This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antunes, L. C. M.
Right arrow Articles by Greenberg, E. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antunes, L. C. M.
Right arrow Articles by Greenberg, E. P.

 Previous Article  |  Next Article 

Journal of Bacteriology, November 2007, p. 8387-8391, Vol. 189, No. 22
0021-9193/07/$08.00+0     doi:10.1128/JB.00736-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Transcriptome Analysis of the Vibrio fischeri LuxR-LuxI Regulon{triangledown}

Luis Caetano M. Antunes,1,2 Amy L. Schaefer,2 Rosana B. R. Ferreira,1,2 Nan Qin,3 Ann M. Stevens,3 Edward G. Ruby,4 and E. Peter Greenberg2*

Department of Microbiology, University of Iowa, Iowa City, Iowa 52242,1 Department of Microbiology, University of Washington, Seattle, Washington 98195,2 Department of Biological Sciences, Virginia Tech, Blacksburg, Virginia 24061,3 Department of Medical Microbiology and Immunology, University of Wisconsin, Madison, Wisconsin 537064

Received 10 May 2007/ Accepted 27 August 2007


arrow
ABSTRACT
 
The Vibrio fischeri quorum-sensing signal N-3-oxohexanoyl-L-homoserine lactone (3OC6-HSL) activates expression of the seven-gene luminescence operon. We used microarrays to unveil 18 additional 3OC6-HSL-controlled genes, 3 of which had been identified by other means previously. We show most of these genes are regulated by the 3OC6-HSL-responsive transcriptional regulator LuxR directly. This demonstrates that V. fischeri quorum sensing regulates a substantial number of genes other than those involved in light production.


arrow
TEXT
 
Quorum sensing allows a species to measure its population density and control gene expression in a population density-dependent manner. Bacterial quorum sensing involves cell-cell communication mediated by extracellular signal compounds. Various species of proteobacteria use acyl-homoserine lactones (acyl-HSLs) as quorum-sensing signals (2, 12-15, 36, 42). Acyl-HSL quorum sensing was first described in the marine luminescent bacterium Vibrio fischeri, where it controls transcription of the luminescence (lux) operon (7, 10, 11). The LuxI acyl-HSL synthase and the LuxR transcriptional activator constitute the quorum-sensing system, which controls the lux operon directly. The LuxI-generated signal is N-3-oxohexanoyl-L-HSL (3OC6-HSL), and LuxR activates the lux operon in response to this signal. The LuxR-3OC6-HSL complex binds to a 20-bp inverted repeat centered at –42.5 from the transcriptional start site of the lux operon (for reviews, see references 14, 36, and 41).

Vibrio fischeri occurs at low population densities in seawater and at high densities in specific light organ symbioses with certain fish and squid (3, 21, 29). Quorum sensing allows V. fischeri to discern its existence in the symbiosis and activate transcription of the lux operon (4). Many proteobacteria have acyl-HSL signaling systems, which serve as global regulators of extracellular factor production and are often important for successful interactions with plant or animal hosts (26, 36). Existing evidence shows that besides the lux operon, LuxR and 3OC6-HSL activate five other genes (5). However, the search for quorum-controlled genes in V. fischeri has been limited to proteomic analyses. We recently reported the complete genome sequence of a strain of V. fischeri isolated from a squid light organ (30). Thus, it is now possible to use DNA microarrays to identify LuxR-regulated V. fischeri genes on a global scale. We have designed and constructed a microarray and used it to perform an analysis of 3OC6-HSL-regulated genes in V. fischeri. We furthered this analysis by examining the activity of relevant promoters in response to 3OC6-HSL and LuxR in recombinant Escherichia coli and by analyzing the binding of LuxR to promoter DNA fragments in vitro.

