JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.00906-07v1
189/19/7077    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glenn, S. A.
Right arrow Articles by González, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glenn, S. A.
Right arrow Articles by González, J. E.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 2007, p. 7077-7088, Vol. 189, No. 19
0021-9193/07/$08.00+0     doi:10.1128/JB.00906-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The ExpR/Sin Quorum-Sensing System Controls Succinoglycan Production in Sinorhizobium meliloti{triangledown}

Sarah A. Glenn, Nataliya Gurich, Morgan A. Feeney,{dagger} and Juan E. González*

Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, Texas 75083-0688

Received 8 June 2007/ Accepted 16 July 2007


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sinorhizobium meliloti is a gram-negative soil bacterium capable of forming a symbiotic nitrogen-fixing relationship with its plant host, Medicago sativa. Various bacterially produced factors are essential for successful nodulation. For example, at least one of two exopolysaccharides produced by S. meliloti (succinoglycan or EPS II) is required for nodule invasion. Both of these polymers are produced in high- and low-molecular-weight (HMW and LMW, respectively) fractions; however, only the LMW forms of either succinoglycan or EPS II are active in nodule invasion. The production of LMW succinoglycan can be generated by direct synthesis or through the depolymerization of HMW products by the action of two specific endoglycanases, ExsH and ExoK. Here, we show that the ExpR/Sin quorum-sensing system in S. meliloti is involved in the regulation of genes responsible for succinoglycan biosynthesis as well as in the production of LMW succinoglycan. Therefore, quorum sensing, which has been shown to regulate the production of EPS II, also plays an important role in succinoglycan biosynthesis.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sinorhizobium meliloti is a free-living gram-negative soil bacterium capable of forming a nitrogen-fixing symbiotic relationship with the leguminous plant, Medicago sativa, commonly known as alfalfa. The symbiotic process involves an exchange of signaling molecules between S. meliloti and its host, leading to the eventual formation of nodules containing nitrogen-fixing bacteroids (24, 33, 68). First, alfalfa releases flavonoids, which serve as a chemoattractant for S. meliloti. In response to flavonoids, the bacterial nod genes produce nod factors that stimulate nodule formation (27). A plant-derived tube, known as the infection thread, allows S. meliloti to travel from its soil environment into the developing nodule. The presence of bacterially produced exopolysaccharides is essential for nodule invasion to occur (for recent reviews, see references 10, 21, and 67). Eventually, the bacteria differentiate into bacteroids that reduce atmospheric dinitrogen into ammonia in exchange for nutrients provided by the plant. In the absence of exopolysaccharides, nodules develop, but they are devoid of nitrogen-fixing bacteroids. S. meliloti produces two symbiotically important polymers, succinoglycan and EPS II, either of which can function in nodule invasion, although their precise role is unknown (10, 21, 67).

Succinoglycan is a polymer of repeating octasaccharide subunits composed of one galactose and seven glucose residues decorated with acetyl, succinyl, and pyruvyl modifications in a ratio of 1:1:1 (1, 60). Succinoglycan production can be observed with the use of the dye calcofluor, to which succinoglycan binds, leading to fluorescence under UV light (18, 44). Various mutants in succinoglycan biosynthesis have been isolated based on their inability to fluoresce or by their altered fluorescent phenotypes on medium supplemented with calcofluor (18, 44, 46). This led to the discovery of a cluster of genes later designated as exo. The products of the 19 exo genes are involved in processes such as the synthesis and modification of the octasaccharide subunits and polymerization and transport of the exopolysaccharide; there is also a glycanase involved in depolymerization of the polymer (5-7, 31, 32, 44, 46, 53, 75). Analysis of the exo gene cluster, as well as the lipid-linked biosynthetic intermediates that were found to accumulate in various succinoglycan-deficient mutants, led to a model for succinoglycan biosynthesis (61). The first sugar residue, galactose, is added to the lipid carrier by the product of exoY. The remaining seven glucose residues are subsequently added by specific glucosyltransferases, and modifications to the octasaccharide are incorporated during the biosynthetic process. Finally, polymerization and transport of the polymer occur (61). Further analysis demonstrated that succinoglycan is produced in two well-defined sizes based on molecular weight. One fraction contains high-molecular-weight (HMW) succinoglycan that consists of up to 2,000 or more of the octasaccharide subunits (4, 35). The second fraction, termed low-molecular-weight (LMW) succinoglycan consists of monomer, dimer, and trimer subunits of the polymer (35, 71). Studies conducted by the Walker laboratory concluded that the trimer fraction of the succinoglycan polymer is the active signal molecule in nodule invasion (70).

The LMW fractions of succinoglycan can be produced either by partial polymerization or by depolymerization of HMW products through the action of specific endoglycanases (35, 75). Direct polymerization of succinoglycan is mediated by the gene products of exoP, exoT, and exoQ (35). ExoP is proposed to be involved in the determination of the chain length of the polymer (9). The ExoP and ExoT proteins are involved in the biosynthesis of the succinoglycan dimer and trimer molecules that form the LMW fraction. The ExoP and ExoQ proteins act in concert to produce the HMW succinoglycan fraction (35).

The depolymerization of succinoglycan is mediated by the action of two endo-1,3-1,4-ß-glycanases, ExoK and ExsH. Elegant work from York and Walker (75) showed that mutations in either the exoK or the exsH gene leads to a decrease in the LMW succinoglycan fraction, suggesting that the majority of this fraction is generated by the action of these two enzymes. This decrease can be observed on calcofluor-containing plates where colonies of exoK exsH double mutants lack the characteristic calcofluor halo that surrounds the colonies as a result of the diffusion of LMW succinoglycan into the medium (75).

A mutation in an additional exo gene, exoH, also yields a haloless colony phenotype on calcofluor medium (46). This gene encodes a succinyltransferase that is responsible for the addition of succinyl groups to the octasaccharide (6, 32, 42, 43). This mutation leads to the production of mostly HMW succinoglycan (42, 43). Interestingly, it has been shown that the HMW polymer generated by this mutant is refractive to cleavage by both the ExoK and ExsH glycanases (76). Therefore, succinyl modifications are important for the production of LMW succinoglycan. Although the mechanisms for the production of LMW succinoglycan have been well established, it is not yet clear how this process is regulated.

Similar to succinoglycan, the LMW fraction of EPS II plays a role in nodule invasion (34). EPS II, the second symbiotically important exopolysaccharide produced by S. meliloti, consists of repeating disaccharide subunits containing glucose and galactose in a ratio of 1:1 with acetyl and pyruvyl modifications (30, 36). A group of 22 genes belonging to the exp gene cluster is responsible for the synthesis of EPS II (11, 30). Unlike succinoglycan, the EPS II biosynthetic pathway has not been elucidated since mutations in any of these genes block EPS II production (11). Environmental factors, such as phosphate concentration, have been shown to play an important role in the regulation of EPS II. Under low-phosphate conditions, like those often found in the soil, EPS II production increases. Under conditions with high phosphate concentrations, such as those found in the nodule, reduced amounts of EPS II are produced (50, 77). Another important regulator of EPS II biosynthesis is the product of the expR gene. ExpR belongs to the family of LuxR quorum-sensing regulators (57). Marketon et al. (47) showed that particular exp genes in S. meliloti are regulated by the ExpR/Sin quorum-sensing system (47). This quorum-sensing system consists of the regulator ExpR, the autoinducer synthase, SinI, and its regulator, SinR (48). SinI is responsible for the production of a series of long-chain N-acyl homoserine lactones (AHLs) that range in size from N-dodecanoyl homoserine lactone to N-octadecanoyl homoserine lactone (49). The commonly used S. meliloti laboratory strain, Rm1021, has a disrupted copy of expR and consequently lacks a complete quorum-sensing system (57). As a result, this strain does not produce EPS II, whereas strain Rm8530 (formerly known as the expR101 strain) contains an intact expR gene and synthesizes both HMW and LMW forms of EPS II, resulting in a very mucoid colony phenotype (47, 57). Interestingly, most of the studies of succinoglycan production have been performed in Rm1021, a strain that lacks a complete ExpR/Sin quorum-sensing system.

