Previous Article | Next Article 
Journal of Bacteriology, October 2007, p. 7077-7088, Vol. 189, No. 19
0021-9193/07/$08.00+0 doi:10.1128/JB.00906-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
The ExpR/Sin Quorum-Sensing System Controls Succinoglycan Production in Sinorhizobium meliloti
Sarah A. Glenn,
Nataliya Gurich,
Morgan A. Feeney,
and
Juan E. González*
Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, Texas 75083-0688
Received 8 June 2007/
Accepted 16 July 2007

ABSTRACT
Sinorhizobium meliloti is a gram-negative soil bacterium capable
of forming a symbiotic nitrogen-fixing relationship with its
plant host,
Medicago sativa. Various bacterially produced factors
are essential for successful nodulation. For example, at least
one of two exopolysaccharides produced by
S. meliloti (succinoglycan
or EPS II) is required for nodule invasion. Both of these polymers
are produced in high- and low-molecular-weight (HMW and LMW,
respectively) fractions; however, only the LMW forms of either
succinoglycan or EPS II are active in nodule invasion. The production
of LMW succinoglycan can be generated by direct synthesis or
through the depolymerization of HMW products by the action of
two specific endoglycanases, ExsH and ExoK. Here, we show that
the ExpR/Sin quorum-sensing system in
S. meliloti is involved
in the regulation of genes responsible for succinoglycan biosynthesis
as well as in the production of LMW succinoglycan. Therefore,
quorum sensing, which has been shown to regulate the production
of EPS II, also plays an important role in succinoglycan biosynthesis.

INTRODUCTION
Sinorhizobium meliloti is a free-living gram-negative soil bacterium
capable of forming a nitrogen-fixing symbiotic relationship
with the leguminous plant,
Medicago sativa, commonly known as
alfalfa. The symbiotic process involves an exchange of signaling
molecules between
S. meliloti and its host, leading to the eventual
formation of nodules containing nitrogen-fixing bacteroids (
24,
33,
68). First, alfalfa releases flavonoids, which serve as
a chemoattractant for
S. meliloti. In response to flavonoids,
the bacterial
nod genes produce nod factors that stimulate nodule
formation (
27). A plant-derived tube, known as the infection
thread, allows
S. meliloti to travel from its soil environment
into the developing nodule. The presence of bacterially produced
exopolysaccharides is essential for nodule invasion to occur
(for recent reviews, see references
10,
21, and
67). Eventually,
the bacteria differentiate into bacteroids that reduce atmospheric
dinitrogen into ammonia in exchange for nutrients provided by
the plant. In the absence of exopolysaccharides, nodules develop,
but they are devoid of nitrogen-fixing bacteroids.
S. meliloti produces two symbiotically important polymers, succinoglycan
and EPS II, either of which can function in nodule invasion,
although their precise role is unknown (
10,
21,
67).
Succinoglycan is a polymer of repeating octasaccharide subunits composed of one galactose and seven glucose residues decorated with acetyl, succinyl, and pyruvyl modifications in a ratio of 1:1:1 (1, 60). Succinoglycan production can be observed with the use of the dye calcofluor, to which succinoglycan binds, leading to fluorescence under UV light (18, 44). Various mutants in succinoglycan biosynthesis have been isolated based on their inability to fluoresce or by their altered fluorescent phenotypes on medium supplemented with calcofluor (18, 44, 46). This led to the discovery of a cluster of genes later designated as exo. The products of the 19 exo genes are involved in processes such as the synthesis and modification of the octasaccharide subunits and polymerization and transport of the exopolysaccharide; there is also a glycanase involved in depolymerization of the polymer (5-7, 31, 32, 44, 46, 53, 75). Analysis of the exo gene cluster, as well as the lipid-linked biosynthetic intermediates that were found to accumulate in various succinoglycan-deficient mutants, led to a model for succinoglycan biosynthesis (61). The first sugar residue, galactose, is added to the lipid carrier by the product of exoY. The remaining seven glucose residues are subsequently added by specific glucosyltransferases, and modifications to the octasaccharide are incorporated during the biosynthetic process. Finally, polymerization and transport of the polymer occur (61). Further analysis demonstrated that succinoglycan is produced in two well-defined sizes based on molecular weight. One fraction contains high-molecular-weight (HMW) succinoglycan that consists of up to 2,000 or more of the octasaccharide subunits (4, 35). The second fraction, termed low-molecular-weight (LMW) succinoglycan consists of monomer, dimer, and trimer subunits of the polymer (35, 71). Studies conducted by the Walker laboratory concluded that the trimer fraction of the succinoglycan polymer is the active signal molecule in nodule invasion (70).
The LMW fractions of succinoglycan can be produced either by partial polymerization or by depolymerization of HMW products through the action of specific endoglycanases (35, 75). Direct polymerization of succinoglycan is mediated by the gene products of exoP, exoT, and exoQ (35). ExoP is proposed to be involved in the determination of the chain length of the polymer (9). The ExoP and ExoT proteins are involved in the biosynthesis of the succinoglycan dimer and trimer molecules that form the LMW fraction. The ExoP and ExoQ proteins act in concert to produce the HMW succinoglycan fraction (35).
The depolymerization of succinoglycan is mediated by the action of two endo-1,3-1,4-ß-glycanases, ExoK and ExsH. Elegant work from York and Walker (75) showed that mutations in either the exoK or the exsH gene leads to a decrease in the LMW succinoglycan fraction, suggesting that the majority of this fraction is generated by the action of these two enzymes. This decrease can be observed on calcofluor-containing plates where colonies of exoK exsH double mutants lack the characteristic calcofluor halo that surrounds the colonies as a result of the diffusion of LMW succinoglycan into the medium (75).
A mutation in an additional exo gene, exoH, also yields a haloless colony phenotype on calcofluor medium (46). This gene encodes a succinyltransferase that is responsible for the addition of succinyl groups to the octasaccharide (6, 32, 42, 43). This mutation leads to the production of mostly HMW succinoglycan (42, 43). Interestingly, it has been shown that the HMW polymer generated by this mutant is refractive to cleavage by both the ExoK and ExsH glycanases (76). Therefore, succinyl modifications are important for the production of LMW succinoglycan. Although the mechanisms for the production of LMW succinoglycan have been well established, it is not yet clear how this process is regulated.
Similar to succinoglycan, the LMW fraction of EPS II plays a role in nodule invasion (34). EPS II, the second symbiotically important exopolysaccharide produced by S. meliloti, consists of repeating disaccharide subunits containing glucose and galactose in a ratio of 1:1 with acetyl and pyruvyl modifications (30, 36). A group of 22 genes belonging to the exp gene cluster is responsible for the synthesis of EPS II (11, 30). Unlike succinoglycan, the EPS II biosynthetic pathway has not been elucidated since mutations in any of these genes block EPS II production (11). Environmental factors, such as phosphate concentration, have been shown to play an important role in the regulation of EPS II. Under low-phosphate conditions, like those often found in the soil, EPS II production increases. Under conditions with high phosphate concentrations, such as those found in the nodule, reduced amounts of EPS II are produced (50, 77). Another important regulator of EPS II biosynthesis is the product of the expR gene. ExpR belongs to the family of LuxR quorum-sensing regulators (57). Marketon et al. (47) showed that particular exp genes in S. meliloti are regulated by the ExpR/Sin quorum-sensing system (47). This quorum-sensing system consists of the regulator ExpR, the autoinducer synthase, SinI, and its regulator, SinR (48). SinI is responsible for the production of a series of long-chain N-acyl homoserine lactones (AHLs) that range in size from N-dodecanoyl homoserine lactone to N-octadecanoyl homoserine lactone (49). The commonly used S. meliloti laboratory strain, Rm1021, has a disrupted copy of expR and consequently lacks a complete quorum-sensing system (57). As a result, this strain does not produce EPS II, whereas strain Rm8530 (formerly known as the expR101 strain) contains an intact expR gene and synthesizes both HMW and LMW forms of EPS II, resulting in a very mucoid colony phenotype (47, 57). Interestingly, most of the studies of succinoglycan production have been performed in Rm1021, a strain that lacks a complete ExpR/Sin quorum-sensing system.
The ExpR/Sin quorum-sensing system in S. meliloti not only regulates EPS II production but also controls a vast array of genes involved in many free-living and symbiotic cell functions in S. meliloti (37). We set out to investigate what roles the ExpR regulator and/or the autoinducer synthase, SinI, play in succinoglycan production. Here, we show that ExpR, together with the sin AHLs, is involved in modulating expression of specific genes within the exo cluster. We also report that the ExpR/Sin quorum-sensing system is involved in LMW succinoglycan production through exsH and, to a smaller extent, exoK, the two endo-1,3-1,4-ß-glycanases responsible for the depolymerization of HMW succinoglycan (75). Together, these findings suggest that the ExpR/Sin quorum-sensing system plays a role in the regulation of both symbiotically important exopolysaccharides, succinoglycan and EPS II, in S. meliloti.