We used E. coli DH12S (Invitrogen, Carlsbad, CA) and V. fischeri ES114 (3). The genome sequence of V. fischeri ES114 is publicly available at http://www.ergo-light.com (30). We used Luria-Bertani broth (31) without added sodium chloride to grow E. coli, at 30°C, and seawater-tryptone broth (3) with seawater salts (300 mM NaCl, 10 mM KCl, 50 mM MgSO4, 10 mM CaCl2) to grow V. fischeri at 28°C. All cultures were grown with shaking at 250 rpm. For LuxR expression in E. coli, we used pHV402, which contains a chloramphenicol resistance gene and contains luxR controlled by its own promoter (18). For cloning of promoter elements, we used pPROBE-gfp[LVA], which contains a promoterless gfp and a kanamycin resistance marker (24). Chloramphenicol and kanamycin were used for plasmid maintenance at 25 and 50 µg/ml, respectively. 3OC6-HSL (Sigma, St. Louis, MO) was added as described elsewhere (33) at a final concentration of 2.3 or 1 µM, as indicated.

In conjunction with Affymetrix (Santa Clara, CA), we designed custom GeneChips (11-µm feature size) representing >99% of the annotated open reading frames in the V. fischeri ES114 genome, as well as 125 intergenic regions greater than 150 bp. GeneChips were designed as described by the manufacturer, except that because the V. fischeri genome has a low G+C content (38 mol%), we used 16 probe pair sets (25-bp oligonucleotide probe length) per gene or intergenic region. Poly(A) control sequences of dap, lys, phe, and trp from Bacillus subtilis were included. We compared transcript profiles of V. fischeri ES114 grown in the presence versus the absence of added 3OC6-HSL (1 µM). Compared to other strains of V. fischeri, strain ES114 produces little 3OC6-HSL in laboratory culture (4). While it produces 3OC6-HSL in amounts insufficient to appreciably induce the lux genes (23, 39), strain ES114 produces larger quantities of a second acyl-HSL, C8-HSL, by using an enzyme called AinS (16, 19). C8-HSL can bind LuxR, but C8-HSL does not appreciably activate LuxR (32, 39). However, C8-HSL can affect lux gene expression in V. fischeri ES114 indirectly (23). Therefore, we were able to add 3OC6-HSL to wild-type cultures and monitor the induction of LuxR-controlled genes. We isolated and purified RNA for GeneChip analysis at culture optical density at 600 nm (OD600) values of 0.3 and 1.5, prepared cDNA, and performed hybridizations and scanning as described elsewhere (www.affymetrix.com). Results are the averages from two independent experiments, and the results were analyzed by using the Affymetrix Microarray Suite v.5 and Cyber-T (http://cybert.microarray.ics.uci.edu) (1). We sorted for genes that showed 2.5-fold or greater differential regulation with a P value of <0.001.

Predicted promoter regions of genes identified as 3OC6-HSL-regulated in transcript analyses were amplified by PCR with V. fischeri genomic DNA as the template. Fusions were constructed by generation of PCR fragments tailed with EcoRI and BamHI sites, digestion of the PCR fragments with EcoRI and BamHI, and ligation of the digested PCR fragments with EcoRI-BamHI-digested pPROBE-gfp[LVA]. The resulting plasmids were used to transform E. coli DH12S with or without pHV402 as previously described (31). Promoter activity was measured as follows. Overnight cultures of recombinant E. coli were used to inoculate fresh cultures at a starting OD600 of 0.1 in medium with or without added 3OC6-HSL (2.3 µM). At an OD600 of 1.2 (±0.2), cells from each culture were pelleted by centrifugation and suspended in phosphate-buffered saline and the fluorescence of the suspension was measured with a GENios Pro 96-well plate reader (TECAN, Research Triangle Park, NC). Results are the averages of three independent experiments.