The ExpR/Sin quorum-sensing system in S. meliloti not only regulates EPS II production but also controls a vast array of genes involved in many free-living and symbiotic cell functions in S. meliloti (37). We set out to investigate what roles the ExpR regulator and/or the autoinducer synthase, SinI, play in succinoglycan production. Here, we show that ExpR, together with the sin AHLs, is involved in modulating expression of specific genes within the exo cluster. We also report that the ExpR/Sin quorum-sensing system is involved in LMW succinoglycan production through exsH and, to a smaller extent, exoK, the two endo-1,3-1,4-ß-glycanases responsible for the depolymerization of HMW succinoglycan (75). Together, these findings suggest that the ExpR/Sin quorum-sensing system plays a role in the regulation of both symbiotically important exopolysaccharides, succinoglycan and EPS II, in S. meliloti.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Media and genetic techniques. S. meliloti strains were grown in Luria-Bertani broth or agar supplemented with MgSO4 and CaCl2 and the appropriate antibiotics as previously described (29). Escherichia coli strains were grown in Luria-Bertani broth or agar with the appropriate antibiotics. Strains (Table 1) were created by generalized transduction using phage {phi}M12 as previously described (29). Bacteria were grown in minimal glutamate mannitol (MGM) low-phosphate broth (50 mM morpholinepropanesulfonic acid, 19 mM sodium glutamate, 55 mM mannitol, 0.1 mM K2HPO4·KH2PO4 [stock consists of equal molar ratio of each], 1 mM MgSO4, 0.25 mM CaCl2, 0.004 mM biotin; pH 7) as previously described (37). Starter cultures for RNA isolation were grown in 2 ml of TYC broth (10 g tryptone, 5 g of yeast extract, and 0.4 g of CaCl2/liter) with streptomycin (500 µg/ml) for 2 days at 30°C. The strains were subcultured (1:100) in 25 ml of MGM low-phosphate medium and grown at 30°C with constant shaking. Cultures used for molecular weight profile analysis were grown in MGM low-phosphate medium. For Calcofluor halo analysis, MGM low-phosphate medium was supplemented with calcofluor (Fluorescent Brightener 28; New Dragon Co.) to a final concentration of 0.02% buffered with 10 mM HEPES, pH 7.4.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Bacterial strains and plasmids used in this work

 
Constructions of the exsH transcriptional fusion. A 1,016-bp internal fragment of the exsH gene was amplified from S. meliloti chromosomal DNA using the following primers which contain EcoRI and KpnI restriction sites (underlined) at their respective 5' ends: 5'-CGCGAATTCCGTCACCATGATCGGCGGTAGG-3' and 5'-CGCGGTACCCATCGGCGACCTTCACCGAAT-3'. PCR was performed by using 30 cycles of 30 s at 95°C, 30 s at 60°C, and 1 min at 72°C. The PCR fragment was purified, digested with EcoRI and KpnI, and cloned into the suicide plasmid pVIK112 (38). The resulting plasmid, pVIKExsH, containing the exsH-lacZ transcriptional fusion was then transformed into S17 {lambda}pir. Biparental matings were performed to transfer the plasmid into a rifampin-resistant Rm1021 derivative (Rm11554) where the gene was replaced by single recombination. The S. meliloti clone carrying the chromosomal lacZ transcriptional fusion was selected by plating on minimal medium (MGM) containing neomycin and rifampin.

Construction of pJNSinI. An arabinose-inducible pJNSinI plasmid was constructed by ligation of a 698-bp PCR fragment of sinI with EcoRI/XbaI-digested pJN105 (55). The sinI gene was amplified from Rm8530 using the following primers: CGCGAATTCTCGCTACATCGCGTAATCACGC and CGCTCTAGATCAGGCGGCGCGTGCCGTTT, where the underlined nucleotides are EcoRI and XbaI restriction enzyme sites, respectively. The plasmid was introduced into E. coli by transformation and selection with gentamicin. The presence of sinI was confirmed by PCR with the above primers. This strain was then used as a donor in a triparental mating with S. meliloti. Transconjugants were selected by plating on streptomycin and gentamicin.

Construction of pSW213ExpR. An IPTG (isopropyl-ß-D-thiogalactopyranoside)-inducible pSW213ExpR plasmid was constructed by ligation of a 741-bp PCR fragment of expR with BglII/KpnI-digested pSW213 (14). The expR gene was amplified from Rm8530 using the following primers: GAAGATCTTCACATGGCCTGGCGGGTTG and CGGGGTACCGAATCCGGTCGAGGCGCTG, where underlined nucleotides are BglII and KpnI restriction enzyme sites, respectively, and italicized nucleotides are 5' additions to the PCR product. The plasmid was introduced into E. coli by transformation and selection with tetracycline. The presence of expR was confirmed by PCR with the above primers. This strain was then used as a donor in a triparental mating with Rm1021. Transconjugants were selected by plating on streptomycin and tetracycline.

ß-Galactosidase assays. Bacteria were grown to an optical density at 600 nm (OD600) of 0.8 in 5 ml of MGM low-phosphate medium at 30°C and assayed as previously described to determine Miller units of activity (51). The average and standard deviations for each strain were calculated from the results of three independent cultures.

RNA purification. Bacterial cultures were grown to an OD600 of 0.8 or 1.2 in MGM low-phosphate medium containing 500 µg of streptomycin/ml. Cells were harvested by centrifugation (20,000 x g for 2 min at 4°C), and cell pellets were immediately frozen in liquid nitrogen. Total RNA was purified by using an RNeasy Mini Kit (QIAGEN). Cells were disrupted in the RLT buffer provided with the QIAGEN kit in Fast Protein Blue tubes (QBIOgene) by using a Ribolyser (Hybaid) (for 30 s at level 6.5) prior to spin column purification, according to the RNeasy Mini Kit RNA purification protocol. The RNA samples were treated with QIAGEN on-column RNase-free DNase and further purified. Samples were DNase treated a second time with the TURBO RNase-free DNase from Ambion according to the manufacturer's protocol, and an additional RNA clean-up step was performed (37). RNA samples were checked for integrity using an Agilent 2100 Bioanalyzer, and then concentration was determined for cDNA synthesis.

Affymetrix chip hybridizations and expression analysis. Two independent biological replicates were analyzed for each strain at mid-logarithmic and early stationary phase (OD600 of 0.8 and 1.2) using the S. meliloti and Medicago truncatula Affymetrix GeneChips (Santa Clara, CA). Affymetrix hybridizations were performed by the Core Microarray facility at the University of Texas Southwestern Medical Center (Dallas, TX) as previously described (3). Ten micrograms of total RNA was used for each experiment. A GeneChip Scanner 3000 was used to measure pixel values, and CEL files were processed by Affymetrix GeneChip operating software, version 1.4. All data were transformed, replicates were combined, and differentially regulated genes were identified with a 90% confidence threshold. Genes were considered as differentially expressed at a P value of ≤0.05 and an M value of >1.5.