MATERIALS AND METHODS
Media and genetic techniques.
S. meliloti strains were grown in Luria-Bertani broth or agar
supplemented with MgSO
4 and CaCl
2 and the appropriate antibiotics
as previously described (
29).
Escherichia coli strains were
grown in Luria-Bertani broth or agar with the appropriate antibiotics.
Strains (Table
1) were created by generalized transduction using
phage

M12 as previously described (
29). Bacteria were grown
in minimal glutamate mannitol (MGM) low-phosphate broth (50
mM morpholinepropanesulfonic acid, 19 mM sodium glutamate, 55
mM mannitol, 0.1 mM K
2HPO
4·KH
2PO
4 [stock consists of
equal molar ratio of each], 1 mM MgSO
4, 0.25 mM CaCl
2, 0.004
mM biotin; pH 7) as previously described (
37). Starter cultures
for RNA isolation were grown in 2 ml of TYC broth (10 g tryptone,
5 g of yeast extract, and 0.4 g of CaCl
2/liter) with streptomycin
(500 µg/ml) for 2 days at 30°C. The strains were subcultured
(1:100) in 25 ml of MGM low-phosphate medium and grown at 30°C
with constant shaking. Cultures used for molecular weight profile
analysis were grown in MGM low-phosphate medium. For Calcofluor
halo analysis, MGM low-phosphate medium was supplemented with
calcofluor (Fluorescent Brightener 28; New Dragon Co.) to a
final concentration of 0.02% buffered with 10 mM HEPES, pH 7.4.
Constructions of the exsH transcriptional fusion.
A 1,016-bp internal fragment of the
exsH gene was amplified
from
S. meliloti chromosomal DNA using the following primers
which contain EcoRI and KpnI restriction sites (underlined)
at their respective 5' ends: 5'-CGC
GAATTCCGTCACCATGATCGGCGGTAGG-3'
and 5'-CGC
GGTACCCATCGGCGACCTTCACCGAAT-3'. PCR was performed
by using 30 cycles of 30 s at 95°C, 30 s at 60°C, and
1 min at 72°C. The PCR fragment was purified, digested with
EcoRI and KpnI, and cloned into the suicide plasmid pVIK112
(
38). The resulting plasmid, pVIKExsH, containing the
exsH-
lacZ transcriptional fusion was then transformed into S17
pir. Biparental
matings were performed to transfer the plasmid into a rifampin-resistant
Rm1021 derivative (Rm11554) where the gene was replaced by single
recombination. The
S. meliloti clone carrying the chromosomal
lacZ transcriptional fusion was selected by plating on minimal
medium (MGM) containing neomycin and rifampin.
Construction of pJNSinI.
An arabinose-inducible pJNSinI plasmid was constructed by ligation of a 698-bp PCR fragment of sinI with EcoRI/XbaI-digested pJN105 (55). The sinI gene was amplified from Rm8530 using the following primers: CGCGAATTCTCGCTACATCGCGTAATCACGC and CGCTCTAGATCAGGCGGCGCGTGCCGTTT, where the underlined nucleotides are EcoRI and XbaI restriction enzyme sites, respectively. The plasmid was introduced into E. coli by transformation and selection with gentamicin. The presence of sinI was confirmed by PCR with the above primers. This strain was then used as a donor in a triparental mating with S. meliloti. Transconjugants were selected by plating on streptomycin and gentamicin.
Construction of pSW213ExpR.
An IPTG (isopropyl-ß-D-thiogalactopyranoside)-inducible pSW213ExpR plasmid was constructed by ligation of a 741-bp PCR fragment of expR with BglII/KpnI-digested pSW213 (14). The expR gene was amplified from Rm8530 using the following primers: GAAGATCTTCACATGGCCTGGCGGGTTG and CGGGGTACCGAATCCGGTCGAGGCGCTG, where underlined nucleotides are BglII and KpnI restriction enzyme sites, respectively, and italicized nucleotides are 5' additions to the PCR product. The plasmid was introduced into E. coli by transformation and selection with tetracycline. The presence of expR was confirmed by PCR with the above primers. This strain was then used as a donor in a triparental mating with Rm1021. Transconjugants were selected by plating on streptomycin and tetracycline.
ß-Galactosidase assays.
Bacteria were grown to an optical density at 600 nm (OD600) of 0.8 in 5 ml of MGM low-phosphate medium at 30°C and assayed as previously described to determine Miller units of activity (51). The average and standard deviations for each strain were calculated from the results of three independent cultures.
RNA purification.
Bacterial cultures were grown to an OD600 of 0.8 or 1.2 in MGM low-phosphate medium containing 500 µg of streptomycin/ml. Cells were harvested by centrifugation (20,000 x g for 2 min at 4°C), and cell pellets were immediately frozen in liquid nitrogen. Total RNA was purified by using an RNeasy Mini Kit (QIAGEN). Cells were disrupted in the RLT buffer provided with the QIAGEN kit in Fast Protein Blue tubes (QBIOgene) by using a Ribolyser (Hybaid) (for 30 s at level 6.5) prior to spin column purification, according to the RNeasy Mini Kit RNA purification protocol. The RNA samples were treated with QIAGEN on-column RNase-free DNase and further purified. Samples were DNase treated a second time with the TURBO RNase-free DNase from Ambion according to the manufacturer's protocol, and an additional RNA clean-up step was performed (37). RNA samples were checked for integrity using an Agilent 2100 Bioanalyzer, and then concentration was determined for cDNA synthesis.
Affymetrix chip hybridizations and expression analysis.
Two independent biological replicates were analyzed for each strain at mid-logarithmic and early stationary phase (OD600 of 0.8 and 1.2) using the S. meliloti and Medicago truncatula Affymetrix GeneChips (Santa Clara, CA). Affymetrix hybridizations were performed by the Core Microarray facility at the University of Texas Southwestern Medical Center (Dallas, TX) as previously described (3). Ten micrograms of total RNA was used for each experiment. A GeneChip Scanner 3000 was used to measure pixel values, and CEL files were processed by Affymetrix GeneChip operating software, version 1.4. All data were transformed, replicates were combined, and differentially regulated genes were identified with a 90% confidence threshold. Genes were considered as differentially expressed at a P value of
0.05 and an M value of >1.5.
Quantitative real-time PCR.
The first-strand cDNA mixture for each strain was prepared with a RETROscript kit from Ambion by using 2 µg of total RNA per reaction, and 1 µl of the cDNA reaction was used as a template for the real-time PCR. The oligonucleotide sequences for real-time PCR are listed in Table 2. The TaqMan probes used were as follows: SMc00128 probe, 5'-[HEX]TCAGCATGAACGACCAGACAGCCGTCA[DBH2]-3'; expE2 probe, 5'-[DFAM]CAACCCGTCCCGCTCGTCAGCAC[DBH1]-3'; exsH probe, 5'-[DFAM]TTGTCCGCCTCGTTGCCGAATGC(DBH1)-3'; exoK probe, 5'-(DFAM)ACACGCTCACCGACTGGATGGGCA[DBH1]-3' (DFAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; DBH1, Black Hole Quencher 1; DBH2, Black Hole Quencher 2). For real-time PCR analysis using TaqMan probes, each reaction mixture contained 0.3 µM sense oligonucleotide, 0.3 µM antisense oligonucleotide, 0.2 µM TaqMan probe, and 0.5 Omni Mix HS PCR beads (each PCR bead contains 1.5 U of Taq DNA polymerase, 10 mM Tris-HCl [pH 9.0], 50 mM KCl, 1.5 mM MgCl2, 200 µM deoxynucleotide triphosphate, and stabilizers, including bovine serum albumin) in a 25-µl reaction volume. The experiment was performed with a Cepheid Smart Cycler, version 2.0c, programmed as follows: stage 1, 95°C for 120 s; stage 2, 95°C for 15 s and 60°C for 30 s (two-temperature cycle repeated 40 times). For the SYBR Green protocol, each reaction mixture contained 0.3 µM sense oligonucleotide, 0.3 µM antisense oligonucleotide, 0.5x SYBR Green 1 (Sigma), and 0.5 Omni Mix HS PCR beads in a 25-µl reaction volume. The experiment was performed with the Cepheid Smart Cycler, version 2.0c, as described previously (37).
Quantitation of succinoglycan production.
Early-stationary-phase cultures grown in MGM low-phosphate medium
to an OD
600 of 1.0 were centrifuged at 4°C for 15 min at
3,220
x g. The total carbohydrate concentration of the exopolysaccharide-containing
supernatant was assayed using the anthrone-H
2SO
4 method (
52).