Global analysis of 3OC6-HSL-regulated gene expression. Our microarray analysis revealed 30 genes and 2 intergenic regions with transcript levels that were at least 2.5-fold different when 3OC6-HSL-grown cells were compared to cells grown without added 3OC6-HSL (Table 1). One of the 30 genes (VFA0895) showed a minimal activation, and it overlaps and forms a predicted operon with VFA0896 (http://www.ergo-light.com), which was not regulated by 3OC6-HSL in our experiments. We did not study VFA0895 further. Also, VF1247, VF1615, VF2034, VF2035, VF2036, and VFA0834 showed induction levels just above our 2.5-fold cutoff (2.6- to 3.2-fold). We examined transcript levels of these six genes further by real-time PCR using SYBR green PCR master mix (Applied Biosystems, Foster City, CA), 5 ng of cDNA, and 900 nM of each primer. With the exception of VF1247 and VF1615, all genes showed minimal activation by 3OC6-HSL (<2-fold). Thus, we did not examine VF2034 to VF2036 and VFA0834 further.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Differential expression of V. fischeri genes in response to 3OC6-HSL

The 25 3OC6-HSL-controlled genes we continued to study were distributed almost equally between the large and small V. fischeri chromosomes. We did not study expression of the intergenic regions differentially regulated by 3OC6-HSL (Table 1). Twenty-four of the 25 genes were induced and 1 was repressed by the quorum-sensing signal (Table 1). Ten of these genes have been identified previously as 3OC6-HSL controlled: VF1977, VF1978, and VFA1058 (5) and the 7 genes in the lux operon (7, 10, 11). These genes code for functions related to light production or have unknown functions. Activities predicted for the 15 newly discovered genes include protease and peptidase functions, an ABC-type transporter, and a mechanosensitive ion channel.

Many of the 3OC6-HSL-regulated genes we discovered are predicted to be in operons (http://www.cifn.unam.mx/moreno/pub/TUpredictions/Predictions/) (25). There are two clusters of linked genes predicted to consist of two transcriptional units each: VFA0924 to VFA0918 and VF1348 and VF1349. The in silico predictions are based primarily on distances between predicted reading frames and are conservative predictors of operons. In fact, we know from previous work that the VFA0924-to-VFA0918 cluster, luxICDABEG, is organized as an operon (10, 11). To determine whether VF1348 and VF1349 might constitute an operon, we performed open reading frame junction-based reverse transcription-PCR, and the analysis supports the contention that these two genes constitute an operon (data not shown). Thus, the 3OC6-HSL-controlled genes identified in the microarray analysis appear to be organized as 13 transcriptional units: 4 multigene operons and 9 single-gene units (Fig. 1).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 1. Genetic organization and transcription activation of 3OC6-HSL-controlled genes. White arrows represent 3OC6-HSL-activated genes, and a black arrow represents the 3OC6-HSL-repressed gene. Genes previously reported as 3OC6-HSL controlled are represented by gray arrows. The directions of the arrows indicate the DNA strand. The values for gene activation (relative units of GFP fluorescence per OD unit) are shown above the first gene in each operon and are from the E. coli expression studies described in the text. In all cases, basal levels of expression with LuxR and without 3OC6-HSL or without LuxR and with 3OC6-HSL were <200 fluorescence units. The values are means of three independent experiments, and the ranges were ±28% of the means.

Evidence for direct LuxR activation of 3OC6-HSL-controlled operons. In the first analysis, we examined the dependence of GFP expression driven by the predicted promoter region of each of the 13 3OC6-HSL-regulated V. fischeri transcriptional units in recombinant E. coli. Eleven of the 12 3OC6-HSL-activated promoters showed 3OC6-HSL-LuxR dependence (Fig. 1). The 3OC6-HSL-repressed promoter did not show LuxR-dependent control in E. coli. We confirmed a direct interaction of LuxR with 7 of the 11 promoters activated by LuxR in E. coli (VF1247, VF1349, VF1725, VFA0622, VFA0894, VFA0924, and VFA1058) by showing that they bind to purified LuxR in vitro (Fig. 2). One interpretation of our inability to demonstrate LuxR binding to the other four promoters in vitro is that they are low-affinity LuxR binding targets.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 2. Gel shift assays showing direct binding of purified LuxR to promoters of 3OC6-HSL-regulated genes in vitro. Experiments were performed as previously described (28, 37). Reaction mixtures contained 1 fmol of DNA, 6 µM 3OC6-HSL, and either no LuxR (–) or LuxR at a final concentration of 6.2 nM (+). DNA probes were generated by PCR amplification of promoter regions using the transcriptional fusion plasmids as templates. Probes are shown side by side to facilitate comparison, even though sizes are different. VF0090 is shown as an example of a promoter fragment that is not shifted by LuxR, and this serves as a negative control.