Quantitative real-time PCR. The first-strand cDNA mixture for each strain was prepared with a RETROscript kit from Ambion by using 2 µg of total RNA per reaction, and 1 µl of the cDNA reaction was used as a template for the real-time PCR. The oligonucleotide sequences for real-time PCR are listed in Table 2. The TaqMan probes used were as follows: SMc00128 probe, 5'-[HEX]TCAGCATGAACGACCAGACAGCCGTCA[DBH2]-3'; expE2 probe, 5'-[DFAM]CAACCCGTCCCGCTCGTCAGCAC[DBH1]-3'; exsH probe, 5'-[DFAM]TTGTCCGCCTCGTTGCCGAATGC(DBH1)-3'; exoK probe, 5'-(DFAM)ACACGCTCACCGACTGGATGGGCA[DBH1]-3' (DFAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; DBH1, Black Hole Quencher 1; DBH2, Black Hole Quencher 2). For real-time PCR analysis using TaqMan probes, each reaction mixture contained 0.3 µM sense oligonucleotide, 0.3 µM antisense oligonucleotide, 0.2 µM TaqMan probe, and 0.5 Omni Mix HS PCR beads (each PCR bead contains 1.5 U of Taq DNA polymerase, 10 mM Tris-HCl [pH 9.0], 50 mM KCl, 1.5 mM MgCl2, 200 µM deoxynucleotide triphosphate, and stabilizers, including bovine serum albumin) in a 25-µl reaction volume. The experiment was performed with a Cepheid Smart Cycler, version 2.0c, programmed as follows: stage 1, 95°C for 120 s; stage 2, 95°C for 15 s and 60°C for 30 s (two-temperature cycle repeated 40 times). For the SYBR Green protocol, each reaction mixture contained 0.3 µM sense oligonucleotide, 0.3 µM antisense oligonucleotide, 0.5x SYBR Green 1 (Sigma), and 0.5 Omni Mix HS PCR beads in a 25-µl reaction volume. The experiment was performed with the Cepheid Smart Cycler, version 2.0c, as described previously (37).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Oligonucleotides used for real-time PCR

 
Quantitation of succinoglycan production. Early-stationary-phase cultures grown in MGM low-phosphate medium to an OD600 of 1.0 were centrifuged at 4°C for 15 min at 3,220 x g. The total carbohydrate concentration of the exopolysaccharide-containing supernatant was assayed using the anthrone-H2SO4 method (52). The amount of carbohydrate was normalized to the protein concentration of its corresponding cell pellet, which was determined using a Bio-Rad detergent-compatible protein assay. The average and standard deviations for each strain were calculated from the results of three independent cultures.

Molecular weight profile. Strains were subcultured 1:100 in 250 ml of MGM low-phosphate medium in a 1-liter flask and incubated at 30°C with constant shaking until they reached an OD600 of 1.0 to 1.1. Cells were harvested by centrifugation at 16,000 x g for 16 min. Cell pellets were washed four times in 20 mM sodium phosphate (pH 7.4)-10 mM sodium chloride buffer. The cell suspension was transferred to a 5-ml flask and incubated with 60 µCi of D-[U-14C]glucose for 5 h with constant shaking at 30°C. Samples were boiled at 100°C for 5 min and then placed on ice for 15 min. The supernatant was recovered from the pellet by centrifugation at 20,000 x g at 4°C for 15 min. Succinoglycan (300 µl) was fractionated by column chromatography (1 by 100 cm) using Bio-Gel P-6 (fine mesh; Bio-Rad) preequilibrated and eluted with pyridinum acetate buffer (0.1 M; pH 5.0) (35). Fractions were collected, and radioactivity was detected by liquid scintillation counting in a Beckman LS6500 scintillation counter.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The ExpR/Sin quorum-sensing system regulates exo gene expression. The ExpR/Sin quorum-sensing system regulates more than 200 genes involved in both free-living and symbiotic functions (37). Previously, our laboratory conducted genome-wide expression studies of S. meliloti and various quorum-sensing-defective derivatives. These strains were grown in a low-phosphate medium and harvested at the mid-logarithmic growth phase (37). These conditions were chosen because quorum-sensing-controlled genes, such as the exp genes involved in the synthesis of EPS II, have been shown to be optimally expressed in a low-phosphate medium which mimics the conditions often found in the soil environment (47, 50, 63, 77). We recently expanded our study of quorum sensing in S. meliloti by conducting further expression analyses using an Affymetrix GeneChip microarray to ascertain differentially expressed genes in the presence (wild type [WT]) and absence (expR) of the ExpR regulator and in the presence and absence of SinI, the autoinducer synthase responsible for the production of the sin AHLs. In addition, we harvested the cultures at mid-logarithmic (OD600 of 0.8) and early stationary phase (OD600 of 1.2). The data obtained in this analysis confirmed many of the observations previously obtained at an OD600 of 0.8 using an Sm6kOligo spotted microarray (37; also N. Gurich and J. González, unpublished data). There was a clear correlation between the Affymetrix and the Sm6kOligo spotted array with respect to the genes that were highly differentiated. For example, exsH, a gene that encodes an endo-1,3-1,4-ß-glycanase responsible for the production of LMW succinoglycan (75), was flagged in both microarray analyses. Interestingly, due to the higher sensitivity of the Affymetrix array, additional genes were found to be quorum sensing dependent. Among these were some of the exo genes responsible for succinoglycan synthesis. Table 3 summarizes the differential expression of genes involved in succinoglycan biosynthesis from the microarray data gathered at mid-logarithmic and early stationary phase.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Gene analysis of the microarray data

 
The genome-wide expression analysis indicates that the ExpR/Sin quorum-sensing system may play a role in the regulation of exsH at both mid-logarithmic and early stationary phase. To verify the microarray data, we created a lacZ transcriptional fusion to exsH and transduced the fusion into the appropriate strains (WT, sinI, expR, and expR sinI strains). Gene expression was then assayed in cells grown to mid-logarithmic phase (OD600 of 0.8) in low-phosphate medium to determine if the regulation of exsH is mediated by the sin AHLs and/or the ExpR regulator. The exsH-lacZ fusion showed a low level of expression in the absence of the ExpR regulator, irrespective of the presence or absence of the sin AHLs (Fig. 1A). On the other hand, in the presence of ExpR, expression of the exsH-lacZ fusion increased in a strain capable of producing sin AHLs (Fig. 1A). This correlates with the data obtained from the microarray studies and shows that expression of exsH is optimal in the presence of both ExpR and the sin AHLs. Further expression studies of exsH were performed utilizing real-time PCR to more sensitively assess the expression at both mid-logarithmic and early stationary phase. At mid-logarithmic phase (OD600 of 0.8), a 12- to 17-fold increase in expression of exsH was observed in the presence of the ExpR regulator and the sin AHLs with regard to the quorum-sensing mutants (Table 4). Correspondingly, an increase of 20- to 23-fold in expression of exsH was also observed in the presence of ExpR and the sin AHLs compared to the quorum-sensing mutants at early stationary phase (OD600 of 1.2) (Table 4). These results correlate with our ß-galactosidase assays above and suggest that full expression of exsH occurs in the presence of an intact ExpR/Sin quorum-sensing system.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

  		FIG. 1. Role of the ExpR/Sin quorum-sensing system on exsH gene expression. (A) ß-Galactosidase levels were measured in strains carrying exsH-lacZ fusions in the WT, expR, or sinI backgrounds. (B) Activity of the exsH-lacZ fusion in the sinI or expR sinI background was measured in the presence of a sinI-complementing plasmid (pJNSinI) or vector alone (pJN105). (C) Activity of the exsH-lacZ fusion in the expR or expR sinI background was measured in the presence of the expR-complementing plasmid (pSWExpR) or vector alone (pSW213).

 

View this table:
[in this window]
[in a new window]

  		TABLE 4. Expression analysis of ExpR/Sin quorum-sensing-regulated genes

 
We performed complementation studies to determine if expression of exsH could be restored by a functional copy of sinI provided in trans. The pJNSinI plasmid or the pJN105 vector alone was transferred into the sinI or the expR sinI mutants containing the exsH-lacZ transcriptional fusion. Expression of the exsH-lacZ fusion was restored to WT levels only in the presence of the ExpR regulator (Fig. 1B). We also assayed expression of exsH in the expR and expR sinI mutants in the presence of the ExpR-complementing plasmid pSWExpR or the pSW213 vector alone. Similar to the previous complementation studies, expression of exsH was restored when expR was supplied in trans in the expR mutant but not in the expR sinI derivative (Fig. 1C). This further confirms that both the sin AHLs and the ExpR regulator are necessary for full expression of exsH.