The amount of carbohydrate was normalized to the protein concentration
of its corresponding cell pellet, which was determined using
a Bio-Rad detergent-compatible protein assay. The average and
standard deviations for each strain were calculated from the
results of three independent cultures.
Molecular weight profile.
Strains were subcultured 1:100 in 250 ml of MGM low-phosphate medium in a 1-liter flask and incubated at 30°C with constant shaking until they reached an OD600 of 1.0 to 1.1. Cells were harvested by centrifugation at 16,000 x g for 16 min. Cell pellets were washed four times in 20 mM sodium phosphate (pH 7.4)-10 mM sodium chloride buffer. The cell suspension was transferred to a 5-ml flask and incubated with 60 µCi of D-[U-14C]glucose for 5 h with constant shaking at 30°C. Samples were boiled at 100°C for 5 min and then placed on ice for 15 min. The supernatant was recovered from the pellet by centrifugation at 20,000 x g at 4°C for 15 min. Succinoglycan (300 µl) was fractionated by column chromatography (1 by 100 cm) using Bio-Gel P-6 (fine mesh; Bio-Rad) preequilibrated and eluted with pyridinum acetate buffer (0.1 M; pH 5.0) (35). Fractions were collected, and radioactivity was detected by liquid scintillation counting in a Beckman LS6500 scintillation counter.

RESULTS
The ExpR/Sin quorum-sensing system regulates exo gene expression.
The ExpR/Sin quorum-sensing system regulates more than 200 genes
involved in both free-living and symbiotic functions (
37). Previously,
our laboratory conducted genome-wide expression studies of
S. meliloti and various quorum-sensing-defective derivatives. These
strains were grown in a low-phosphate medium and harvested at
the mid-logarithmic growth phase (
37). These conditions were
chosen because quorum-sensing-controlled genes, such as the
exp genes involved in the synthesis of EPS II, have been shown
to be optimally expressed in a low-phosphate medium which mimics
the conditions often found in the soil environment (
47,
50,
63,
77). We recently expanded our study of quorum sensing in
S. meliloti by conducting further expression analyses using
an Affymetrix GeneChip microarray to ascertain differentially
expressed genes in the presence (wild type [WT]) and absence
(
expR) of the ExpR regulator and in the presence and absence
of SinI, the autoinducer synthase responsible for the production
of the
sin AHLs. In addition, we harvested the cultures at mid-logarithmic
(OD
600 of 0.8) and early stationary phase (OD
600 of 1.2). The
data obtained in this analysis confirmed many of the observations
previously obtained at an OD
600 of 0.8 using an Sm6kOligo spotted
microarray (
37; also N. Gurich and J. González, unpublished
data). There was a clear correlation between the Affymetrix
and the Sm6kOligo spotted array with respect to the genes that
were highly differentiated. For example,
exsH, a gene that encodes
an endo-1,3-1,4-ß-glycanase responsible for the production
of LMW succinoglycan (
75), was flagged in both microarray analyses.
Interestingly, due to the higher sensitivity of the Affymetrix
array, additional genes were found to be quorum sensing dependent.
Among these were some of the
exo genes responsible for succinoglycan
synthesis. Table
3 summarizes the differential expression of
genes involved in succinoglycan biosynthesis from the microarray
data gathered at mid-logarithmic and early stationary phase.
The genome-wide expression analysis indicates that the ExpR/Sin
quorum-sensing system may play a role in the regulation of
exsH at both mid-logarithmic and early stationary phase. To verify
the microarray data, we created a
lacZ transcriptional fusion
to
exsH and transduced the fusion into the appropriate strains
(WT,
sinI,
expR, and
expR sinI strains). Gene expression was
then assayed in cells grown to mid-logarithmic phase (OD
600 of 0.8) in low-phosphate medium to determine if the regulation
of
exsH is mediated by the
sin AHLs and/or the ExpR regulator.
The
exsH-lacZ fusion showed a low level of expression in the
absence of the ExpR regulator, irrespective of the presence
or absence of the
sin AHLs (Fig.
1A). On the other hand, in
the presence of ExpR, expression of the
exsH-lacZ fusion increased
in a strain capable of producing
sin AHLs (Fig.
1A). This correlates
with the data obtained from the microarray studies and shows
that expression of
exsH is optimal in the presence of both ExpR
and the
sin AHLs. Further expression studies of
exsH were performed
utilizing real-time PCR to more sensitively assess the expression
at both mid-logarithmic and early stationary phase. At mid-logarithmic
phase (OD
600 of 0.8), a 12- to 17-fold increase in expression
of
exsH was observed in the presence of the ExpR regulator and
the
sin AHLs with regard to the quorum-sensing mutants (Table
4). Correspondingly, an increase of 20- to 23-fold in expression
of
exsH was also observed in the presence of ExpR and the
sin AHLs compared to the quorum-sensing mutants at early stationary
phase (OD
600 of 1.2) (Table
4). These results correlate with
our ß-galactosidase assays above and suggest that
full expression of
exsH occurs in the presence of an intact
ExpR/Sin quorum-sensing system.
We performed complementation studies to determine if expression
of
exsH could be restored by a functional copy of
sinI provided
in
trans. The pJNSinI plasmid or the pJN105 vector alone was
transferred into the
sinI or the
expR sinI mutants containing
the
exsH-lacZ transcriptional fusion. Expression of the
exsH-lacZ fusion was restored to WT levels only in the presence of the
ExpR regulator (Fig.
1B). We also assayed expression of
exsH in the
expR and
expR sinI mutants in the presence of the ExpR-complementing
plasmid pSWExpR or the pSW213 vector alone. Similar to the previous
complementation studies, expression of
exsH was restored when
expR was supplied in
trans in the
expR mutant but not in the
expR sinI derivative (Fig.
1C). This further confirms that both
the
sin AHLs and the ExpR regulator are necessary for full expression
of
exsH.
We continued our analysis of the entire exo gene cluster in order to examine if additional exo genes were regulated by quorum sensing. Figure 2 illustrates the exo gene cluster and the genes that were shown to be regulated by quorum sensing. Table 4 lists the genes differentially expressed by the ExpR/Sin quorum-sensing system. exoI, a gene whose function has yet to be determined (7, 32), showed an increase in expression in the presence of the ExpR/Sin quorum-sensing system at mid-logarithmic and early stationary phase. The expression studies also elucidated a group of exo genes showing differential expression in the presence of an intact quorum-sensing system compared to a sinI mutant only at mid-logarithmic phase (Table 4). For example, exoK, another endo-1,3-1,4-ß-glycanase that depolymerizes HMW succinoglycan (32, 75), displayed an almost fivefold increase in expression specifically at mid-logarithmic growth. Similarly, expression was also increased at the mid-logarithmic growth phase in WT versus sinI strain for the exoL, exoA, and exoO genes, all of which encode glucosyltransferases (6, 31, 61). exoN and exoH, which encode a UDP-glucose pyrophosphorylase and a succinyltransferase (6, 32), respectively, also display increased expression in the WT strain with respect to sinI. These studies confirmed that, indeed, various exo genes are moderately controlled by the ExpR/Sin quorum-sensing system.
Succinoglycan production is increased in the presence of the ExpR/Sin quorum-sensing system.
The finding that particular genes involved in the biosynthesis
of succinoglycan appear to be regulated by the ExpR/Sin quorum-sensing
system (Fig.
2 and Table
4) led us to investigate if overall
levels of succinoglycan production would be controlled by quorum
sensing. We measured the overall succinoglycan biosynthesis
by quantifying exopolysaccharide production using the anthrone-H
2SO
4 assay (
52). In order to quantify solely succinoglycan production
in the WT strains, an
expA mutation was introduced to block
EPS II production. In low-phosphate medium, WT and
expR strains
produce equivalent amounts of succinoglycan (Fig.
3). A slight
decrease in succinoglycan production is observed when a
sinI mutation is introduced into the
expR strain (Fig.
3). Interestingly,
a
sinI mutation in the presence of the ExpR regulator shows
almost a fivefold decrease in succinoglycan production (Fig.
3). We complemented the
sinI mutant with the pJNSinI plasmid
to see if we could restore succinoglycan production. Indeed,
addition of
sinI in
trans restores succinoglycan back to WT
levels (Fig.
3). In the presence of the vector alone (pJN105),
succinoglycan production was unaffected (Fig.
3). This suggests
that the
sin AHLs, in conjunction with ExpR, play a role in
the overall production of this polymer. The data generated from
the succinoglycan assays correlate with the observation that
expression of particular succinoglycan biosynthesis genes decreases
in the
sinI mutant, suggesting that succinoglycan production
is directly or indirectly regulated by the ExpR/Sin quorum-sensing
system but only in the presence of the ExpR regulator.
