Previous Article | Next Article ![]()
Journal of Bacteriology, November 2007, p. 8044-8052, Vol. 189, No. 22
0021-9193/07/$08.00+0 doi:10.1128/JB.00773-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

L. SaiSree,
and
Manjula Reddy*
Centre for Cellular and Molecular Biology, Hyderabad 500007, India
Received 17 May 2007/ Accepted 23 August 2007
|
|
|---|
ftsEX or ftsI23 allele, exhibited sensitivity to oxidative stress or DNA damage, and this sensitivity was also abolished by multiple copies of SufI. All of these data suggest that SufI is a division component involved in protecting or stabilizing the divisomal assembly under conditions of stress. Since sufI fulfils the requirements to be designated an fts gene, we propose that it be renamed ftsP. |
|
|---|
ftsK, and
ftsEX mutations, but not ftsZ84 mutation (11, 14, 38). AmiC and EnvC are septal murein hydrolases that facilitate the separation of daughter cells but are not essential for growth (5, 6). FtsK is a bifunctional protein; its amino-terminal region is involved in the essential division process, and the dispensable carboxy-terminal domain facilitates chromosomal partitioning (30). Most of the division proteins listed above are essential for cell viability. However, a gain-of-function mutation in FtsA (FtsA R286W) can bypass the requirement for ZipA, FtsK, or FtsN, suggesting the existence of functional redundancy between various cell division proteins (4, 14, 15). A trans-envelope Tol-Pal complex was recently shown to facilitate the invagination of the outer membrane during division (17). Chaperone proteins, such as DnaK, GroE, HscA, and trigger factor, are also implicated in division because they are known to affect the folding of one or more division proteins but are not specific for this process (13, 21, 32, 36, 41).
Recently, it was shown that FtsEX, a putative ABC transporter located in the inner membrane, is essential for growth and division only under low-osmolarity conditions and that under conditions of high osmotic strength, the viability of ftsEX deletion mutants is dependent on the presence of a periplasmic protein, SufI (38, 40). In addition, SufI overexpression could substitute for the deficiency of FtsEX, leading to the suggestion that FtsEX and SufI functions could be redundant (38). Previous evidence also implicated SufI in cell division, as multiple copies of sufI suppressed the thermosensitivity of an ftsI23 mutant, but the gene was shown to be dispensable for normal cell growth (25). SufI has been well studied as a prototype substrate of the TatABC (twin-arginine translocase) system, which is a Sec-independent transport pathway that translocates proteins in native conformation from the cytosol into the periplasm across the inner membrane (2, 3, 28, 49). Most Tat substrates bind redox cofactors, such as iron-sulfur clusters and molybdopterin nucleotides, and play important roles in energy metabolism and cell wall biosynthesis. These also include two murein hydrolases, AmiA and AmiC, that facilitate daughter cell separation during cytokinesis (5, 6, 24).
Because the functions of SufI are not well understood, a genetic analysis of sufI was undertaken in this study. The results show that SufI is a cell division protein required for the viability of E. coli cells under a variety of stressful conditions, implicating a role for it in the stabilization of the divisomal assembly.
|
|
|---|
lacI) was used as the wild-type strain (38). The construction of the sufI deletion strain is described below. The division-defective ftsZ84, ftsA12, ftsK44, ftsQ1, and ftsI23 mutations were introduced by phage P1-mediated transduction into other strain backgrounds, with the aid of linked antibiotic markers from strains DRC14, EC290, TOE44, JOE86, and LMG64 (obtained from the laboratory of Jon Beckwith), respectively. sodA sodB mutants (10) were obtained from the Coli Genetic Stock Centre (CGSC), and sodC mutants (19) were obtained from the laboratory of James Imlay. Phage P1kc was obtained from a laboratory stock. |
View this table: [in a new window] |
TABLE 1. Strains and plasmids used in this study
|
Growth media and conditions. Unless otherwise indicated, Luria-Bertani (LB) medium (with 1% NaCl) was used (33), and the growth temperature was 30°C. LBON medium is the same as LB, but without NaCl. The culture media were obtained from BBL-Difco (Madison, WI). Supplementation of LBON with osmolytes (i.e., glucose, sucrose, glycerol, or NaCl) was done at 0.4 M. H2O2 (30% [wt/vol]) was used at 0.5 mM. Paraquat (PQ; methyl viologen) and mitomycin C (MMC) were used at the indicated concentrations. L-Arabinose or D-glucose was used at 0.2% for induction or repression of sufI cloned into the pBAD18 vector. Sodium ascorbate was used at 15 mM. The following antibiotics were used at the indicated concentrations: ampicillin (Amp), 50 µg/ml; kanamycin (Kan), 50 µg/ml (in LB) and 10 µg/ml (in LBON); tetracycline (Tet), 15 µg/ml; chloramphenicol (Cam), 30 µg/ml; spectinomycin (Spc), 50 µg/ml; and trimethoprim (Tp), 60 µg/ml.