We continued our analysis of the entire exo gene cluster in order to examine if additional exo genes were regulated by quorum sensing. Figure 2 illustrates the exo gene cluster and the genes that were shown to be regulated by quorum sensing. Table 4 lists the genes differentially expressed by the ExpR/Sin quorum-sensing system. exoI, a gene whose function has yet to be determined (7, 32), showed an increase in expression in the presence of the ExpR/Sin quorum-sensing system at mid-logarithmic and early stationary phase. The expression studies also elucidated a group of exo genes showing differential expression in the presence of an intact quorum-sensing system compared to a sinI mutant only at mid-logarithmic phase (Table 4). For example, exoK, another endo-1,3-1,4-ß-glycanase that depolymerizes HMW succinoglycan (32, 75), displayed an almost fivefold increase in expression specifically at mid-logarithmic growth. Similarly, expression was also increased at the mid-logarithmic growth phase in WT versus sinI strain for the exoL, exoA, and exoO genes, all of which encode glucosyltransferases (6, 31, 61). exoN and exoH, which encode a UDP-glucose pyrophosphorylase and a succinyltransferase (6, 32), respectively, also display increased expression in the WT strain with respect to sinI. These studies confirmed that, indeed, various exo genes are moderately controlled by the ExpR/Sin quorum-sensing system.


Figure 2
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 2. Illustration of the exo region. The genes flagged as differentially expressed by microarray studies and real-time PCR analyses are shown in bold.

 
Succinoglycan production is increased in the presence of the ExpR/Sin quorum-sensing system. The finding that particular genes involved in the biosynthesis of succinoglycan appear to be regulated by the ExpR/Sin quorum-sensing system (Fig. 2 and Table 4) led us to investigate if overall levels of succinoglycan production would be controlled by quorum sensing. We measured the overall succinoglycan biosynthesis by quantifying exopolysaccharide production using the anthrone-H2SO4 assay (52). In order to quantify solely succinoglycan production in the WT strains, an expA mutation was introduced to block EPS II production. In low-phosphate medium, WT and expR strains produce equivalent amounts of succinoglycan (Fig. 3). A slight decrease in succinoglycan production is observed when a sinI mutation is introduced into the expR strain (Fig. 3). Interestingly, a sinI mutation in the presence of the ExpR regulator shows almost a fivefold decrease in succinoglycan production (Fig. 3). We complemented the sinI mutant with the pJNSinI plasmid to see if we could restore succinoglycan production. Indeed, addition of sinI in trans restores succinoglycan back to WT levels (Fig. 3). In the presence of the vector alone (pJN105), succinoglycan production was unaffected (Fig. 3). This suggests that the sin AHLs, in conjunction with ExpR, play a role in the overall production of this polymer. The data generated from the succinoglycan assays correlate with the observation that expression of particular succinoglycan biosynthesis genes decreases in the sinI mutant, suggesting that succinoglycan production is directly or indirectly regulated by the ExpR/Sin quorum-sensing system but only in the presence of the ExpR regulator.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 3. Succinoglycan production of S. meliloti strains containing or lacking one or more of the components of the ExpR/Sin quorum-sensing system. In WT derivatives, an expA mutation was introduced to block EPS II production. As described in Materials and Methods, exopolysaccharides were isolated from the supernatant, and the total succinoglycan content was determined by the anthrone-H2SO4 assay (52). The amount of succinoglycan was normalized to the protein concentration.

 
LMW succinoglycan production is regulated by the ExpR/Sin quorum-sensing system. We have shown that a sinI mutant produces less succinoglycan and has lower expression of specific exo genes than a strain containing an intact quorum-sensing system. Some of these genes are known to be involved in the production of LMW succinoglycan. These genes include exoH, whose gene product encodes a succinyltransferase necessary for the depolymerization of succinoglycan, as well as the endo-1,3-1,4-ß-glycanase, exoK (32, 74-76). Expression of exsH, the other endoglycanase responsible for LMW succinoglycan production, appears to be maximally expressed in an intact ExpR/Sin quorum-sensing system in mid-logarithmic and early stationary phase. A well-characterized assay utilizing calcofluor allows us to visualize the presence of succinoglycan under UV light and differentiate between its HMW and LMW forms (18, 28, 44, 75). Fluorescent halos surrounding S. meliloti colonies appear due to the diffusion of LMW succinoglycan into the medium (28, 44, 75). In order to assess if the ExpR/Sin quorum-sensing system regulates the generation of LMW succinoglycan, cultures from relevant strains of S. meliloti were spotted on calcofluor-containing medium and incubated over a period of time. An expA mutation was introduced into the strains that contain an intact expR gene in order to observe the fluorescence of succinoglycan without the mucoid interference of EPS II.

The WT strain began to produce a bright fluorescent halo beginning at day 2 and continued to diffuse through the medium during the incubation process (Fig. 4). The presence of the exsH mutation did not affect the production of the fluorescent halo over the course of time. The introduction of an exoK mutation resulted in a halo delay phenotype (Fig. 4). The fluorescent halo began to develop at day 5. The exsH exoK mutant resulted in a haloless phenotype throughout the incubation period, indicating that these two glycanases contribute to the majority of the LMW succinoglycan diffusion away from the colonies (Fig. 4).


Figure 4
View larger version (93K):
[in this window]
[in a new window]

  		FIG. 4. Calcofluor halo phenotypes of various S. meliloti derivatives. An expA mutation was introduced in the WT strain derivatives to block EPS II production. LMW succinoglycan is visualized as a fluorescent halo surrounding the colonies that develops over time.

 
A sinI mutant showed a slight halo delay (day 3), suggesting an initial decrease in the production of LMW succinoglycan (Fig. 4). The sinI exsH mutant has slightly less overall halo (Fig. 4). Interestingly, the sinI exoK mutant produces a haloless phenotype parallel to that of a double glycanase exsH exoK mutant (Fig. 4). This suggests that expression of exsH is decreased in the absence of sinI, resulting in a loss of LMW succinoglycan. The halo assays were also performed in the absence of the ExpR regulator (Fig. 5). An initial halo delay was observed until day 3 in the expR mutant, but the fluorescent halo began to develop and diffuse around the colony as the incubation period progressed (Fig. 5). The addition of an exsH mutation did not alter halo development in comparison with the expR mutant (Fig. 5). An expR exoK mutant resulted in a haloless phenotype as did an expR exsH exoK mutant (Fig. 5). The addition of a sinI mutation in any of the expR derivatives did not alter the halo phenotype of the exoK mutant, suggesting that in the absence of the ExpR regulator, the sin AHLs do not contribute to the production of LMW succinoglycan.


Figure 5
View larger version (81K):
[in this window]
[in a new window]

  		FIG. 5. Calcofluor halo phenotypes of various S. meliloti expR derivatives. LMW succinoglycan is visualized as a fluorescent halo surrounding the colonies that develops over time.

 
The gene expression data suggested that the ExpR/Sin quorum-sensing system may be involved in the expression of exsH and, to a lesser extent, exoK, two genes whose products are involved in the depolymerization of HMW succinoglycan (75). In addition, our observations of the calcofluor halo phenotypes suggest that the production of LMW succinoglycan may be affected by the ExpR/Sin quorum-sensing system. Therefore, we determined the molecular weight profile of succinoglycan from the relevant strains grown in low-phosphate medium to determine if the production of HMW and LMW succinoglycan is altered in a quorum-sensing mutant. For the strains containing an intact expR, an expA mutation was introduced to allow observation of the molecular weight profile of succinoglycan alone without contribution from EPS II. Cells were harvested and radiolabeled with D-[U-14C]glucose (see Material and Methods). The succinoglycan-containing supernatant was fractionated using gel filtration chromatography to separate the HMW and LMW forms of the exopolysaccharide.