LMW succinoglycan production is regulated by the ExpR/Sin quorum-sensing system.
We have shown that a
sinI mutant produces less succinoglycan
and has lower expression of specific
exo genes than a strain
containing an intact quorum-sensing system. Some of these genes
are known to be involved in the production of LMW succinoglycan.
These genes include
exoH, whose gene product encodes a succinyltransferase
necessary for the depolymerization of succinoglycan, as well
as the endo-1,3-1,4-ß-glycanase,
exoK (
32,
74-
76).
Expression of
exsH, the other endoglycanase responsible for
LMW succinoglycan production, appears to be maximally expressed
in an intact ExpR/Sin quorum-sensing system in mid-logarithmic
and early stationary phase. A well-characterized assay utilizing
calcofluor allows us to visualize the presence of succinoglycan
under UV light and differentiate between its HMW and LMW forms
(
18,
28,
44,
75). Fluorescent halos surrounding
S. meliloti colonies appear due to the diffusion of LMW succinoglycan into
the medium (
28,
44,
75). In order to assess if the ExpR/Sin
quorum-sensing system regulates the generation of LMW succinoglycan,
cultures from relevant strains of
S. meliloti were spotted on
calcofluor-containing medium and incubated over a period of
time. An
expA mutation was introduced into the strains that
contain an intact
expR gene in order to observe the fluorescence
of succinoglycan without the mucoid interference of EPS II.
The WT strain began to produce a bright fluorescent halo beginning at day 2 and continued to diffuse through the medium during the incubation process (Fig. 4). The presence of the exsH mutation did not affect the production of the fluorescent halo over the course of time. The introduction of an exoK mutation resulted in a halo delay phenotype (Fig. 4). The fluorescent halo began to develop at day 5. The exsH exoK mutant resulted in a haloless phenotype throughout the incubation period, indicating that these two glycanases contribute to the majority of the LMW succinoglycan diffusion away from the colonies (Fig. 4).
A
sinI mutant showed a slight halo delay (day 3), suggesting
an initial decrease in the production of LMW succinoglycan (Fig.
4). The
sinI exsH mutant has slightly less overall halo (Fig.
4). Interestingly, the
sinI exoK mutant produces a haloless
phenotype parallel to that of a double glycanase
exsH exoK mutant
(Fig.
4). This suggests that expression of
exsH is decreased
in the absence of
sinI, resulting in a loss of LMW succinoglycan.
The halo assays were also performed in the absence of the ExpR
regulator (Fig.
5). An initial halo delay was observed until
day 3 in the
expR mutant, but the fluorescent halo began to
develop and diffuse around the colony as the incubation period
progressed (Fig.
5). The addition of an
exsH mutation did not
alter halo development in comparison with the
expR mutant (Fig.
5). An
expR exoK mutant resulted in a haloless phenotype as
did an
expR exsH exoK mutant (Fig.
5). The addition of a
sinI mutation in any of the
expR derivatives did not alter the halo
phenotype of the
exoK mutant, suggesting that in the absence
of the ExpR regulator, the
sin AHLs do not contribute to the
production of LMW succinoglycan.
The gene expression data suggested that the ExpR/Sin quorum-sensing
system may be involved in the expression of
exsH and, to a lesser
extent,
exoK, two genes whose products are involved in the depolymerization
of HMW succinoglycan (
75). In addition, our observations of
the calcofluor halo phenotypes suggest that the production of
LMW succinoglycan may be affected by the ExpR/Sin quorum-sensing
system. Therefore, we determined the molecular weight profile
of succinoglycan from the relevant strains grown in low-phosphate
medium to determine if the production of HMW and LMW succinoglycan
is altered in a quorum-sensing mutant. For the strains containing
an intact
expR, an
expA mutation was introduced to allow observation
of the molecular weight profile of succinoglycan alone without
contribution from EPS II. Cells were harvested and radiolabeled
with
D-[U-
14C]glucose (see Material and Methods). The succinoglycan-containing
supernatant was fractionated using gel filtration chromatography
to separate the HMW and LMW forms of the exopolysaccharide.
The molecular weight profile of the WT strain showed a distribution of 20% HMW succinoglycan and 80% LMW succinoglycan (Fig. 6A). Succinoglycan recovered from the exsH mutant did not show an appreciable increase in HMW succinoglycan (Fig. 6B), suggesting that the remaining glycanase, ExoK, was sufficient to depolymerize succinoglycan. In the exoK mutant, our analysis of the molecular weight profile led to the interesting observation that the monomer peak decreases significantly (Fig. 6C). Previous work to characterize the molecular weight profile of succinoglycan used primarily Bio-gel A5 column chromatography, which has the capability only to resolve HMW from the LMW fractions of succinoglycan and cannot separate the individual LMW forms (75). By using P6 column chromatography, we were able to further separate LMW succinoglycan into its fractions of monomer, dimer, and trimer, enabling us to detect the loss of monomer in the exoK mutants. Although the monomer peak was reduced, the overall percentages of HMW and LMW succinoglycan were 23% and 77%, respectively, in the presence of ExpR. Interestingly, we determined that a sinI mutation in the presence of an intact ExpR resulted in a doubling of the amount of HMW succinoglycan (40%) produced by that strain (Fig. 6D), suggesting a role for quorum sensing in the production of LMW succinoglycan.
We determined the molecular weight profile of succinoglycan
in the absence of
expR. We observed a ratio of 22% to 78% for
HMW to LMW succinoglycan, respectively, produced by this strain
(Fig.
6E). In the absence of ExpR, mutations in either of the
glycanases leads to a pronounced increase in HMW succinoglycan
compared to derivatives lacking the gene (Fig.
6F and G). As
in the WT background, we also observed a decrease in the monomer
fractions of succinoglycan in the
exoK mutant. The introduction
of a
sinI mutation in the absence of the ExpR regulator did
not change the ratio of HMW to LMW succinoglycan, 24% HMW to
76% LMW succinoglycan (Fig.
6H), suggesting that in the absence
of ExpR, the
sin AHLs do not play a role in the generation of
LMW succinoglycan. Complementation studies with the
sinI gene
in
trans restored
exsH-lacZ expression and overall succinoglycan
production levels back to WT in the respective
sinI mutants
(see above). We also set out to determine if we could restore
the percentage of LMW succinoglycan to that of the WT strain
by providing a functional copy of
sinI in
trans. As expected,
the levels of LMW succinoglycan increased at the expense of
the HMW polymer when
sinI was provided in
trans in a
sinI-defective
derivative (Fig.
7A). We did not observe a change in the ratio
of HMW to LMW succinoglycan with the vector alone (Fig.
7B),
suggesting that the
sinI gene in the presence of the ExpR regulator
contributes to the production of LMW succinoglycan.

DISCUSSION
The ExpR/Sin quorum-sensing system plays an important role in
regulating genes that are important to free-living as well as
symbiotic processes in
S. meliloti (
37). Previous work has shown
that the ExpR/Sin quorum-sensing system regulates particular
exp genes involved in EPS II production (
47,
57). We show here
that this quorum-sensing system is also involved in the production
of succinoglycan, another symbiotically important exopolysaccharide.
Our genome-wide expression studies performed at mid-logarithmic
and early stationary phase in
S. meliloti derivatives showed
that specific genes involved in succinoglycan biosynthesis were
regulated by the ExpR/Sin quorum-sensing system. Our gene expression
analyses confirmed these observations. A particular region of
the
exo gene cluster, including
exoL,
exoA,
exoO, and
exoN,
was upregulated in the ExpR/Sin quorum-sensing system with respect
to the
sinI mutant. This upregulation was specifically observed
at mid-logarithmic phase.
exoA,
exoL, and
exoO encode glucosyltransferases
that add the first, second, and fourth glucose residues, respectively,
to the building octasaccharide subunit (
6,
31,
61). Mutations
in any of these genes result in the loss of succinoglycan production
(
46).
exoN encodes a UDP-glucose pyrophosphorylase, and mutants
in this gene have been found to synthesize a reduced amount
of succinoglycan (
6,
32). The residual amount of succinoglycan
is presumably due to the presence of a redundant gene on the
chromosome (
32). The strong influence of quorum sensing on
exoI expression is interesting.
exoI is proposed to encode a small
periplasmic protein involved in succinoglycan biosynthesis;
however, its function is still unknown (
7,
32). Mutants in this
gene are unaffected in succinoglycan production (
32).