Construction of a chromosomal sufI deletion-insertion mutant. A complete deletion of the sufI locus was made on the chromosome by recombineering as described previously (50). A pair of primers having homology at the 5' end to the flanking region of the sufI locus and at the 3' end to the sequence of the kanamycin resistance gene cassette (sufIFPKan [5'-TGCGGGGAACACTTTCCTGCACGGTATTACTTTAGCCAGTTTTACATGGATTGTGTCTCAAAA TCTCTGAT-3'] and sufIRPKan [5'-GCCCTCCTCGGGCGAGTATGAAGATTACGGTACCGGATTGACCAACAGTTAGAAAAACTCATCGAGCATCA AATG] [underlined sequences are homologous to the Kanr gene of plasmid pUC4K]) were employed to amplify a 0.9-kb Kanr cassette of pUC4K. This linear PCR product with flanking homologous sequences of sufI was electroporated into strain HME63, and Kanr transformants were obtained at 30°C. The putative sufI::Kan deletion-substitution was transferred to a fresh background by P1 transduction, and subsequently, the presence of the deletion was confirmed by sequencing the PCR product amplified with the flanking primers (sufIFP3 [5'-CGGAATTCGGCAATCTGTATTTTTGC] and sufIRP3 [5'-CGGAATTCGCCCTCCTCGGGCGAGT] [EcoRI restriction sites are underlined]). This deletion removed the entire sufI gene.
Construction of ftsA* derivative of strain MR22. The ftsA* mutation was transferred into the sufI mutant MR22 from strain WM1659 (obtained from William Margolin) with the aid of the leuB82::Tn10 marker, which is approximately 50% linked to the ftsA locus. Initially, strain WM1659 was transduced to Tetr with a P1 lysate prepared on a strain carrying the leuB::Tn10 marker. The presence of the ftsA* mutation in the Tetr transductants was examined by preparing P1 lysates on six of these and checking for the ability to suppress the temperature sensitivity of an ftsK44 mutant. Of the six Tetr transductants examined, two were shown to have the ftsA* allele, and subsequently, the P1 lysates made with these two strains were used to transduce strain MR22. The presence of the ftsA* allele in these sufI Tetr transductants was tested by preparing P1 lysates on six of them and transducing them again into the ftsK44 mutant strain. Of the six sufI Tetr colonies, three were shown to carry the ftsA* allele, and one of these was designated MR29. The isogenic Tetr transductant that retained the wild-type ftsA locus was designated MR30.
LBON-Ts phenotype of sufI mutant. For most of the experiments, the growth of the sufI mutant was examined on LBON plates prepared from BBL-Difco Laboratories medium, on which growth was significantly inhibited at high temperatures (LBON-Ts phenotype). However, on LBON plates prepared with medium components sourced indigenously (Hi-Media, Mumbai, India), the growth inhibition was very severe, and therefore we used this medium for the isolation of multicopy suppressor plasmids as described below.
Screening for multicopy plasmids that suppress the phenotype of the sufI mutant. A multicopy plasmid library carrying approximately 3- to 5-kb E. coli genomic DNA fragments generated by partial Sau3A digestion and cloned at the BamHI site in a p15A-based plasmid, pACYC184, was a gift from M. Radman's laboratory. This plasmid pool was introduced into the sufI mutant MR22, and transformants were plated on LBON-Cam plates at 42°C. Plasmids were isolated from colonies that grew to different extents, and their ability to suppress was reconfirmed after an additional round of transformation. Subsequent restriction analysis and sequencing with the vector primers (184TetA [5'-CGCCGAAACAAGCGCTCATGAGCC] and 184TetB [5'-CTATGCGCACCCGTTCTCGGAGCAC]) allowed the identification of various classes of plasmids that restored the viability of the sufI mutant on LBON medium. One such suppressor plasmid, pMN60, obtained in this screen carried the complete dapE gene and the C-terminal part of the adjacent acrD gene. Deletion of dapE from pMN60 eliminated the ability to suppress the phenotype of MR22, indicating that dapE was responsible for the multicopy suppression.