The molecular weight profile of the WT strain showed a distribution of 20% HMW succinoglycan and 80% LMW succinoglycan (Fig. 6A). Succinoglycan recovered from the exsH mutant did not show an appreciable increase in HMW succinoglycan (Fig. 6B), suggesting that the remaining glycanase, ExoK, was sufficient to depolymerize succinoglycan. In the exoK mutant, our analysis of the molecular weight profile led to the interesting observation that the monomer peak decreases significantly (Fig. 6C). Previous work to characterize the molecular weight profile of succinoglycan used primarily Bio-gel A5 column chromatography, which has the capability only to resolve HMW from the LMW fractions of succinoglycan and cannot separate the individual LMW forms (75). By using P6 column chromatography, we were able to further separate LMW succinoglycan into its fractions of monomer, dimer, and trimer, enabling us to detect the loss of monomer in the exoK mutants. Although the monomer peak was reduced, the overall percentages of HMW and LMW succinoglycan were 23% and 77%, respectively, in the presence of ExpR. Interestingly, we determined that a sinI mutation in the presence of an intact ExpR resulted in a doubling of the amount of HMW succinoglycan (40%) produced by that strain (Fig. 6D), suggesting a role for quorum sensing in the production of LMW succinoglycan.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 6. Chromatographic separation of [14C]glucose-labeled succinoglycan from the supernatants of S. meliloti derivatives. All WT strains carried the expA mutation to block EPS II synthesis. The ratio of HMW to LMW [14C]glucose-labeled succinoglycan expressed as a percentage of total molecular weight is included in the upper left-hand corner of each graph. Fractions 30 to 40 represent HMW succinoglycan, and fractions 41 to 65 represent LMW succinoglycan. LMW succinoglycan is further divided into trimer (fractions 41 to 45), dimer (fractions 46 to 57), and monomer (fractions 58 to 65). The data represent averages of at least two independent cultures. The standard deviation is ≤4%.

 
We determined the molecular weight profile of succinoglycan in the absence of expR. We observed a ratio of 22% to 78% for HMW to LMW succinoglycan, respectively, produced by this strain (Fig. 6E). In the absence of ExpR, mutations in either of the glycanases leads to a pronounced increase in HMW succinoglycan compared to derivatives lacking the gene (Fig. 6F and G). As in the WT background, we also observed a decrease in the monomer fractions of succinoglycan in the exoK mutant. The introduction of a sinI mutation in the absence of the ExpR regulator did not change the ratio of HMW to LMW succinoglycan, 24% HMW to 76% LMW succinoglycan (Fig. 6H), suggesting that in the absence of ExpR, the sin AHLs do not play a role in the generation of LMW succinoglycan. Complementation studies with the sinI gene in trans restored exsH-lacZ expression and overall succinoglycan production levels back to WT in the respective sinI mutants (see above). We also set out to determine if we could restore the percentage of LMW succinoglycan to that of the WT strain by providing a functional copy of sinI in trans. As expected, the levels of LMW succinoglycan increased at the expense of the HMW polymer when sinI was provided in trans in a sinI-defective derivative (Fig. 7A). We did not observe a change in the ratio of HMW to LMW succinoglycan with the vector alone (Fig. 7B), suggesting that the sinI gene in the presence of the ExpR regulator contributes to the production of LMW succinoglycan.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 7. LMW succinoglycan production is restored when complemented in trans with a sinI gene. (A) A sinI strain containing the complementing plasmid pJNSinI. (B) A sinI strain containing vector alone (pJN105). The ratio of HMW to LMW [14C]glucose-labeled succinoglycan expressed as a percentage of total molecular weight is included in the upper left-hand corner of each graph. Fractions 30 to 40 represent HMW succinoglycan, and fractions 41 to 65 represent LMW succinoglycan. LMW succinoglycan is further divided into trimer (fractions 41 to 45), dimer (fractions 46 to 57), and monomer (fractions 58 to 65). The data represent averages of at least two independent cultures. The standard deviation is ≤4%.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The ExpR/Sin quorum-sensing system plays an important role in regulating genes that are important to free-living as well as symbiotic processes in S. meliloti (37). Previous work has shown that the ExpR/Sin quorum-sensing system regulates particular exp genes involved in EPS II production (47, 57). We show here that this quorum-sensing system is also involved in the production of succinoglycan, another symbiotically important exopolysaccharide. Our genome-wide expression studies performed at mid-logarithmic and early stationary phase in S. meliloti derivatives showed that specific genes involved in succinoglycan biosynthesis were regulated by the ExpR/Sin quorum-sensing system. Our gene expression analyses confirmed these observations. A particular region of the exo gene cluster, including exoL, exoA, exoO, and exoN, was upregulated in the ExpR/Sin quorum-sensing system with respect to the sinI mutant. This upregulation was specifically observed at mid-logarithmic phase. exoA, exoL, and exoO encode glucosyltransferases that add the first, second, and fourth glucose residues, respectively, to the building octasaccharide subunit (6, 31, 61). Mutations in any of these genes result in the loss of succinoglycan production (46). exoN encodes a UDP-glucose pyrophosphorylase, and mutants in this gene have been found to synthesize a reduced amount of succinoglycan (6, 32). The residual amount of succinoglycan is presumably due to the presence of a redundant gene on the chromosome (32). The strong influence of quorum sensing on exoI expression is interesting. exoI is proposed to encode a small periplasmic protein involved in succinoglycan biosynthesis; however, its function is still unknown (7, 32). Mutants in this gene are unaffected in succinoglycan production (32).

Since various genes involved in succinoglycan biosynthesis were shown to be upregulated by the ExpR/Sin quorum-sensing system, we explored the possibility that it may play a role in the amount of succinoglycan produced. We quantified succinoglycan biosynthesis in the presence and absence of expR and/or sinI. In the sinI mutant, there was almost a fivefold reduction in the amount of succinoglycan produced compared to a strain with an intact quorum-sensing system. This decrease was not observed in the expR or in the expR sinI mutant. In the presence of ExpR, the sin AHLs seem to be required for maximal production of succinoglycan. The data correlate with our observations that in the absence of sinI but in the presence of expR, expression of exoL, exoA, exoO, and exoN decreases. The increase in gene expression and the increase in succinoglycan production are, again, dependent on the presence of both ExpR and the sin AHLs. This may explain why an ExpR/Sin quorum-sensing effect was not initially observed for succinoglycan as it was with EPS II. EPS II production is completely abolished by a mutation in any of the exp genes or by a mutation in the ExpR/Sin quorum-sensing system (11, 47, 57). This is easily observed due to the high level of mucoidy produced by EPS II. The ExpR/Sin quorum-sensing system does not turn on or off succinoglycan production as it does with EPS II but, rather, appears to modulate its synthesis through the ExpR regulator in conjunction with the sin AHLs. In the absence of the ExpR regulator, production of succinoglycan remains high and unaffected by the sin AHLs, suggesting that in this context, biosynthesis of succinoglycan becomes independent of quorum-sensing control. One possible explanation for these observations is that ExpR acts as a repressor of succinoglycan biosynthesis in the absence of the sin AHLs. In the absence of ExpR, repression does not occur.