Since various genes involved in succinoglycan biosynthesis were shown to be upregulated by the ExpR/Sin quorum-sensing system, we explored the possibility that it may play a role in the amount of succinoglycan produced. We quantified succinoglycan biosynthesis in the presence and absence of expR and/or sinI. In the sinI mutant, there was almost a fivefold reduction in the amount of succinoglycan produced compared to a strain with an intact quorum-sensing system. This decrease was not observed in the expR or in the expR sinI mutant. In the presence of ExpR, the sin AHLs seem to be required for maximal production of succinoglycan. The data correlate with our observations that in the absence of sinI but in the presence of expR, expression of exoL, exoA, exoO, and exoN decreases. The increase in gene expression and the increase in succinoglycan production are, again, dependent on the presence of both ExpR and the sin AHLs. This may explain why an ExpR/Sin quorum-sensing effect was not initially observed for succinoglycan as it was with EPS II. EPS II production is completely abolished by a mutation in any of the exp genes or by a mutation in the ExpR/Sin quorum-sensing system (11, 47, 57). This is easily observed due to the high level of mucoidy produced by EPS II. The ExpR/Sin quorum-sensing system does not turn on or off succinoglycan production as it does with EPS II but, rather, appears to modulate its synthesis through the ExpR regulator in conjunction with the sin AHLs. In the absence of the ExpR regulator, production of succinoglycan remains high and unaffected by the sin AHLs, suggesting that in this context, biosynthesis of succinoglycan becomes independent of quorum-sensing control. One possible explanation for these observations is that ExpR acts as a repressor of succinoglycan biosynthesis in the absence of the sin AHLs. In the absence of ExpR, repression does not occur.
The ExpR/Sin quorum-sensing system is also involved in the production of LMW succinoglycan. We observed the upregulation of exoH, exoK, and exsH in the presence of the ExpR/Sin quorum-sensing system compared to the sinI mutant. exoH encodes the succinyltransferase responsible for the addition of succinyl modifications to the octasaccharide subunit of succinoglycan (6, 32, 43). Mutants in exoH produce only HMW succinoglycan, which can be observed as a haloless colony on calcofluor-containing plates (42, 43, 46). These mutants yield a Fix– phenotype on alfalfa plants, demonstrating the essential role of LMW succinoglycan in invasion (32, 46). Expression of exoK and exsH also decreased in the sinI mutant with respect to the WT strain at mid-logarithmic phase. Moreover, our exsH-lacZ fusion and real-time PCR analysis showed a decrease in exsH expression in the absence of any of the ExpR/Sin quorum-sensing components. Therefore, the ExpR/Sin quorum-sensing system appears to regulate steps in the building of the octasaccharide subunit, the modifications important for the production of LMW succinoglycan as well as glycanases responsible for the depolymerization of the polymer. Based on these findings, one may speculate that quorum sensing may play a fine-tuning role in the overall synthesis of succinoglycan at specific instances during the symbiotic process.
We performed our genetic analyses in the presence and absence of not only ExpR but also the sin AHLs and continued our analyses of LMW succinoglycan production in low-phosphate medium to mimic the environment S. meliloti may encounter in the soil. We observed development of a calcofluor halo surrounding the colony of the WT strain at day 2 and continuing through day 11, leading to a large diffuse halo. A delay in the production of the halo phenotype occurred until day 3 for the sinI, expR, and expR sinI mutants. This suggests that the absence of some of the component(s) of the ExpR/Sin quorum-sensing system has a detrimental effect on the generation of LMW succinoglycan. Previous studies have shown that, in the absence of both exsH and exoK, colonies are unable to produce calcofluor fluorescent halos (75). As expected, when we observed the exsH exoK glycanase mutants in the presence or absence of expR and/or sinI, our colonies produced haloless phenotypes. Interestingly, we also observed a haloless phenotype in strains missing the exoK allele in conjunction with expR and sinI or in the absence of both expR and the sin AHLs. These findings suggest that the contribution of LMW succinoglycan by ExsH is largely dependent on the ExpR/Sin quorum-sensing system.
We observed an interesting colony morphology while growing our mutants on solid medium. The exsH exoK mutants developed a wrinkled, rugose colony morphology on minimal medium after a period of days. This phenotype was independent of the presence or absence of the ExpR/Sin quorum-sensing system, though the phenotype was most dramatic in the WT strain. The reason for this colony morphology is yet to be determined. It is interesting, however, that similar phenotypes have been linked to biofilm production (22, 26, 73). Biofilms have recently been shown to occur in Rhizobia (23, 62, 65). In Rhizobium leguminosarum, the PrsD-PrsE secretion system was shown to be involved in biofilm production (65). This type I secretion system is responsible for the secretion of two glycanases, PlyA and PlyB, needed for exopolysaccharide depolymerization (19, 20). A mutation in plyB resulted in a reduction in biofilm formation, suggesting that this glycanase plays a role possibly by generating the correct size of exopolysaccharide required for biofilm establishment (65). In S. meliloti, ExsH is secreted by the PrsD-PrsE secretion system (75). Whether ExsH or ExoK contributes to biofilm production in S. meliloti is currently under investigation.
We examined the ratio of HMW to LMW succinoglycan in the presence of ExpR, without contribution of EPS II. We observed a large amount of LMW succinoglycan isolated under these conditions. The introduction of a sinI mutation in the presence of ExpR led to a doubling in the amount of HMW succinoglycan recovered at the expense of the LMW form. In the absence of the ExpR regulator or in the expR sinI mutant, the LMW fraction of succinoglycan did not decrease with respect to WT, suggesting that the sin AHLs do not play a role in LMW succinoglycan production when ExpR is absent. In the presence of ExpR, an exsH or exoK mutation did not alter the ratio of HMW to LMW succinoglycan, indicating a compensatory effect between these two enzymes in the WT strain. We examined the glycanase mutants in the absence of expR and found that a mutation in exsH or exoK led to an increase in HMW succinoglycan. It appears that, in the absence of the ExpR regulator, this compensation does not take place. It remains to be determined if quorum sensing plays a role directly in this balancing effect or indirectly through a yet to be identified effector.
Succinoglycan biosynthesis, although well characterized, has a complex regulatory network. Many genes as well as environmental factors have been shown to play a role in its production (10, 21, 67). For instance, under limiting nitrogen conditions, succinoglycan production increases (17). The ratio of HMW to LMW succinoglycan can also differ depending on osmolarity conditions (12, 54). The products of various genes negatively regulate succinoglycan production, including ExoR, ExoX, ExsB, and, as reported more recently, CbrA (8, 16, 17, 28, 58, 72, 78). Positive regulators of succinoglycan biosynthesis include the ExoS-ChvI system, ExoD, MucR, and SyrM (15-17, 39, 59, 72). The large number of regulators involved in not only succinoglycan biosynthesis but also its molecular weight determination speaks of the importance the bacteria places on the production of this exopolysaccharide. We do not have evidence that quorum sensing regulates the expression of any of the previously identified regulators of succinoglycan. It seems that quorum sensing represents an additional layer in this complex regulatory network.
Also of interest is the molecular weight analysis of succinoglycan produced in strains lacking ExoK. Due to the higher resolution of our separation methods, we found that the fractions corresponding to monomer were significantly reduced. We observed this altered profile in all derivatives containing the exoK mutation independent of quorum sensing. In light of these findings, it is tempting to draw a correlation between the halo delay phenotype of the exoK mutant and the lack of monomer. The monomer fraction may readily diffuse into the agar, allowing for the observable calcofluor halo phenotype. In the absence of ExoK, a calcofluor halo eventually develops, which may be because the remaining glycanase activity of ExsH leads to the production of monomer. Our gel filtration chromatography methods also allowed us to observe an increase in the amount of the trimer fraction isolated from the exoK mutant. The trimer fraction has been shown to play a role in nodule invasion (70). This suggests the interesting notion that specific glycanases may contribute to particular LMW fractions of succinoglycan. Quorum sensing may act, in ways yet to be determined, as a regulator of the final amount of glycanase activity in the cell and, as a consequence, may play a role in the production of particular LMW fractions of succinoglycan.
