfate (13), where all the genes of the cys regulon are upregulated under sulfate starvation conditions and the cells do not upregulate multiple members of particular COG families. Sulfate limitation was linked to an oxidative stress response, as also observed in E. coli, with upregulation of ahpC (alkylhydroperoxide reductase), katB (catalase), ohr (organic hydroperoxide resistance protein), and lsfA (thiol-specific antioxidant). Multiple members of two additional COGs potentially related to sulfur metabolism were also upregulated. The most interesting of these was COG1960 (six genes), which includes proteins with homology to acylCoA dehydrogenases, some of which are known to be involved in desulfurization of dibenzothiophene and methanesulfonate in this and other species (DszC and MsuC, respectively) (11, 25). With the exception of DszC (which acts as an FMNH2-dependent monooxygenase in Rhodococcus [11]), the function of these proteins has yet to be clarified. A second group is made up of TonB-dependent receptor proteins (COG1629; four genes). Glutathione S-transferases (COG625) represent another large protein family connected to sulfur metabolism, with 18 members of this group on the P. aeruginosa genome, mostly of unknown function (53). No glutathione S-transferase genes, and indeed no other glutathione-related genes, were significantly regulated by shifts in the sulfur source, providing evidence that changes in the sulfur source for growth do not affect glutathione utilization or synthesis.
Role of the TonB complex in the sulfate starvation response. Three of the most strongly upregulated genes in the absence of sulfate were tonB2 (PA0197) and the two genes encoding TonB accessory proteins, exbB and exbD. The TonB-ExbB-ExbD complex is essential in the uptake of siderophores into the cell and also plays a role in the transport of vitamin B12 (8). Its potential importance in sulfur metabolism is underlined by the fact that several putative TonB-dependent receptors and transducers are upregulated during growth in the absence of sulfate. Recent work has shown that these outer membrane proteins act either as transporters or as transducers of external signals, depending on their domain structure (26), and are energized by the TonB-ExbB-ExbD complex in the cytoplasmic membrane and periplasm. The strong upregulation of the tonB2 gene under sulfate-limited conditions suggested that it might be required for uptake of alternative sulfur sources and contrasts strongly with the expression levels of tonB1 (PA5531) and tonB3 (17), which were unchanged under sulfate limitation. We cultivated a tonB2 mutant strain of P. aeruginosa (strain 1407 [58]) with a variety of different sulfur sources but found that it grew normally compared to the wild-type strain (data not shown). This suggested that the tonB1 gene (PA5531) might be able to complement the deficiency in tonB2. In contrast, TonB2 cannot fully compensate for a deficiency in TonB1, since growth of a tonB1 mutant strain (strain K1440M) required iron supplementation during growth with either sulfate or cyclamate (i.e., even when tonB2 expression was induced by sulfate limitation). We conclude that the sulfur-regulated TonB2 complex is important for uptake of an unknown sulfur-containing substrate. It is located on the genome in sulfur island I (Fig. 2B), in close proximity to a putative TonB-dependent receptor (PA0192) and a number of genes that are involved in sulfate ester metabolism (22), so it may be involved in utilization of an unidentified sulfate ester.
Sulfate starvation and the influence of mucin. Cells of P. aeruginosa E601 were grown in batch cultures containing human mucin as the sole source of sulfur, and RNA extracted from these cultures was used for GeneChip analysis. Compared to growth results with sulfate, provision of mucin as the sole sulfur source led to upregulation of a slightly larger group of genes than that observed during growth with cyclamate (see Table S4 in the supplemental material). This group included almost all the sulfate starvation-induced genes that were upregulated during growth with cyclamate, confirming that the observed sulfate limitation response is not specific to cyclamate as the sulfur source and is seen during both rapid and slow growth. Several additional genes were also upregulated under these slow-growth conditions, including exoenzyme S, components of the type III secretion apparatus, and multidrug efflux systems. However, most of these were also upregulated during rapid growth with mucin and cyclamate together, relative to growth with cyclamate alone, and they therefore constitute the cells response to mucin independent of the overall sulfate starvation response.
|
|
|---|
The homeostatic response of P. aeruginosa to sulfate limitation involved the upregulation of some 132 genes (>2-fold, P < 0.05) (see Table S2 in the supplemental material), with 44 of these showing >10-fold regulation (Table 2). Regulation of these genes by sulfur supply was observed in two different strains of P. aeruginosa, the cystic fibrosis isolate E601 and the laboratory strain PAO1. Some additional genes were upregulated in each strain specifically, but these were considered less relevant for the present study. Importantly, the same set of SSI genes was observed during growth with cyclamate and with mucin for both strains investigated, and this included the genes encoding all the SSI proteins identified in a previous proteomic study (34). Compared with that of other bacteria, the P. aeruginosa SSI response is quite extensive. E. coli, for example, responds to sulfate starvation (growth with taurine or glutathione) with changed regulation of 64 genes (13), while in Bacillus subtilis some 56 genes were similarly regulated (growth with methionine) (2). The most-expected response to sulfate limitation is increased transcription of the cysteine and methionine biosynthetic pathways, and this is indeed observed in E. coli, with all the genes of the cys regulon and several methionine biosynthesis genes upregulated under sulfate starvation conditions (13). In P. aeruginosa, however, this was not observed, and although expression of sulfate transport genes was increased, the rest of the cysteine and methionine biosynthesis pathways were not significantly affected. In B. subtilis, there was upregulation of cysteine biosynthesis, but since methionine was supplied as the derepressing growth substrate, no conclusions can be drawn concerning methionine biosynthesis (2).