The ExpR/Sin quorum-sensing system is also involved in the production of LMW succinoglycan. We observed the upregulation of exoH, exoK, and exsH in the presence of the ExpR/Sin quorum-sensing system compared to the sinI mutant. exoH encodes the succinyltransferase responsible for the addition of succinyl modifications to the octasaccharide subunit of succinoglycan (6, 32, 43). Mutants in exoH produce only HMW succinoglycan, which can be observed as a haloless colony on calcofluor-containing plates (42, 43, 46). These mutants yield a Fix– phenotype on alfalfa plants, demonstrating the essential role of LMW succinoglycan in invasion (32, 46). Expression of exoK and exsH also decreased in the sinI mutant with respect to the WT strain at mid-logarithmic phase. Moreover, our exsH-lacZ fusion and real-time PCR analysis showed a decrease in exsH expression in the absence of any of the ExpR/Sin quorum-sensing components. Therefore, the ExpR/Sin quorum-sensing system appears to regulate steps in the building of the octasaccharide subunit, the modifications important for the production of LMW succinoglycan as well as glycanases responsible for the depolymerization of the polymer. Based on these findings, one may speculate that quorum sensing may play a fine-tuning role in the overall synthesis of succinoglycan at specific instances during the symbiotic process.

We performed our genetic analyses in the presence and absence of not only ExpR but also the sin AHLs and continued our analyses of LMW succinoglycan production in low-phosphate medium to mimic the environment S. meliloti may encounter in the soil. We observed development of a calcofluor halo surrounding the colony of the WT strain at day 2 and continuing through day 11, leading to a large diffuse halo. A delay in the production of the halo phenotype occurred until day 3 for the sinI, expR, and expR sinI mutants. This suggests that the absence of some of the component(s) of the ExpR/Sin quorum-sensing system has a detrimental effect on the generation of LMW succinoglycan. Previous studies have shown that, in the absence of both exsH and exoK, colonies are unable to produce calcofluor fluorescent halos (75). As expected, when we observed the exsH exoK glycanase mutants in the presence or absence of expR and/or sinI, our colonies produced haloless phenotypes. Interestingly, we also observed a haloless phenotype in strains missing the exoK allele in conjunction with expR and sinI or in the absence of both expR and the sin AHLs. These findings suggest that the contribution of LMW succinoglycan by ExsH is largely dependent on the ExpR/Sin quorum-sensing system.

We observed an interesting colony morphology while growing our mutants on solid medium. The exsH exoK mutants developed a wrinkled, rugose colony morphology on minimal medium after a period of days. This phenotype was independent of the presence or absence of the ExpR/Sin quorum-sensing system, though the phenotype was most dramatic in the WT strain. The reason for this colony morphology is yet to be determined. It is interesting, however, that similar phenotypes have been linked to biofilm production (22, 26, 73). Biofilms have recently been shown to occur in Rhizobia (23, 62, 65). In Rhizobium leguminosarum, the PrsD-PrsE secretion system was shown to be involved in biofilm production (65). This type I secretion system is responsible for the secretion of two glycanases, PlyA and PlyB, needed for exopolysaccharide depolymerization (19, 20). A mutation in plyB resulted in a reduction in biofilm formation, suggesting that this glycanase plays a role possibly by generating the correct size of exopolysaccharide required for biofilm establishment (65). In S. meliloti, ExsH is secreted by the PrsD-PrsE secretion system (75). Whether ExsH or ExoK contributes to biofilm production in S. meliloti is currently under investigation.

We examined the ratio of HMW to LMW succinoglycan in the presence of ExpR, without contribution of EPS II. We observed a large amount of LMW succinoglycan isolated under these conditions. The introduction of a sinI mutation in the presence of ExpR led to a doubling in the amount of HMW succinoglycan recovered at the expense of the LMW form. In the absence of the ExpR regulator or in the expR sinI mutant, the LMW fraction of succinoglycan did not decrease with respect to WT, suggesting that the sin AHLs do not play a role in LMW succinoglycan production when ExpR is absent. In the presence of ExpR, an exsH or exoK mutation did not alter the ratio of HMW to LMW succinoglycan, indicating a compensatory effect between these two enzymes in the WT strain. We examined the glycanase mutants in the absence of expR and found that a mutation in exsH or exoK led to an increase in HMW succinoglycan. It appears that, in the absence of the ExpR regulator, this compensation does not take place. It remains to be determined if quorum sensing plays a role directly in this balancing effect or indirectly through a yet to be identified effector.

Succinoglycan biosynthesis, although well characterized, has a complex regulatory network. Many genes as well as environmental factors have been shown to play a role in its production (10, 21, 67). For instance, under limiting nitrogen conditions, succinoglycan production increases (17). The ratio of HMW to LMW succinoglycan can also differ depending on osmolarity conditions (12, 54). The products of various genes negatively regulate succinoglycan production, including ExoR, ExoX, ExsB, and, as reported more recently, CbrA (8, 16, 17, 28, 58, 72, 78). Positive regulators of succinoglycan biosynthesis include the ExoS-ChvI system, ExoD, MucR, and SyrM (15-17, 39, 59, 72). The large number of regulators involved in not only succinoglycan biosynthesis but also its molecular weight determination speaks of the importance the bacteria places on the production of this exopolysaccharide. We do not have evidence that quorum sensing regulates the expression of any of the previously identified regulators of succinoglycan. It seems that quorum sensing represents an additional layer in this complex regulatory network.

Also of interest is the molecular weight analysis of succinoglycan produced in strains lacking ExoK. Due to the higher resolution of our separation methods, we found that the fractions corresponding to monomer were significantly reduced. We observed this altered profile in all derivatives containing the exoK mutation independent of quorum sensing. In light of these findings, it is tempting to draw a correlation between the halo delay phenotype of the exoK mutant and the lack of monomer. The monomer fraction may readily diffuse into the agar, allowing for the observable calcofluor halo phenotype. In the absence of ExoK, a calcofluor halo eventually develops, which may be because the remaining glycanase activity of ExsH leads to the production of monomer. Our gel filtration chromatography methods also allowed us to observe an increase in the amount of the trimer fraction isolated from the exoK mutant. The trimer fraction has been shown to play a role in nodule invasion (70). This suggests the interesting notion that specific glycanases may contribute to particular LMW fractions of succinoglycan. Quorum sensing may act, in ways yet to be determined, as a regulator of the final amount of glycanase activity in the cell and, as a consequence, may play a role in the production of particular LMW fractions of succinoglycan.

The ExpR regulator, in conjunction with the sin AHLs, appears to play an important role in many cell functions, although the mechanism of regulation has not yet been elucidated (37). Interestingly, the S. meliloti strain most commonly used for symbiotic interaction studies is Rm1021, which lacks the expR gene. It is the genome of this strain that was sequenced (2, 13, 25), and its genome is also featured in two different microarray technologies (3, 64). Unfortunately, it seems that this strain may have accumulated through the years some defects that influence the regulation of important bacterial phenotypes, many of them implicated in the symbiotic interaction with its host. For example, Rm1021 has lost its ability to naturally produce EPS II, an exopolysaccharide that plays a role in nodule invasion (30, 56, 57). We report here that it also seems to have lost the fine-tuning control of succinoglycan biosynthesis and the production of its symbiotically important LMW fraction. In addition, we have evidence that key processes such as motility (H. Hoang et al., unpublished data), nitrogen utilization (N. Gurich and J. González, unpublished data), and others are not properly regulated in this strain. Most of these defects can be attributed to the disruption by an insertion sequence of the expR gene, a quorum-sensing regulator that seems to work in conjunction with the sin AHLs (47, 57). This gene is intact and active in most natural strains examined (57). Rm1021 has also lost a plasmid (pRme41a) normally present in natural isolates and also found in Rm41, another commonly used WT derivative (33, 69). The strain also lacks the proper size of the capsular polysaccharide (KPS), shown to be sufficient for nodule invasion in strain Rm41 (40, 66). Despite these defects, Rm1021 can still form a successful symbiotic interaction with its host, at least under laboratory conditions. It seems that Rm1021 has compensated for the lack of the ExpR/Sin quorum-sensing system, pRme41a, and perhaps other shortcomings.