The ExpR regulator, in conjunction with the sin AHLs, appears to play an important role in many cell functions, although the mechanism of regulation has not yet been elucidated (37). Interestingly, the S. meliloti strain most commonly used for symbiotic interaction studies is Rm1021, which lacks the expR gene. It is the genome of this strain that was sequenced (2, 13, 25), and its genome is also featured in two different microarray technologies (3, 64). Unfortunately, it seems that this strain may have accumulated through the years some defects that influence the regulation of important bacterial phenotypes, many of them implicated in the symbiotic interaction with its host. For example, Rm1021 has lost its ability to naturally produce EPS II, an exopolysaccharide that plays a role in nodule invasion (30, 56, 57). We report here that it also seems to have lost the fine-tuning control of succinoglycan biosynthesis and the production of its symbiotically important LMW fraction. In addition, we have evidence that key processes such as motility (H. Hoang et al., unpublished data), nitrogen utilization (N. Gurich and J. González, unpublished data), and others are not properly regulated in this strain. Most of these defects can be attributed to the disruption by an insertion sequence of the expR gene, a quorum-sensing regulator that seems to work in conjunction with the sin AHLs (47, 57). This gene is intact and active in most natural strains examined (57). Rm1021 has also lost a plasmid (pRme41a) normally present in natural isolates and also found in Rm41, another commonly used WT derivative (33, 69). The strain also lacks the proper size of the capsular polysaccharide (KPS), shown to be sufficient for nodule invasion in strain Rm41 (40, 66). Despite these defects, Rm1021 can still form a successful symbiotic interaction with its host, at least under laboratory conditions. It seems that Rm1021 has compensated for the lack of the ExpR/Sin quorum-sensing system, pRme41a, and perhaps other shortcomings.

ACKNOWLEDGMENTS
We thank the members of our laboratory for helpful discussions
and critical reading of the manuscript. We also thank Audry
Almengor for the construction of pJNSinI.
This work was supported by National Science Foundation grant MCB-9733532 to J.E.G. and National Institutes of Health grant 1R01GM069925 to J.E.G.

FOOTNOTES
* Corresponding author. Mailing Address: Department of Molecular and Cell Biology, University of Texas at Dallas, RL 11, Richardson, TX 75083-0688. Phone: (972) 883-2526. Fax: (630) 604-3093. E-mail:
jgonzal{at}utdallas.edu 
Published ahead of print on 20 July 2007. 
Present address: Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115. 

REFERENCES
1 - Aman, P., M. McNeil, L.-E. Franzen, A. G. Darvill, and P. Albersheim. 1981. Structural elucidation, using H.P.L.C.-M.S. and G. L. C.-M.S. of the acidic polysaccharide secreted by Rhizobium meliloti strain 1021. Carbohydr. Res. 95:263-282.[CrossRef]
2 - Barnett, M. J., R. F. Fisher, T. Jones, C. Komp, A. P. Abola, F. Barloy-Hubler, L. Bowser, D. Capela, F. Galibert, J. Gouzy, M. Gurjal, A. Hong, L. Huizar, R. W. Hyman, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, C. Palm, M. C. Peck, R. Surzycki, D. H. Wells, K. C. Yeh, R. W. Davis, N. A. Federspiel, and S. R. Long. 2001. Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA 98:9883-9888.[Abstract/Free Full Text]
3 - Barnett, M. J., C. J. Toman, R. F. Fisher, and S. R. Long. 2004. A dual-genome symbiosis chip for coordinate study of signal exchange and development in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA 101:16636-16641.[Abstract/Free Full Text]
4 - Battisti, L., J. C. Lara, and J. A. Leigh. 1992. Specific oligosaccharide form of the Rhizobium meliloti exopolysaccharide promotes nodule invasion in alfalfa. Proc. Natl. Acad. Sci. USA 89:5625-5629.[Abstract/Free Full Text]
5 - Becker, A., A. Kleickmann, W. Arnold, and A. Pühler. 1993. Analysis of the Rhizobium meliloti exoH/exoK/exoL fragment: ExoK shows homology to excreted endo-beta-1,3-1,4-glucanases and ExoH resembles membrane proteins. Mol. Gen. Genet. 238:145-154.[Medline]
6 - Becker, A., A. Kleickmann, M. Keller, W. Arnold, and A. Pühler. 1993. Identification and analysis of the Rhizobium meliloti exoAMNOP genes involved in exopolysaccharide biosynthesis and mapping of promoters located on the exoHKLAMONP fragment. Mol. Gen. Genet. 241:367-379.[Medline]
7 - Becker, A., A. Kleickmann, H. Kuster, M. Keller, W. Arnold, and A. Pühler. 1993. Analysis of the Rhizobium meliloti genes exoU, exoV, exoW, exoT, and exoI involved in exopolysaccharide biosynthesis and nodule invasion: exoU and exoW probably encode glucosyltransferases. Mol. Plant-Microbe Interact. 6:735-744.[Medline]
8 - Becker, A., H. Kuster, K. Niehaus, and A. Pühler. 1995. Extension of the Rhizobium meliloti succinoglycan biosynthesis gene cluster: identification of the exsA gene encoding an ABC transporter protein, and the exsB gene which probably codes for a regulator of succinoglycan biosynthesis. Mol. Gen. Genet. 249:487-497.[CrossRef][Medline]
9 - Becker, A., K. Niehaus, and A. Pühler. 1995. Low-molecular-weight succinoglycan is predominantly produced by Rhizobium meliloti strains carrying a mutated ExoP protein characterized by a periplasmic N-terminal domain and a missing C-terminal domain. Mol. Microbiol. 16:191-203.[CrossRef][Medline]
10 - Becker, A., S. Ruberg, B. Baumgarth, P. A. Bertram-Drogatz, I. Quester, and A. Pühler. 2002. Regulation of succinoglycan and galactoglucan biosynthesis in Sinorhizobium meliloti. J. Mol. Microbiol. Biotechnol. 4:187-190.[Medline]
11 - Becker, A., S. Ruberg, H. Kuster, A. A. Roxlau, M. Keller, T. Ivashina, H. P. Cheng, G. C. Walker, and A. Pühler. 1997. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products. J. Bacteriol. 179:1375-1384.[Abstract/Free Full Text]
12 - Breedveld, M. W., L. P. T. M. Zevenhuizen, and A. J. B. Zehnder. 1990. Osmotically induced oligo- and polysaccharide synthesis by Rhizobium meliloti SU-47. J Gen. Microbiol. 136:2511-2519.[Abstract/Free Full Text]
13 - Capela, D., F. Barloy-Hubler, J. Gouzy, G. Bothe, F. Ampe, J. Batut, P. Boistard, A. Becker, M. Boutry, E. Cadieu, S. Dreano, S. Gloux, T. Godrie, A. Goffeau, D. Kahn, E. Kiss, V. Lelaure, D. Masuy, T. Pohl, D. Portetelle, A. Pühler, B. Purnelle, U. Ramsperger, C. Renard, P. Thebault, M. Vandenbol, S. Weidner, and F. Galibert. 2001. Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti strain 1021. Proc. Natl. Acad. Sci. USA 98:9877-9882.[Abstract/Free Full Text]
14 - Chen, C. Y., and S. C. Winans. 1991. Controlled expression of the transcriptional activator gene virG in Agrobacterium tumefaciens by using the Escherichia coli lac promoter. J. Bacteriol. 173:1139-1144.[Abstract/Free Full Text]
15 - Cheng, H. P., and G. C. Walker. 1998. Succinoglycan production by Rhizobium meliloti is regulated through the ExoS-ChvI two-component regulatory system. J. Bacteriol. 180:20-26.[Abstract/Free Full Text]
16 - Cheng, H. P., and S. Y. Yao. 2004. The key Sinorhizobium meliloti succinoglycan biosynthesis gene exoY is expressed from two promoters. FEMS Microbiol. Lett. 231:131-136.[CrossRef][Medline]
17 - Doherty, D., J. A. Leigh, J. Glazebrook, and G. C. Walker. 1988. Rhizobium meliloti mutants that overproduce the R. meliloti acidic calcofluor-binding exopolysaccharide. J. Bacteriol. 170:4249-4256.[Abstract/Free Full Text]
18 - Finan, T. M., A. M. Hirsch, J. A. Leigh, E. Johansen, G. A. Kuldau, S. Deegan, G. C. Walker, and E. R. Signer. 1985. Symbiotic mutants of Rhizobium meliloti that uncouple plant from bacterial differentiation. Cell 40:869-877.[CrossRef][Medline]