Search for LuxR binding sites in 3OC6-HSL-controlled promoter regions. The LuxR protein interacts with a 20-bp inverted repeat centered at –42.5 from the start of luxICDABEG transcription (6, 8, 9, 37). We sought to assess whether the other LuxR-controlled transcriptional units have similar sequences in their promoter regions by searching for similarities to a relaxed consensus sequence (DVCTGYADKAWNNKACAGKW) based on multiple V. fischeri luxI promoter sequences available from the NCBI database (http://www.ncbi.nlm.nih.gov/) and promoter sequences of qsrP from V. fischeri MJ-100 and ESR1 and ribB from MJ-100 (5) by using the Regulatory Sequence Analysis Tools (http://rsat.ulb.ac.be/rsat/) (38). Out of the 11 promoter regions searched, only 2 showed identifiable lux boxes. The promoter of VFA0924 (luxI) showed the canonical lux box, and the promoter of VFA1058 (qsrP) presented the sequence ACCTGTAATAAACGACAGGA, which was described previously as a potential lux box (5, 28). Our lack of ability to identify lux box elements in the other nine promoters indicates that we do not yet have a clear picture of the elements required for LuxR binding to any given 3OC6-HSL-dependent promoter region. This is not surprising in light of the fact that the Pseudomonas aeruginosa LuxR homolog LasR can bind to lux box-like sequences called las boxes and also to sequences with no obvious similarity to las boxes (35). A considerably more detailed analysis is required to identify the LuxR binding determinants in the newly discovered quorum-sensing controlled promoters.

Acyl-HSL quorum sensing was discovered in V. fischeri, where it regulates the seven-gene lux operon (7, 10, 11). Studies of other proteobacteria have revealed that acyl-HSL signaling often regulates multiple genes that are distributed throughout the genome (for example, see references 34 and 40). In P. aeruginosa, a number of acyl-HSL-controlled genes code for the production of extracellular virulence factors (20, 34, 40). A few V. fischeri 3OC6-HSL-controlled genes in addition to the lux genes have been described previously (5, 28). We used a V. fischeri DNA microarray to identify 14 previously unreported 3OC6-HSL-activated genes and 1 3OC6-HSL-repressed gene. The annotation of the V. fischeri genome indicates four of the 3OC6-HSL-activated genes we identified code for proteases or peptidases (Table 1). Protease and peptidase genes are regulated by acyl-HSL quorum sensing in other bacteria (34, 40). We know that V. fischeri can acquire amino acids from the squid host during growth in the light organ (17). These 3OC6-HSL-induced proteases and peptidases may thus have significant roles in the symbiosis, aiding in nutrient acquisition. The activated genes also include an intimin-like adhesin (VFA0894). In E. coli, an intimin is involved in virulence by mediating bacterial attachment to mammalian host cells (22). Therefore, it is easy to imagine that the V. fischeri intimin-like protein could be involved in the light organ symbiosis. A gene annotated as coding for an accessory colonization factor A-like protein is also activated by 3OC6-HSL. This gene shows significant sequence similarity to the V. cholerae acfA gene, which is required for efficient intestinal colonization by this pathogen (27). Previous studies showed that a LuxR mutant derived from V. fischeri ES114 colonized light organs at a reduced level compared to its parent. The colonization defect could be compensated for by provision of the lux genes under control of a LuxR-independent promoter (39). These experiments on initial light organ colonization suggest that if any of the genes we have uncovered are involved in symbiotic competence, the involvement is likely to be subsequent to initial colonization.