   ACKNOWLEDGMENTS
 
We thank the members of our laboratory for helpful discussions and critical reading of the manuscript. We also thank Audry Almengor for the construction of pJNSinI.

This work was supported by National Science Foundation grant MCB-9733532 to J.E.G. and National Institutes of Health grant 1R01GM069925 to J.E.G.


   FOOTNOTES
 
* Corresponding author. Mailing Address: Department of Molecular and Cell Biology, University of Texas at Dallas, RL 11, Richardson, TX 75083-0688. Phone: (972) 883-2526. Fax: (630) 604-3093. E-mail: jgonzal{at}utdallas.edu Back

{triangledown} Published ahead of print on 20 July 2007. Back

{dagger} Present address: Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115. Back


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Aman, P., M. McNeil, L.-E. Franzen, A. G. Darvill, and P. Albersheim. 1981. Structural elucidation, using H.P.L.C.-M.S. and G. L. C.-M.S. of the acidic polysaccharide secreted by Rhizobium meliloti strain 1021. Carbohydr. Res. 95:263-282.[CrossRef]
  2. Barnett, M. J., R. F. Fisher, T. Jones, C. Komp, A. P. Abola, F. Barloy-Hubler, L. Bowser, D. Capela, F. Galibert, J. Gouzy, M. Gurjal, A. Hong, L. Huizar, R. W. Hyman, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, C. Palm, M. C. Peck, R. Surzycki, D. H. Wells, K. C. Yeh, R. W. Davis, N. A. Federspiel, and S. R. Long. 2001. Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA 98:9883-9888.[Abstract/Free Full Text]
  3. Barnett, M. J., C. J. Toman, R. F. Fisher, and S. R. Long. 2004. A dual-genome symbiosis chip for coordinate study of signal exchange and development in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA 101:16636-16641.[Abstract/Free Full Text]
  4. Battisti, L., J. C. Lara, and J. A. Leigh. 1992. Specific oligosaccharide form of the Rhizobium meliloti exopolysaccharide promotes nodule invasion in alfalfa. Proc. Natl. Acad. Sci. USA 89:5625-5629.[Abstract/Free Full Text]
  5. Becker, A., A. Kleickmann, W. Arnold, and A. Pühler. 1993. Analysis of the Rhizobium meliloti exoH/exoK/exoL fragment: ExoK shows homology to excreted endo-beta-1,3-1,4-glucanases and ExoH resembles membrane proteins. Mol. Gen. Genet. 238:145-154.[Medline]
  6. Becker, A., A. Kleickmann, M. Keller, W. Arnold, and A. Pühler. 1993. Identification and analysis of the Rhizobium meliloti exoAMNOP genes involved in exopolysaccharide biosynthesis and mapping of promoters located on the exoHKLAMONP fragment. Mol. Gen. Genet. 241:367-379.[Medline]
  7. Becker, A., A. Kleickmann, H. Kuster, M. Keller, W. Arnold, and A. Pühler. 1993. Analysis of the Rhizobium meliloti genes exoU, exoV, exoW, exoT, and exoI involved in exopolysaccharide biosynthesis and nodule invasion: exoU and exoW probably encode glucosyltransferases. Mol. Plant-Microbe Interact. 6:735-744.[Medline]
  8. Becker, A., H. Kuster, K. Niehaus, and A. Pühler. 1995. Extension of the Rhizobium meliloti succinoglycan biosynthesis gene cluster: identification of the exsA gene encoding an ABC transporter protein, and the exsB gene which probably codes for a regulator of succinoglycan biosynthesis. Mol. Gen. Genet. 249:487-497.[CrossRef][Medline]
  9. Becker, A., K. Niehaus, and A. Pühler. 1995. Low-molecular-weight succinoglycan is predominantly produced by Rhizobium meliloti strains carrying a mutated ExoP protein characterized by a periplasmic N-terminal domain and a missing C-terminal domain. Mol. Microbiol. 16:191-203.[CrossRef][Medline]
  10. Becker, A., S. Ruberg, B. Baumgarth, P. A. Bertram-Drogatz, I. Quester, and A. Pühler. 2002. Regulation of succinoglycan and galactoglucan biosynthesis in Sinorhizobium meliloti. J. Mol. Microbiol. Biotechnol. 4:187-190.[Medline]
  11. Becker, A., S. Ruberg, H. Kuster, A. A. Roxlau, M. Keller, T. Ivashina, H. P. Cheng, G. C. Walker, and A. Pühler. 1997. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products. J. Bacteriol. 179:1375-1384.[Abstract/Free Full Text]
  12. Breedveld, M. W., L. P. T. M. Zevenhuizen, and A. J. B. Zehnder. 1990. Osmotically induced oligo- and polysaccharide synthesis by Rhizobium meliloti SU-47. J Gen. Microbiol. 136:2511-2519.
  13. Capela, D., F. Barloy-Hubler, J. Gouzy, G. Bothe, F. Ampe, J. Batut, P. Boistard, A. Becker, M. Boutry, E. Cadieu, S. Dreano, S. Gloux, T. Godrie, A. Goffeau, D. Kahn, E. Kiss, V. Lelaure, D. Masuy, T. Pohl, D. Portetelle, A. Pühler, B. Purnelle, U. Ramsperger, C. Renard, P. Thebault, M. Vandenbol, S. Weidner, and F. Galibert. 2001. Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti strain 1021. Proc. Natl. Acad. Sci. USA 98:9877-9882.[Abstract/Free Full Text]
  14. Chen, C. Y., and S. C. Winans. 1991. Controlled expression of the transcriptional activator gene virG in Agrobacterium tumefaciens by using the Escherichia coli lac promoter. J. Bacteriol. 173:1139-1144.[Abstract/Free Full Text]
  15. Cheng, H. P., and G. C. Walker. 1998. Succinoglycan production by Rhizobium meliloti is regulated through the ExoS-ChvI two-component regulatory system. J. Bacteriol. 180:20-26.[Abstract/Free Full Text]
  16. Cheng, H. P., and S. Y. Yao. 2004. The key Sinorhizobium meliloti succinoglycan biosynthesis gene exoY is expressed from two promoters. FEMS Microbiol. Lett. 231:131-136.[CrossRef][Medline]
  17. Doherty, D., J. A. Leigh, J. Glazebrook, and G. C. Walker. 1988. Rhizobium meliloti mutants that overproduce the R. meliloti acidic calcofluor-binding exopolysaccharide. J. Bacteriol. 170:4249-4256.[Abstract/Free Full Text]
  18. Finan, T. M., A. M. Hirsch, J. A. Leigh, E. Johansen, G. A. Kuldau, S. Deegan, G. C. Walker, and E. R. Signer. 1985. Symbiotic mutants of Rhizobium meliloti that uncouple plant from bacterial differentiation. Cell 40:869-877.[CrossRef][Medline]
  19. Finnie, C., N. M. Hartley, K. C. Findlay, and J. A. Downie. 1997. The Rhizobium leguminosarum prsDE genes are required for secretion of several proteins, some of which influence nodulation, symbiotic nitrogen fixation and exopolysaccharide modification. Mol. Microbiol. 25:135-146.[CrossRef][Medline]
  20. Finnie, C., A. Zorreguieta, N. M. Hartley, and J. A. Downie. 1998. Characterization of Rhizobium leguminosarum exopolysaccharide glycanases that are secreted via a type I exporter and have a novel heptapeptide repeat motif. J. Bacteriol. 180:1691-1699.[Abstract/Free Full Text]
  21. Fraysse, N., F. Couderc, and V. Poinsot. 2003. Surface polysaccharide involvement in establishing the Rhizobium-legume symbiosis. Eur. J. Biochem. 270:1365-1380.[Medline]