Other techniques. Standard protocols were followed for experiments involving recombinant DNA and plasmid manipulations (39). Transpositions, transductions, P1 phage preparations, and ß-galactosidase assays were performed using standard methods, as described previously (33).
Growth and viability measurements. The viability of each strain was measured by applying 8-µl aliquots of various dilutions (10–2, 10–4, 10–5, 10–6, and 10–7) of overnight cultures to appropriate plates and incubating them for 20 to 36 h. The relative plating efficiency and growth were determined for each strain based on comparison with the control strain on the same plate.
Microscopy. The strains to be examined by microscopy were diluted into appropriate medium from fresh overnight cultures and processed after 6 to 8 h of growth. They were fixed in 2% formaldehyde for 1 h at 37°C, washed twice with phosphate-buffered saline, and suspended in the same buffer containing 50% glycerol. For DAPI (4',6'-diamidino-2-phenylindole dihydrochloride) staining of nucleoids, fixed cells were treated with 0.25 µg/ml DAPI for 15 min at room temperature and mounted on slides. Differential interference contrast (DIC) and fluorescence images were taken using a Zeiss Axioplan fluorescence microscope and were processed in Adobe Photoshop.
|
|
|---|
sufI222::Kan), grew quite well on LB plates at all temperatures and on LBON plates at 30°C; however, on LBON at 37°C or 42°C, growth was significantly inhibited (Fig. 1A). This growth inhibition (LBON-Ts) was osmoremedial, as supplementation with any of a variety of osmolytes, such as glucose (Fig. 1A), sucrose, glycerol, or NaCl (data not shown), completely rescued the growth of MR22. The LBON-Ts phenotype of the sufI mutant was seen only on medium exposed to good aerobic conditions; the generation of partially anaerobic conditions by tightly sealing the plate with Parafilm alleviated the LBON-Ts phenotype (Fig. 1A). Furthermore, the addition of a chemical reductant, ascorbate, to the growth medium eliminated the LBON-Ts phenotype (Fig. 1A). Since these observations suggested that molecular oxygen or oxidative stress could be toxic to the sufI mutant, the effect of reactive oxygen radicals on the growth of this mutant was examined by adding either PQ, a redox cycling agent that generates superoxide radicals (O2–), or H2O2, which generates hydroxyl radicals (OH·). The results showed that the sufI mutant was extremely sensitive to PQ (PQs) at 37°C or 42°C (Fig. 1A), indicating that superoxide-generated stress is lethal at high temperatures. It was only slightly sensitive to hydrogen peroxide up to 0.5 mM (data not shown).
![]() View larger version (85K): [in a new window] |
FIG. 1. Growth and filamentation of sufI mutant. (A) Growth of MR2 (wt) and MR22 (sufI) on LBON plates at 30, 37, and 42°C and on LBON plates (at 42°C) with 0.4 M glucose, tightly sealed with Parafilm (to create partial anaerobic conditions), or with 15 mM ascorbate. (Bottom) Growth of wild-type, sufI, and sufI sulA (MR32) strains on LB plates supplemented with either PQ (20 µM) or MMC (0.3 µg/ml) at 42°C. (B) Growth curves for wild-type and sufI strains at 30 or 42°C in LBON broth or LB broth plus PQ (40 µM; LBPQ) at 42°C. (C) DIC micrographs of sufI (a, b, and c) and wild-type (d, e, and f) cells taken out after 90 min, 3 h, or 6 h of growth in LBON at 42°C. The inset in panel c shows a very rare and exceptionally long sufI mutant filament.
|
However, both the LBON-Ts (data not shown) and PQs phenotypes of MR22 (Fig. 1A) were not suppressed by sulA mutation, indicating that sensitivity to oxidative stress is not due to the SOS response caused by DNA damage. On the other hand, strain MR22 was not sensitive to alkylating agents, such as MNNG (N-methyl-N'-nitro-N-nitrosoguanidine) and EMS (ethyl methane sulfonate) (data not shown). An insertion mutation in tatB that affects the formation of a functional TatABC translocase, thereby abolishing the export of SufI into the periplasm, also conferred sensitivity to PQ or MMC at high temperatures; however, the tatB mutant required slightly higher concentrations of these agents for its sensitivity than did the sufI mutant (data not shown).