Microarray data accession number. The microarray data have been deposited in the GEO database (http://www.ncbi.nlm.nih.gov/geo) under accession no. GSE7485.


arrow
ACKNOWLEDGMENTS
 
We thank Sudha Chugani for help with real-time PCR experiments and analysis of microarray results. The cDNA hybridization and microarray scanning were performed by the University of Washington Center for Expression Arrays.

This work was supported by a grant from the W. M. Keck Foundation (E.P.G.) and a subcontract from NIH grant GM066786 (A.M.S.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, HSC K-359, University of Washington School of Medicine, 1959 NE Pacific St., Seattle, WA 98195. Phone: (206) 616-2881. Fax: (206) 616-2938. E-mail: epgreen{at}u.washington.edu Back

{triangledown} Published ahead of print on 7 September 2007. Back


arrow
REFERENCES
 
    1
  1. Baldi, P., and A. D. Long. 2001. A Bayesian framework for the analysis of microarray expression data: regularized t-test and statistical inferences of gene changes. Bioinformatics 17:509-519.[Abstract/Free Full Text]
  2. 2
  3. Bassler, B. L., and R. Losick. 2006. Bacterially speaking. Cell 125:237-246.[CrossRef][Medline]
  4. 3
  5. Boettcher, K. J., and E. G. Ruby. 1990. Depressed light emission by symbiotic Vibrio fischeri of the sepiolid squid Euprymna scolopes. J. Bacteriol. 172:3701-3706.[Abstract/Free Full Text]
  6. 4
  7. Boettcher, K. J., and E. G. Ruby. 1995. Detection and quantification of Vibrio fischeri autoinducer from symbiotic squid light organs. J. Bacteriol. 177:1053-1058.[Abstract/Free Full Text]
  8. 5
  9. Callahan, S. M., and P. V. Dunlap. 2000. LuxR- and acyl-homoserine-lactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri. J. Bacteriol. 182:2811-2822.[Abstract/Free Full Text]
  10. 6
  11. Devine, J. H., G. S. Shadel, and T. O. Baldwin. 1989. Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744. Proc. Natl. Acad. Sci. USA 86:5688-5692.[Abstract/Free Full Text]
  12. 7
  13. Eberhard, A., A. L. Burlingame, C. Eberhard, G. L. Kenyon, K. H. Nealson, and N. J. Oppenheimer. 1981. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20:2444-2449.[CrossRef][Medline]
  14. 8
  15. Egland, K. A., and E. P. Greenberg. 2000. Conversion of the Vibrio fischeri transcriptional activator, LuxR, to a repressor. J. Bacteriol. 182:805-811.[Abstract/Free Full Text]
  16. 9
  17. Egland, K. A., and E. P. Greenberg. 1999. Quorum sensing in Vibrio fischeri: elements of the luxI promoter. Mol. Microbiol. 31:1197-1204.[CrossRef][Medline]
  18. 10
  19. Engebrecht, J., K. Nealson, and M. Silverman. 1983. Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32:773-781.[CrossRef][Medline]
  20. 11
  21. Engebrecht, J., and M. Silverman. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl. Acad. Sci. USA 81:4154-4158.[Abstract/Free Full Text]
  22. 12
  23. Fuqua, C., and E. P. Greenberg. 2002. Listening in on bacteria: acyl-homoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3:685-695.[CrossRef][Medline]
  24. 13
  25. Fuqua, C., and E. P. Greenberg. 1998. Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr. Opin. Microbiol. 1:183-189.[CrossRef][Medline]
  26. 14
  27. Fuqua, C., M. R. Parsek, and E. P. Greenberg. 2001. Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu. Rev. Genet. 35:439-468.[CrossRef][Medline]