19 - Finnie, C., N. M. Hartley, K. C. Findlay, and J. A. Downie. 1997. The Rhizobium leguminosarum prsDE genes are required for secretion of several proteins, some of which influence nodulation, symbiotic nitrogen fixation and exopolysaccharide modification. Mol. Microbiol. 25:135-146.[CrossRef][Medline]
20 - Finnie, C., A. Zorreguieta, N. M. Hartley, and J. A. Downie. 1998. Characterization of Rhizobium leguminosarum exopolysaccharide glycanases that are secreted via a type I exporter and have a novel heptapeptide repeat motif. J. Bacteriol. 180:1691-1699.[Abstract/Free Full Text]
21 - Fraysse, N., F. Couderc, and V. Poinsot. 2003. Surface polysaccharide involvement in establishing the Rhizobium-legume symbiosis. Eur. J. Biochem. 270:1365-1380.[Medline]
22 - Friedman, L., and R. Kolter. 2004. Two genetic loci produce distinct carbohydrate-rich structural components of the Pseudomonas aeruginosa biofilm matrix. J. Bacteriol. 186:4457-4465.[Abstract/Free Full Text]
23 - Fujishige, N. A., N. N. Kapadia, P. L. De Hoff, and A. M. Hirsch. 2006. Investigations of Rhizobium biofilm formation. FEMS Microbiol. Ecol. 56:195-206.[CrossRef][Medline]
24 - Gage, D. J. 2004. Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol. Mol. Biol Rev. 68:280-300.[Abstract/Free Full Text]
25 - Galibert, F., T. M. Finan, S. R. Long, A. Pühler, P. Abola, F. Ampe, F. Barloy-Hubler, M. J. Barnett, A. Becker, P. Boistard, G. Bothe, M. Boutry, L. Bowser, J. Buhrmester, E. Cadieu, D. Capela, P. Chain, A. Cowie, R. W. Davis, S. Dreano, N. A. Federspiel, R. F. Fisher, S. Gloux, T. Godrie, A. Goffeau, B. Golding, J. Gouzy, M. Gurjal, I. Hernandez-Lucas, A. Hong, L. Huizar, R. W. Hyman, T. Jones, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, E. Kiss, C. Komp, V. Lelaure, D. Masuy, C. Palm, M. C. Peck, T. M. Pohl, D. Portetelle, B. Purnelle, U. Ramsperger, R. Surzycki, P. Thebault, M. Vandenbol, F. J. Vorholter, S. Weidner, D. H. Wells, K. Wong, K. C. Yeh, and J. Batut. 2001. The composite genome of the legume symbiont Sinorhizobium meliloti. Science 293:668-672.[Abstract/Free Full Text]
26 - Garcia, B., C. Latasa, C. Solano, F. Garcia-del Portillo, C. Gamazo, and I. Lasa. 2004. Role of the GGDEF protein family in Salmonella cellulose biosynthesis and biofilm formation. Mol. Microbiol. 54:264-277.[CrossRef][Medline]
27 - Geurts, R., E. Fedorova, and T. Bisseling. 2005. Nod factor signaling genes and their function in the early stages of Rhizobium infection. Curr. Opin. Plant Biol. 8:346-352.[CrossRef][Medline]
28 - Gibson, K. E., G. R. Campbell, J. Lloret, and G. C. Walker. 2006. CbrA is a stationary-phase regulator of cell surface physiology and legume symbiosis in Sinorhizobium meliloti. J. Bacteriol. 188:4508-4521.[Abstract/Free Full Text]
29 - Glazebrook, J., and G. C. Walker. 1991. Genetic techniques in Rhizobium meliloti. Methods Enzymol. 204:398-418.[Medline]
30 - Glazebrook, J., and G. C. Walker. 1989. A novel exopolysaccharide can function in place of the calcofluor-binding exopolysaccharide in nodulation of alfalfa by Rhizobium meliloti. Cell 56:661-672.[CrossRef][Medline]
31 - Glucksmann, M. A., T. L. Reuber, and G. C. Walker. 1993. Family of glycosyl transferases needed for the synthesis of succinoglycan by Rhizobium meliloti. J. Bacteriol. 175:7033-7044.[Abstract/Free Full Text]
32 - Glucksmann, M. A., T. L. Reuber, and G. C. Walker. 1993. Genes needed for the modification, polymerization, export, and processing of succinoglycan by Rhizobium meliloti: a model for succinoglycan biosynthesis. J. Bacteriol. 175:7045-7055.[Abstract/Free Full Text]
33 - González, J. E., and M. M. Marketon. 2003. Quorum sensing in nitrogen-fixing rhizobia. Microbiol. Mol. Biol Rev. 67:574-592.[Abstract/Free Full Text]
34 - González, J. E., B. L. Reuhs, and G. C. Walker. 1996. Low-molecular-weight EPS II of Rhizobium meliloti allows nodule invasion in Medicago sativa. Proc. Natl. Acad. Sci. USA 93:8636-8641.[Abstract/Free Full Text]
35 - González, J. E., C. E. Semino, L. X. Wang, L. E. Castellano-Torres, and G. C. Walker. 1998. Biosynthetic control of molecular weight in the polymerization of the octasaccharide subunits of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 95:13477-13482.[Abstract/Free Full Text]
36 - Her, G. R., J. Glazebrook, G. C. Walker, and V. N. Reinhold. 1990. Structural studies of a novel exopolysaccharide produced by a mutant of Rhizobium meliloti strain Rm1021. Carbohydr. Res. 198:305-312.[CrossRef][Medline]
37 - Hoang, H. H., A. Becker, and J. E. González. 2004. The LuxR homolog ExpR, in combination with the Sin quorum-sensing system, plays a central role in Sinorhizobium meliloti gene expression. J. Bacteriol. 186:5460-5472.[Abstract/Free Full Text]
38 - Kalogeraki, V. S., and S. C. Winans. 1997. Suicide plasmids containing promoterless reporter genes can simultaneously disrupt and create fusions to target genes of diverse bacteria. Gene 188:69-75.[CrossRef][Medline]
39 - Keller, M., A. Roxlau, W. M. Weng, M. Schmidt, J. Quandt, N. Karsten, D. Jording, W. Arnold, and A. Pühler. 1995. Molecular analysis of the Rhizobium meliloti mucR gene regulating the biosynthesis of the exopolysaccharides succinoglycan and galactoglucan. Mol. Plant-Microbe Interact. 8:267-277.[Medline]
40 - Kiss, E., A. Kereszt, F. Barta, S. Stephens, B. L. Reuhs, A. Kondorosi, and P. Putnoky. 2001. The rkp-3 gene region of Sinorhizobium meliloti Rm41 contains strain-specific genes that determine K antigen structure. Mol. Plant-Microbe Interact. 14:1395-1403.[Medline]
41 - Krol, E., and A. Becker. 2004. Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011. Mol. Genet. Genomics 272:1-17.[CrossRef][Medline]
42 - Leigh, J. A., and C. C. Lee. 1988. Characterization of polysaccharides of Rhizobium meliloti exo mutants that form ineffective nodules. J. Bacteriol. 170:3327-3332.[Abstract/Free Full Text]
43 - Leigh, J. A., J. W. Reed, J. F. Hanks, A. M. Hirsch, and G. C. Walker. 1987. Rhizobium meliloti mutants that fail to succinylate their calcofluor-binding exopolysaccharide are defective in nodule invasion. Cell 51:579-587.[CrossRef][Medline]
44 - Leigh, J. A., E. R. Signer, and G. C. Walker. 1985. Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 82:6231-6235.[Abstract/Free Full Text]
45 - Llamas, I., N. Keshavan, and J. E. González. 2004. Use of Sinorhizobium meliloti as an indicator for specific detection of long-chain N-acyl homoserine lactones. Appl. Environ. Microbiol. 70:3715-3723.[Abstract/Free Full Text]
46 - Long, S., J. W. Reed, J. Himawan, and G. C. Walker. 1988. Genetic analysis of a cluster of genes required for synthesis of the calcofluor-binding exopolysaccharide of Rhizobium meliloti. J. Bacteriol. 170:4239-4248.[Abstract/Free Full Text]
47 - Marketon, M. M., S. A. Glenn, A. Eberhard, and J. E. González. 2003. Quorum-sensing controls exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 185:325-331.[Abstract/Free Full Text]
48 - Marketon, M. M., and J. E. González. 2002. Identification of two quorum-sensing systems in Sinorhizobium meliloti. J. Bacteriol. 184:3466-3475.[Abstract/Free Full Text]
49 - Marketon, M. M., M. R. Gronquist, A. Eberhard, and J. E. González. 2002. Characterization of the Sinorhizobium meliloti sinR/sinI locus and the production of novel N-acyl homoserine lactones. J. Bacteriol. 184:5686-5695.[Abstract/Free Full Text]
50 - Mendrygal, K. E., and J. E. González. 2000. Environmental regulation of exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 182:599-606.[Abstract/Free Full Text]
51 - Miller, J. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
52 - Morris, D. 1948. Quantitative determination of carbohydrates with Drerywood's anthrone reagent. Science 108:254-255.