The sufI mutant is filamentous at high temperatures. Although the growth of strain MR22 was appreciably inhibited on LBON plates at 42°C, the cultures grown in LBON broth showed only a minor decrease in absorbance (A600) values (and also a corresponding reduction in the number of CFU) in the exponential phase and almost no difference in values in the stationary phase compared to those for the wild-type strain, MR2 (Fig. 1B). Likewise, the growth rate of MR22 was also not altered by the addition of PQ (up to 40 µM) to the broth cultures at 42°C (Fig. 1B).
We examined the cell morphology of the sufI mutant by taking aliquots from the cultures growing in LBON at 42°C at various time points. As shown in Fig. 1C, the cells from early exponential phase appeared to be significantly longer and were heterogeneous in size. Nevertheless, the filamentation of these mutants slowly disappeared as the culture entered into stationary phase. At an A600 value of around 1, the cells started regaining their normal shape, and by an A600 value of 1.5, the wild-type and mutant cells were almost indistinguishable, though the latter were slightly elongated (Fig. 1C). However, a few exceptionally long filaments could be seen at a very low frequency (approximately 1 in 104 cells) in the stationary-phase cultures of the sufI mutant (inset in Fig. 1C). A similar pattern of filamentation was seen in cultures grown in either LB or minimal medium (with 0.2% glucose as the C source) at 42°C, demonstrating that cell elongation is a function of temperature and does not depend on the growth rate in the medium (data not shown). Likewise, the presence of PQ in the growth medium had no effect on the filamentation of the sufI mutant; it neither enhanced nor allowed filamentation to persist in the stationary phase (data not shown). Conversely, MMC treatment greatly enhanced the filamentation of the sufI mutant (because of SulA-mediated inhibition of FtsZ), and as expected, this increase was abolished in the sufI sulA double mutant, MR32 (data not shown). Nevertheless, strain MR32 was as filamentous as MR22, clearly indicating that the filamentation seen in the sufI mutant (Fig. 1C) was not a consequence of SOS induction and that SufI as such is required for some step in the process of cell septation.
Visualization of the nucleoids by DAPI staining followed by fluorescence microscopy revealed that they were normal and regularly spaced, without any significant chromosomal aberrations or partition defects (data not shown).
Identification of multicopy suppressors of sufI. To understand the basis of sufI phenotypes, we identified multicopy suppressor plasmids that restored viability to the mutant on LBON at 42°C as described in Materials and Methods. One major class of suppressor plasmids was found to carry the complete ftsN gene. Since multicopy ftsN is known to suppress the defects of many division mutants (11, 14, 38), we tested the effect of plasmid pMN14, a medium-copy-number vector with cloned ftsN (38), on the growth of the sufI strain MR22. The results showed that multicopy ftsN was able to suppress the LBON-Ts phenotype of MR22 very efficiently (Fig. 2). Another set of plasmids conferring multicopy suppression of sufI carried the sdiA locus, which encodes a positive regulator of the ftsQAZ operon (46). Thereafter, the effect of increased ftsQAZ expression was directly examined by introducing plasmid pMN8 (38), and it was also found to confer viability to MR22 on LBON medium. However, plasmids carrying ftsQ, ftsA, ftsQA, and ftsAZ (38) did not restore growth to MR22 on LBON.
![]() View larger version (64K): [in a new window] |
FIG. 2. Suppressors of sufI. Cultures of MR22 carrying the plasmid pCL1920, its derivatives with cloned sufI, ftsQAZ, or ftsN, or pMN60 (pACYC184-dapE) and strains MR29 (sufI ftsA* leuB::Tn10) and MR30 (sufI leuB::Tn10) were grown at 30°C in LB, and various dilutions (10–2, 10–4, 10–5, 10–6, and 10–7) were applied to LBON, LB-plus-PQ (20 µM), or LB-plus-MMC (0.4 µg/ml) plates and grown for 24 h at 42°C.
|
In addition to conferring growth on LBON at 42°C, all of the above-described plasmids relieved both the PQs and MMCs phenotypes of strain MR22 (Fig. 2). The filamentation of MR22 carrying these plasmids was also completely reduced (data not shown).