  28. 15
  29. Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 50:727-751.[CrossRef][Medline]
  30. 16
  31. Gilson, L., A. Kuo, and P. V. Dunlap. 1995. AinS and a new family of autoinducer synthesis proteins. J. Bacteriol. 177:6946-6951.[Abstract/Free Full Text]
  32. 17
  33. Graf, J., and E. G. Ruby. 1998. Host-derived amino acids support the proliferation of symbiotic bacteria. Proc. Natl. Acad. Sci. USA 95:1818-1822.[Abstract/Free Full Text]
  34. 18
  35. Gray, K. M., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1994. Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. J. Bacteriol. 176:3076-3080.[Abstract/Free Full Text]
  36. 19
  37. Kuo, A., N. V. Blough, and P. V. Dunlap. 1994. Multiple N-acyl-L-homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. J. Bacteriol. 176:7558-7565.[Abstract/Free Full Text]
  38. 20
  39. Latifi, A., M. K. Winson, M. Foglino, B. W. Bycroft, G. S. Stewart, A. Lazdunski, and P. Williams. 1995. Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 17:333-343.[CrossRef][Medline]
  40. 21
  41. Lee, K.-H., and E. G. Ruby. 1992. Detection of the light organ symbiont, Vibrio fischeri, in Hawaiian seawater by using lux gene probes. Appl. Environ. Microbiol. 58:942-947.[Abstract/Free Full Text]
  42. 22
  43. Luo, Y., E. A. Frey, R. A. Pfuetzner, A. L. Creagh, D. G. Knoechel, C. A. Haynes, B. B. Finlay, and N. C. Strynadka. 2000. Crystal structure of enteropathogenic Escherichia coli intimin-receptor complex. Nature 405:1073-1077.[CrossRef][Medline]
  44. 23
  45. Lupp, C., M. Urbanowski, E. P. Greenberg, and E. G. Ruby. 2003. The Vibrio fischeri quorum-sensing systems ain and lux sequentially induce luminescence gene expression and are important for persistence in the squid host. Mol. Microbiol. 50:319-331.[CrossRef][Medline]
  46. 24
  47. Miller, W. G., J. H. Leveau, and S. E. Lindow. 2000. Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol. Plant-Microbe Interact. 13:1243-1250.[Medline]
  48. 25
  49. Moreno-Hagelsieb, G., and J. Collado-Vides. 2002. A powerful non-homology method for the prediction of operons in prokaryotes. Bioinformatics 18(Suppl. 1):S329-S336.[Abstract]
  50. 26
  51. Parsek, M. R., and E. P. Greenberg. 2000. Acyl-homoserine lactone quorum sensing in gram-negative bacteria: a signaling mechanism involved in associations with higher organisms. Proc. Natl. Acad. Sci. USA 97:8789-8793.[Abstract/Free Full Text]
  52. 27
  53. Peterson, K. M., and J. J. Mekalanos. 1988. Characterization of the Vibrio cholerae ToxR regulon: identification of novel genes involved in intestinal colonization. Infect. Immun. 56:2822-2829.[Abstract/Free Full Text]
  54. 28
  55. Qin, N., S. M. Callahan, P. V. Dunlap, and A. M. Stevens. 2007. Analysis of LuxR regulon gene expression during quorum sensing in Vibrio fischeri. J. Bacteriol. 189:4127-4134.[Abstract/Free Full Text]
  56. 29
  57. Ruby, E. G., and K. H. Nealson. 1976. Symbiotic association of Photobacterium fischeri with the marine luminous fish Monocentris japonica: a model of symbiosis based on bacterial studies. Biol. Bull. 151:574-586.[Abstract/Free Full Text]
  58. 30