The P. aeruginosa genome is characterized by the presence of larger numbers of regulatory proteins and uptake systems than in most other bacteria whose genomes have been sequenced (27). This allows a flexibility of response to different environmental conditions and helps explain the ability of this species to colonize a wide variety of habitats. The P. aeruginosa SSI response observed here reflects this genomic flexibility, since its main feature is the upregulation of families of related genes. Many of these are of unknown function, and they are likely to catalyze uptake and desulfurization of unidentified sulfur-containing substrates. B. subtilis also increases transcription of a range of transport systems under sulfate limitation, but E. coli appears to be limited to the two characterized sulfonate utilization operons, ssu and tau (50, 51). All three species respond to sulfate starvation with the synthesis of proteins that help to counter oxidative stress, such as catalases and peroxidases. It has been suggested that this may be linked to peroxide production by autoxidation of enzymes containing flavin adenine dinucleotide, such as sulfite oxidase (13). However, all three species studied respond to sulfate limitation by strongly upregulating the expression of FMNH2-dependent monooxygenases (mainly sulfonatases such as SsuD or MsuD; in P. aeruginosa, no fewer than eight genes of this family were upregulated) and the corresponding flavin mononucleotide (FMN) reductases. The resulting increase in FMN reductase activity will lead to enhanced levels of reduced FMN in the cell, and if the appropriate sulfonatase substrates are not present, rapid autoxidation will release active oxygen species, potentially causing the observed oxidative stress response.
Comparison of the sulfate starvation responses observed in E. coli during growth with taurine (rapid growth) and glutathione (slow growth), and during various shifts in sulfur supply, led to the conclusion that a set of responses that occurred both for N and S limitation were in fact consequences of slow growth and were controlled to a great extent by the RpoS protein (12, 13). We were therefore surprised to observe that in P. aeruginosa, the SSI response seen with cyclamate (rapid growth) was very similar to that observed during slow growth with mucin as the sulfur source. Of all the sulfate starvation-regulated genes (see Table S3 in the supplemental material), only six corresponded with P. aeruginosa genes found to be RpoS controlled in a previous study (40), suggesting that RpoS does not play a large role in the homeostatic sulfate starvation response in this species. However, other sigma factors are also important in the SSI response of Pseudomonas species. In P. putida, for example, the RpoN sigma factor is known to play a role in sulfur metabolism, controlling expression of the sfn genes that are required for dimethylsulfone metabolism (10). Very few of the P. aeruginosa SSI genes carried a conserved RpoN-binding site (46), but these included the P. aeruginosa sfn orthologues PA2346 and PA2347 and the nearby msuD and msuE genes, which are involved in methanesulfonate metabolism (25). Apart from these, only the porin gene oprB (PA3186) appeared to be RpoN controlled. In P. putida, expression of the sfn genes also required the CysB protein, which is a LysR family regulator of sulfur metabolism in a number of gram-negative species. In P. aeruginosa, CysB has been shown to be required for the utilization of sulfate esters and to be involved in sulfonate utilization (19, 52), but the extent to which it controls the other SSI genes reported here has not yet been investigated. A consensus CysB-binding sequence has been reported in Salmonella enterica serovar Typhimurium (16), but it is not well conserved, and a search for conserved sequences upstream of the P. aeruginosa SSI genes (Table 2) was unsuccessful.
The largest group of sigma factors in P. aeruginosa is that associated with extracytoplasmic function (the ECF group), of which the best characterized are AlgU and PvdS (15, 21). The 19 ECF sigma factors found in P. aeruginosa reflect the versatility of this species in adapting to a variety of different habitats and responding to environmental signals (33). Under sulfate-limited conditions, P. aeruginosa upregulated transcription of one of these ECF sigma factors, PA2093, and this transcriptional activation was further increased when mucin was present in the growth medium. This gene was located within a larger cluster of sulfate-regulated genes (PA2087 to PA2094) within sulfur island II and was associated with a TonB-dependent transducer system and a putative sulfonatase gene, suggesting that it is involved in sensing extracellular sulfate limitation and especially in responding to the presence of mucin as a sulfur source in the environment. Cells of P. aeruginosa also responded to the presence of mucin with increased transcription of several genes involved in the synthesis of the type III secretion system and exoenzyme S. The upregulation of the type III secretion system genes under the conditions tested here suggests that the cells recognize mucin not only as a source of sulfur but also as a component of the host environment and induce the type III secretion system accordingly. Previous studies on the response of P. aeruginosa to mucus exposure have identified the migA and npt20 genes (PA0705 and PA5499, respectively) as mucin induced (54). These genes were not induced in the present study, possibly because the concentrations of mucin applied here were much lower.
This work was supported by a grant from the Biotechnology and Biological Sciences Research Council to M.K. and by a CNRS ATIP grant to S.V. We are grateful for support from Cystic Fibrosis Foundation Therapeutics.
Published ahead of print on 3 August 2007. ![]()
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
|
|
|---|
54-dependent transcriptional activators. J. Bacteriol. 185:1757-1767.This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»