The ftsA* allele alleviates the defects of the sufI mutant. ftsA* is a gain-of-function allele that encodes a mutant FtsA protein (R286W) which is capable of suppressing the defects of zipA (15), ftsK (14), and ftsN (4) deletion mutants. The ftsA* allele was introduced into strain MR22 by phage P1-mediated transduction with the linked leuB::Tn10 marker (as described in Materials and Methods), and it was observed that the transductants carrying the ftsA* allele were not sensitive to either PQ or MMC and showed no growth defects on LBON at 42°C (Fig. 2). The double mutants also regained their normal cell shape at high temperatures (data not shown).
Multicopy SufI suppresses the division defects of ftsA12, ftsQ1, and ftsK44 mutants but not that of an ftsZ84 mutant.
It was shown earlier that multicopy sufI could partially suppress the thermosensitivity of an ftsI23 mutant (25). In addition, it restored the viability of
ftsEX mutants under low-osmolarity conditions (38). Here the ability of multicopy sufI to suppress the defects of other division mutants was examined by introducing the plasmid pCL1920 (control vector) or pMN16 (pCL1920 with cloned sufI) into strains MR24, MR25, MR26, and MR27, which carry ftsZ84 (Ts), ftsA12 (Ts), ftsK44 (Ts), and ftsQ1 (Ts) mutations, respectively. As shown in Fig. 3A, strain MR26/pMN16 grew well at 42°C on both LB (Fig. 3A) and LBON (data not shown) plates, and correspondingly, its filamentation was notably decreased (Fig. 3B). Strains MR25/pMN16 and MR27/pMN16 also grew well at 42°C on LB plates (Fig. 3A) but not on LBON plates (data not shown). The filamentation of these strains was not significantly decreased at 42°C, although the filaments appeared to be slightly shorter and healthier (data not shown). However, the filamentation of both of these strains was considerably reduced when they were grown at 37°C (Fig. 3B). The plasmid pMN16 did not suppress the temperature sensitivity of strain MR24 on either LBON (Fig. 3A) or LBON supplemented with 0.5% NaCl (data not shown), and likewise, the filamentation remained unchanged (data not shown).
![]() View larger version (117K): [in a new window] |
FIG. 3. Effects of multicopy sufI on growth and filamentation of division mutants. (A) Viability of division mutants carrying the vector, pCL1920 (–), or pMN16 (+) on LB plates at 30 or 42°C. ftsZ84 mutants were plated on LBON. (B) DIC micrographs of ftsA12, ftsK44, and ftsQ1 strains carrying either pCL1920 (a, b, and c) or pMN16 (d, e, and f). Cells were grown to mid-exponential phase in LB at 37°C (ftsA12 and ftsQ1 cells) or 42°C (ftsK44 cells) and then taken for microscopy.
|
ftsEX, or
sufI allele) to DNA damage or oxidative stress by exposing them to either MMC or PQ at 30°C. Compared to the wild-type strain MR2, all of the division mutants, excepting the ftsZ84 mutant, were sensitive to both agents at a range of concentrations. Of all the mutants, strains MR28 (ftsI23) and MR10 (
ftsEX) were extremely sensitive to MMC (at 0.4 µg/ml) and PQ (at 15 µM), and this sensitivity was abolished by overexpression of SufI. Plasmid pMN58, a derivative of pBAD18 with sufI placed under the control of the arabinose-regulated promoter, conferred a growth ability on MR28 and MR10 upon the addition of 0.2% arabinose, whereas the addition of glucose had no effect (Fig. 4).
![]() View larger version (65K): [in a new window] |
FIG. 4. Effects of multicopy sufI on MMC and PQ sensitivities of division mutants. Cultures of ftsEX::Kan, ftsI23, and sufI mutants carrying plasmid pMN58 (pBAD18-sufI) were grown, and dilutions were applied to LB-MMC (0.4 µg/ml) or LB-PQ (15 µM) plates supplemented with either 0.2% L-arabinose or D-glucose and incubated for 24 h at 30°C.