  22. Friedman, L., and R. Kolter. 2004. Two genetic loci produce distinct carbohydrate-rich structural components of the Pseudomonas aeruginosa biofilm matrix. J. Bacteriol. 186:4457-4465.[Abstract/Free Full Text]
  23. Fujishige, N. A., N. N. Kapadia, P. L. De Hoff, and A. M. Hirsch. 2006. Investigations of Rhizobium biofilm formation. FEMS Microbiol. Ecol. 56:195-206.[CrossRef][Medline]
  24. Gage, D. J. 2004. Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol. Mol. Biol Rev. 68:280-300.[Abstract/Free Full Text]
  25. Galibert, F., T. M. Finan, S. R. Long, A. Pühler, P. Abola, F. Ampe, F. Barloy-Hubler, M. J. Barnett, A. Becker, P. Boistard, G. Bothe, M. Boutry, L. Bowser, J. Buhrmester, E. Cadieu, D. Capela, P. Chain, A. Cowie, R. W. Davis, S. Dreano, N. A. Federspiel, R. F. Fisher, S. Gloux, T. Godrie, A. Goffeau, B. Golding, J. Gouzy, M. Gurjal, I. Hernandez-Lucas, A. Hong, L. Huizar, R. W. Hyman, T. Jones, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, E. Kiss, C. Komp, V. Lelaure, D. Masuy, C. Palm, M. C. Peck, T. M. Pohl, D. Portetelle, B. Purnelle, U. Ramsperger, R. Surzycki, P. Thebault, M. Vandenbol, F. J. Vorholter, S. Weidner, D. H. Wells, K. Wong, K. C. Yeh, and J. Batut. 2001. The composite genome of the legume symbiont Sinorhizobium meliloti. Science 293:668-672.[Abstract/Free Full Text]
  26. Garcia, B., C. Latasa, C. Solano, F. Garcia-del Portillo, C. Gamazo, and I. Lasa. 2004. Role of the GGDEF protein family in Salmonella cellulose biosynthesis and biofilm formation. Mol. Microbiol. 54:264-277.[CrossRef][Medline]
  27. Geurts, R., E. Fedorova, and T. Bisseling. 2005. Nod factor signaling genes and their function in the early stages of Rhizobium infection. Curr. Opin. Plant Biol. 8:346-352.[CrossRef][Medline]
  28. Gibson, K. E., G. R. Campbell, J. Lloret, and G. C. Walker. 2006. CbrA is a stationary-phase regulator of cell surface physiology and legume symbiosis in Sinorhizobium meliloti. J. Bacteriol. 188:4508-4521.[Abstract/Free Full Text]
  29. Glazebrook, J., and G. C. Walker. 1991. Genetic techniques in Rhizobium meliloti. Methods Enzymol. 204:398-418.[Medline]
  30. Glazebrook, J., and G. C. Walker. 1989. A novel exopolysaccharide can function in place of the calcofluor-binding exopolysaccharide in nodulation of alfalfa by Rhizobium meliloti. Cell 56:661-672.[CrossRef][Medline]
  31. Glucksmann, M. A., T. L. Reuber, and G. C. Walker. 1993. Family of glycosyl transferases needed for the synthesis of succinoglycan by Rhizobium meliloti. J. Bacteriol. 175:7033-7044.[Abstract/Free Full Text]
  32. Glucksmann, M. A., T. L. Reuber, and G. C. Walker. 1993. Genes needed for the modification, polymerization, export, and processing of succinoglycan by Rhizobium meliloti: a model for succinoglycan biosynthesis. J. Bacteriol. 175:7045-7055.[Abstract/Free Full Text]
  33. González, J. E., and M. M. Marketon. 2003. Quorum sensing in nitrogen-fixing rhizobia. Microbiol. Mol. Biol Rev. 67:574-592.[Abstract/Free Full Text]
  34. González, J. E., B. L. Reuhs, and G. C. Walker. 1996. Low-molecular-weight EPS II of Rhizobium meliloti allows nodule invasion in Medicago sativa. Proc. Natl. Acad. Sci. USA 93:8636-8641.[Abstract/Free Full Text]
  35. González, J. E., C. E. Semino, L. X. Wang, L. E. Castellano-Torres, and G. C. Walker. 1998. Biosynthetic control of molecular weight in the polymerization of the octasaccharide subunits of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 95:13477-13482.[Abstract/Free Full Text]
  36. Her, G. R., J. Glazebrook, G. C. Walker, and V. N. Reinhold. 1990. Structural studies of a novel exopolysaccharide produced by a mutant of Rhizobium meliloti strain Rm1021. Carbohydr. Res. 198:305-312.[CrossRef][Medline]
  37. Hoang, H. H., A. Becker, and J. E. González. 2004. The LuxR homolog ExpR, in combination with the Sin quorum-sensing system, plays a central role in Sinorhizobium meliloti gene expression. J. Bacteriol. 186:5460-5472.[Abstract/Free Full Text]
  38. Kalogeraki, V. S., and S. C. Winans. 1997. Suicide plasmids containing promoterless reporter genes can simultaneously disrupt and create fusions to target genes of diverse bacteria. Gene 188:69-75.[CrossRef][Medline]
  39. Keller, M., A. Roxlau, W. M. Weng, M. Schmidt, J. Quandt, N. Karsten, D. Jording, W. Arnold, and A. Pühler. 1995. Molecular analysis of the Rhizobium meliloti mucR gene regulating the biosynthesis of the exopolysaccharides succinoglycan and galactoglucan. Mol. Plant-Microbe Interact. 8:267-277.[Medline]
  40. Kiss, E., A. Kereszt, F. Barta, S. Stephens, B. L. Reuhs, A. Kondorosi, and P. Putnoky. 2001. The rkp-3 gene region of Sinorhizobium meliloti Rm41 contains strain-specific genes that determine K antigen structure. Mol. Plant-Microbe Interact. 14:1395-1403.[Medline]
  41. Krol, E., and A. Becker. 2004. Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011. Mol. Genet. Genomics 272:1-17.[CrossRef][Medline]
  42. Leigh, J. A., and C. C. Lee. 1988. Characterization of polysaccharides of Rhizobium meliloti exo mutants that form ineffective nodules. J. Bacteriol. 170:3327-3332.[Abstract/Free Full Text]
  43. Leigh, J. A., J. W. Reed, J. F. Hanks, A. M. Hirsch, and G. C. Walker. 1987. Rhizobium meliloti mutants that fail to succinylate their calcofluor-binding exopolysaccharide are defective in nodule invasion. Cell 51:579-587.[CrossRef][Medline]
  44. Leigh, J. A., E. R. Signer, and G. C. Walker. 1985. Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 82:6231-6235.[Abstract/Free Full Text]
  45. Llamas, I., N. Keshavan, and J. E. González. 2004. Use of Sinorhizobium meliloti as an indicator for specific detection of long-chain N-acyl homoserine lactones. Appl. Environ. Microbiol. 70:3715-3723.[Abstract/Free Full Text]
  46. Long, S., J. W. Reed, J. Himawan, and G. C. Walker. 1988. Genetic analysis of a cluster of genes required for synthesis of the calcofluor-binding exopolysaccharide of Rhizobium meliloti. J. Bacteriol. 170:4239-4248.[Abstract/Free Full Text]
  47. Marketon, M. M., S. A. Glenn, A. Eberhard, and J. E. González. 2003. Quorum-sensing controls exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 185:325-331.[Abstract/Free Full Text]
  48. Marketon, M. M., and J. E. González. 2002. Identification of two quorum-sensing systems in Sinorhizobium meliloti. J. Bacteriol. 184:3466-3475.[Abstract/Free Full Text]