53 - Müller, P., M. Hynes, D. Kapp, K. Niehaus, and A. Pühler. 1988. Two classes of Rhizobium meliloti infection mutants differ in exopolysaccharide production and in coinoculation properties with nodulation mutants. Mol. Gen. Genet. 211:17-26.[CrossRef]
54 - Navarini, L., A. Cesaro, and S. B. Ross-Murphy. 1992. Exopolysaccharides from Rhizobium meliloti YE-2 grown under different osmolarity conditions: viscoelastic properties. Carbohydr. Res. 223:227-234.[CrossRef][Medline]
55 - Newman, J. R., and C. Fuqua. 1999. Broad-host-range expression vectors that carry the L-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227:197-203.[CrossRef][Medline]
56 - Pellock, B. J., H. P. Cheng, and G. C. Walker. 2000. Alfalfa root nodule invasion efficiency is dependent on Sinorhizobium meliloti polysaccharides. J. Bacteriol. 182:4310-4318.[Abstract/Free Full Text]
57 - Pellock, B. J., M. Teplitski, R. P. Boinay, W. D. Bauer, and G. C. Walker. 2002. A LuxR homolog controls production of symbiotically active extracellular polysaccharide II by Sinorhizobium meliloti. J. Bacteriol. 184:5067-5076.[Abstract/Free Full Text]
58 - Reed, J., J. Glazebrook, and G. C. Walker. 1991. The exoR gene of Rhizobium meliloti affects RNA levels of other exo genes but lacks homology to known transcriptional regulators. J. Bacteriol. 173:3789-3794.[Abstract/Free Full Text]
59 - Reed, J. W., and G. C. Walker. 1991. The exoD gene of Rhizobium meliloti encodes a novel function needed for alfalfa nodule invasion. J. Bacteriol. 1991:664-677.
60 - Reinhold, B. B., S. Y. Chan, T. L. Reuber, A. Marra, G. C. Walker, and V. N. Reinhold. 1994. Detailed structural characterization of succinoglycan, the major symbiotically important exopolysaccharide of Rhizobium meliloti Rm1021. J. Bacteriol. 176:1997-2002.[Abstract/Free Full Text]
61 - Reuber, T. L., and G. C. Walker. 1993. Biosynthesis of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Cell 74:269-280.[CrossRef][Medline]
62 - Rinaudi, L., N. A. Fujishige, A. M. Hirsch, E. Banchio, A. Zorreguieta, and W. Giordano. 2006. Effects of nutritional and environmental conditions on Sinorhizobium meliloti biofilm formation. Res. Microbiol. 157:867-875.[Medline]
63 - Rüberg, S., A. Pühler, and A. Becker. 1999. Biosynthesis of the exopolysaccharide galactoglucan in Sinorhizobium meliloti is subject to a complex control by the phosphate-dependent regulator PhoB and the proteins ExpG and MucR. Microbiology 145:603-611.[CrossRef][Medline]
64 - Rüberg, S., Z. X. Tian, E. Krol, B. Linke, F. Meyer, A. Pühler, S. Weidner, and A. Becker. 2003. Construction and validation of a DNA microarray for genome-wide expression profiling in Sinorhizobium meliloti. J. Biotechnol. 106:255-268.[CrossRef][Medline]
65 - Russo, D. M., A. Williams, A. Edwards, D. M. Posadas, C. Finnie, M. Dankert, J. A. Downie, and A. Zorreguieta. 2006. Proteins exported via the PrsD-PrsE type I secretion system and the acidic exopolysaccharide are involved in biofilm formation by Rhizobium leguminosarum. J. Bacteriol. 188:4474-4486.[Abstract/Free Full Text]
66 - Sharypova, L. A., G. Chataigne, N. Fraysse, A. Becker, and V. Poinsot. 2006. Overproduction and increased molecular weight account for the symbiotic activity of the rkpZ-modified K polysaccharide from Sinorhizobium meliloti Rm1021. Glycobiology 16:1181-1193.[Abstract/Free Full Text]
67 - Skorupska, A., M. Janczarek, M. Marczak, A. Mazur, and J. Krol. 2006. Rhizobial exopolysaccharides: genetic control and symbiotic functions. Microb. Cell Fact. 5:1-19.[CrossRef][Medline]
68 - Soto, M. J., J. Sanjuan, and J. Olivares. 2006. Rhizobia and plant-pathogenic bacteria: common infection weapons. Microbiology 152:3167-3174.[Abstract/Free Full Text]
69 - Tepfer, D., A. Goldmann, N. Pamboukdjian, M. Maille, A. Lepingle, D. Chevalier, J. Denarie, and C. Rosenberg. 1988. A plasmid of Rhizobium meliloti 41 encodes catabolism of two compounds from root exudate of Calystegium sepium. J. Bacteriol. 170:1153-1161.[Abstract/Free Full Text]
70 - Urzainqui, A., and G. C. Walker. 1992. Exogenous suppression of the symbiotic deficiencies of Rhizobium meliloti exo mutants. J. Bacteriol. 174:3403-3406.[Abstract/Free Full Text]
71 - Wang, L. X., Y. Wang, B. Pellock, and G. C. Walker. 1999. Structural characterization of the symbiotically important low-molecular-weight succinoglycan of Sinorhizobium meliloti. J. Bacteriol. 181:6788-6796.[Abstract/Free Full Text]
72 - Yao, S. Y., L. Luo, K. J. Har, A. Becker, S. Ruberg, G. Q. Yu, J. B. Zhu, and H. P. Cheng. 2004. Sinorhizobium meliloti ExoR and ExoS proteins regulate both succinoglycan and flagellum production. J. Bacteriol. 186:6042-6049.[Abstract/Free Full Text]
73 - Yildiz, F. H., and G. K. Schoolnik. 1999. Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proc. Natl. Acad. Sci. USA 96:4028-4033.[Abstract/Free Full Text]
74 - York, G. M., and G. C. Walker. 1998. The Rhizobium meliloti ExoK and ExsH glycanases specifically depolymerize nascent succinoglycan chains. Proc. Natl. Acad. Sci. USA 95:4912-4917.[Abstract/Free Full Text]
75 - York, G. M., and G. C. Walker. 1997. The Rhizobium meliloti exoK gene and prsD/prsE/exsH genes are components of independent degradative pathways which contribute to production of low-molecular-weight succinoglycan. Mol. Microbiol. 25:117-134.[CrossRef][Medline]
76 - York, G. M., and G. C. Walker. 1998. The succinyl and acetyl modifications of succinoglycan influence susceptibility of succinoglycan to cleavage by the Rhizobium meliloti glycanases ExoK and ExsH. J. Bacteriol. 180:4184-4191.[Abstract/Free Full Text]
77 - Zhan, H. J., C. C. Lee, and J. A. Leigh. 1991. Induction of the second exopolysaccharide (EPSb) in Rhizobium meliloti SU47 by low phosphate concentrations. J. Bacteriol. 173:7391-7394.[Abstract/Free Full Text]
78 - Zhan, H. J., and J. A. Leigh. 1990. Two genes that regulate exopolysaccharide production in Rhizobium meliloti. J. Bacteriol. 172:5254-5259.[Abstract/Free Full Text]
Journal of Bacteriology, October 2007, p. 7077-7088, Vol. 189, No. 19
0021-9193/07/$08.00+0 doi:10.1128/JB.00906-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Morris, J., Gonzalez, J. E.
(2009). The Novel Genes emmABC Are Associated with Exopolysaccharide Production, Motility, Stress Adaptation, and Symbiosis in Sinorhizobium meliloti. J. Bacteriol.
191: 5890-5900
[Abstract]
[Full Text]
-
Gurich, N., Gonzalez, J. E.
(2009). Role of Quorum Sensing in Sinorhizobium meliloti-Alfalfa Symbiosis. J. Bacteriol.
191: 4372-4382
[Abstract]
[Full Text]
-
Edwards, A., Frederix, M., Wisniewski-Dye, F., Jones, J., Zorreguieta, A., Downie, J. A.
(2009). The cin and rai Quorum-Sensing Regulatory Systems in Rhizobium leguminosarum Are Coordinated by ExpR and CinS, a Small Regulatory Protein Coexpressed with CinI. J. Bacteriol.
191: 3059-3067
[Abstract]
[Full Text]
-
Subramoni, S., Venturi, V.
(2009). LuxR-family 'solos': bachelor sensors/regulators of signalling molecules. Microbiology
155: 1377-1385
[Abstract]
[Full Text]
-
Patankar, A. V., Gonzalez, J. E.
(2009). An Orphan LuxR Homolog of Sinorhizobium meliloti Affects Stress Adaptation and Competition for Nodulation. Appl. Environ. Microbiol.
75: 946-955
[Abstract]
[Full Text]
-
McIntosh, M., Krol, E., Becker, A.
(2008). Competitive and Cooperative Effects in Quorum-Sensing-Regulated Galactoglucan Biosynthesis in Sinorhizobium meliloti. J. Bacteriol.
190: 5308-5317
[Abstract]
[Full Text]
-
Hoang, H. H., Gurich, N., Gonzalez, J. E.
(2008). Regulation of Motility by the ExpR/Sin Quorum-Sensing System in Sinorhizobium meliloti. J. Bacteriol.
190: 861-871
[Abstract]
[Full Text]