|
Transcriptional regulation of sufI. To examine whether the expression of sufI is regulated by conditions of stress, the promoter of sufI was cloned into the single-copy promoter-probe vector pMU2385 (45), and its expression was measured by ß-galactosidase reporter gene assays. The basal level of ß- galactosidase activity of the vector was in the range of 3 to 5 Miller units, whereas plasmid pMN59 (with the sufI promoter) showed activity of 25 to 30 Miller units, indicating that the promoter is weak. None of the perturbations tested, including altered temperature, osmolarity, stationary phase, oxidative stress, DNA damage, or mutations in either the stationary-phase sigma factor gene rpoS or soxR, encoding an activator of the superoxide regulon, affected the promoter strength of the sufI promoter.
|
|
|---|
Role of SufI in cell division. The sulA-independent filamentation phenotype of the sufI deletion mutant at 42°C indicates that some step of cell septation is blocked at high temperatures (Fig. 1C). The filamentation pattern of the sufI mutant is interesting in that cells in the early exponential phase exhibit cell elongation but gradually regain their normal cell shape at later stages of growth (Fig. 1C), suggesting the existence of an adaptation mechanism that operates in stationary phase. Since the stationary-phase sigma factor RpoS regulates a morphogene, bolA, that controls cell shape in stationary phase (27), an rpoS deletion was introduced but was shown not to alter the viability or filamentation pattern of MR22 (data not shown). One other possible reason for this growth phase-dependent filamentation of the sufI mutant could be the generation of partially anaerobic conditions in the medium with increasing culture density; however, cells grown with high or low aeration did not show significant variation in filamentation (data not shown).
The suppression of sufI mutant filamentation by factors that stabilize the FtsZ ring assembly strongly argues for the functional involvement of sufI in the division process. Most of the phenotypes of the sufI mutant (Fig. 1) were suppressed by multiple copies of FtsQAZ, showing that a coordinated increase of all these divisomal proteins removes the defect of sufI deletion (Fig. 2). Likewise, multicopy FtsN also abolished all the defects of the sufI mutant. Furthermore, the presence of the gain-of-function ftsA* allele, which codes for an altered FtsA (R286W) protein, alleviated the phenotypes of the sufI mutant very efficiently (Fig. 2). This allele emerged as a nonspecific suppressor of most of the division mutants and, interestingly, was able to eliminate the requirement for several essential division proteins, such as ZipA (15), FtsK (14), FtsN (4), and FtsEX (Reddy, unpublished observations), most likely by stabilizing the FtsZ ring assembly (16). In accordance with all of the above observations, a SufI-green fluorescent protein fusion protein has been shown to localize to the division septum (David Weiss, personal communication).
SufI is required for growth under conditions of stress. Most of the phenotypes of the sufI mutant were more striking at 37 or 42°C, reflecting the need for SufI at high temperatures (Fig. 1A) and/or implicating high temperature as a sensitizing factor for the assembly of the divisome (38). It appears that SufI is rendered essential for the growth of E. coli whenever the division process is compromised by various conditions, as described below.
(i) Decreased FtsZ function through high levels of SulA, generated either by treatment with the DNA-damaging agent MMC or by a mutation in Lon protease, is detrimental to the sufI mutant (Fig. 1A). This premise is also strengthened by the extreme sickness of an ftsZ84 sufI double mutant at 42°C (on LBON plates that contained 0.7% NaCl, on which both the single mutants grew reasonably well) and also by its filamentation phenotype in LB at 30°C, where the single mutants showed normal cell morphology (data not shown). Hence, it seems that the MMCs phenotype of the sufI mutant is due to two overlapping mechanisms, i.e., compromised division in the absence of SufI coupled to the lowered activity of FtsZ.
(ii) SufI is also required for the growth and viability of the various division-defective mutants carrying the ftsQ1 (Ts), ftsK44 (Ts), ftsI23 (Ts), or
ftsEX allele. The extent of dependence on SufI may vary with the severity of the division-defective mutation, and this could be the most likely basis for the absolute requirement of SufI for the viability of either the
ftsEX or ftsI23 mutant (38; this study).
(iii) Unlike the MMCs phenotype, both the PQs and LBON-Ts phenotypes of the sufI mutant are not suppressed by a mutation in sulA, showing that these are not the result of a DNA damage response (Fig. 1A). This observation permitted us to speculate that oxidative damage may cause stress to the divisomal assembly, and the fact that most of the division mutants are sensitive to superoxide radicals (Fig. 4) supports the idea that the division process could be intrinsically sensitive to oxidative stress.
However, the effect of oxidative stress on the division assembly could be indirect, as growth at high temperatures coupled with increased oxidative stress or low osmotic strength may require a higher activity of chaperones and therefore may affect the proper folding of division proteins. It was recently shown that the chaperonin GroE is involved in folding of the division protein FtsE, and the filamentation phenotype of a GroE depletion mutant is due to the improper folding of FtsE (13). It has been shown that the rate of superoxide formation in the periplasm is fairly high (
3 µM/s, when normalized to the estimated periplasmic volume, whereas the rate in the cytosol is
5 µM/s), and it also contains a Cu, Zn superoxide dismutase (SodC) for scavenging the periplasmic superoxides (19, 26). Yet sodC mutants are not sensitive to superoxide-generating agents, indicating that there probably should be some hitherto unidentified factor(s) that protects the periplasm from superoxide stress (19). However, the preliminary observations show that a sufI sodC double mutant is viable and just as PQ sensitive as the sufI single mutant. Likewise, mutations in sodAB which abolish the cytoplasmic superoxide dismutase activity (10) also did not alter the viability or filamentation pattern of the sufI mutant (data not shown).
SufI stabilizes the divisomal assembly. In an earlier study (38), we speculated that both SufI and FtsEX may have redundant functions, based on the findings that (i) the presence of sufI is essential for the viability of an ftsEX deletion mutant and (ii) the multicopy SufI protein is able to substitute for the functions of FtsEX. However, in this study, it was observed that the absence of SufI is detrimental to the growth of several division-defective mutants. Hence, it is possible that the function of SufI may not be particularly redundant or overlapping with that of FtsEX alone but may have a wide-ranging role in protecting the divisomal assembly or its components. In support of this, multicopy sufI suppressed the growth defects of division mutants carrying the ftsA12, ftsEX, ftsK44, ftsQ1, or ftsI23 allele (25, 38; this study). In addition to suppressing the thermosensitivity of the division mutants (Fig. 3A), multicopy sufI also abolished the PQ and MMC sensitivity of ftsI23 and ftsEX mutants (Fig. 4), validating the idea that SufI protects the divisomal components against damage caused by various stress conditions. Preliminary observations from this laboratory showed that increased FtsQAZ or FtsN also suppresses the PQ and MMC sensitivity of ftsI23 and ftsEX mutants.
The restoration of the growth defects of the division mutants by multicopy sufI is reminiscent of the suppression shown by multicopy ftsN (11). Both sufI and ftsN in multiple copies are able to confer growth to all of the above mutants, except the ftsZ84 mutant. The role of FtsN in division is not clear; in vitro, it binds murein sacculus and is presumed to be involved in peptidoglycan assembly or stabilization of the divisome components (42). It is possible that SufI may also function in an analogous way. As proposed earlier (14), division proteins may perform two main functions: one is to stabilize the interactions between divisome components, and the second is to generate the division septum. SufI may fall into the former class of divisome proteins.
However, the precise biochemical function of SufI does not emerge from these studies. A homology search with SufI has shown that it belongs to the multicopper oxidase family. It closely resembles the blue copper oxidase (CueO) of E. coli and, to a lesser extent, the spore coat protein (CotA) of Bacillus subtilis. Both CueO and CotA are copper-dependent oxidoreductases. CueO is a TatABC substrate that confers copper tolerance to E. coli by oxidizing the toxic cuprous ions into cupric ions in the periplasm (20), whereas CotA is a thermostable laccase that protects the spores of B. subtilis against UV irradiation and oxidative stress (23). Unlike its homologs, SufI is not known to bind any cofactor (3). SufI does not appear to be a ubiquitous protein. In this context, it is interesting that both FtsN and SufI are present only in organisms belonging to the orders Enterobacteriales and Pasteurellales of the Gammaproteobacteria.
Our results, along with the localization data of David Weiss, strongly argue for a role of sufI in the cell division of E. coli. Since sufI fulfils the requirements of an fts gene (as defined in reference 9), we propose that it be redesignated ftsP. In addition, this will avoid confusion with other known suf genes (the sufABCDSE operon located at 37.9 min) that are involved in the biogenesis of iron-sulfur (Fe-S) clusters in E. coli (37).
This work was supported in part by funds from the Department of Biotechnology (DBT), Government of India. H.S. is a DBT postdoctoral fellow.
Published ahead of print on 31 August 2007. ![]()
H.S. and L.S. contributed equally to the study. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»