  59. Ruby, E. G., M. Urbanowski, J. Campbell, A. Dunn, M. Faini, R. Gunsalus, P. Lostroh, C. Lupp, J. McCann, D. Millikan, A. Schaefer, E. Stabb, A. Stevens, K. Visick, C. Whistler, and E. P. Greenberg. 2005. Complete genome sequence of Vibrio fischeri: a symbiotic bacterium with pathogenic congeners. Proc. Natl. Acad. Sci. USA 102:3004-3009.[Abstract/Free Full Text]
  60. 31
  61. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  62. 32
  63. Schaefer, A. L., B. L. Hanzelka, A. Eberhard, and E. P. Greenberg. 1996. Quorum sensing in Vibrio fischeri: probing autoinducer-LuxR interactions with autoinducer analogs. J. Bacteriol. 178:2897-2901.[Abstract/Free Full Text]
  64. 33
  65. Schaefer, A. L., B. L. Hanzelka, M. R. Parsek, and E. P. Greenberg. 2000. Detection, purification, and structural elucidation of the acylhomoserine lactone inducer of Vibrio fischeri luminescence and other related molecules. Methods Enzymol. 305:288-301.[Medline]
  66. 34
  67. Schuster, M., C. P. Lostroh, T. Ogi, and E. P. Greenberg. 2003. Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis. J. Bacteriol. 185:2066-2079.[Abstract/Free Full Text]
  68. 35
  69. Schuster, M., M. L. Urbanowski, and E. P. Greenberg. 2004. Promoter specificity in Pseudomonas aeruginosa quorum sensing revealed by DNA binding of purified LasR. Proc. Natl. Acad. Sci. USA 101:15833-15839.[Abstract/Free Full Text]
  70. 36
  71. Smith, D., J. H. Wang, J. E. Swatton, P. Davenport, B. Price, H. Mikkelsen, H. Stickland, K. Nishikawa, N. Gardiol, D. R. Spring, and M. Welch. 2006. Variations on a theme: diverse N-acyl homoserine lactone-mediated quorum sensing mechanisms in gram-negative bacteria. Sci. Prog. 89:167-211.[Medline]
  72. 37
  73. Urbanowski, M. L., C. P. Lostroh, and E. P. Greenberg. 2004. Reversible acyl-homoserine lactone binding to purified Vibrio fischeri LuxR protein. J. Bacteriol. 186:631-637.[Abstract/Free Full Text]
  74. 38
  75. van Helden, J. 2003. Regulatory sequence analysis tools. Nucleic Acids Res. 31:3593-3596.[Abstract/Free Full Text]
  76. 39
  77. Visick, K. L., J. Foster, J. Doino, M. McFall-Ngai, and E. G. Ruby. 2000. Vibrio fischeri lux genes play an important role in colonization and development of the host light organ. J. Bacteriol. 182:4578-4586.[Abstract/Free Full Text]
  78. 40
  79. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski. 2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J. Bacteriol. 185:2080-2095.[Abstract/Free Full Text]
  80. 41
  81. Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 21:319-346.[CrossRef][Medline]
  82. 42
  83. Williams, P., K. Winzer, W. C. Chan, and M. Camara. 2007. Look who's talking: communication and quorum sensing in the bacterial world. Philos. Trans. R. Soc. Lond. B Biol. Sci. 362:1119-1134.[Abstract/Free Full Text]


Journal of Bacteriology, November 2007, p. 8387-8391, Vol. 189, No. 22
0021-9193/07/$08.00+0     doi:10.1128/JB.00736-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Studer, S. V., Mandel, M. J., Ruby, E. G. (2008). AinS Quorum Sensing Regulates the Vibrio fischeri Acetate Switch. J. Bacteriol. 190: 5915-5923 [Abstract] [Full Text]  
  • Chun, C. K., Troll, J. V., Koroleva, I., Brown, B., Manzella, L., Snir, E., Almabrazi, H., Scheetz, T. E., de Fatima Bonaldo, M., Casavant, T. L., Soares, M. B., Ruby, E. G., McFall-Ngai, M. J. (2008). Effects of colonization, luminescence, and autoinducer on host transcription during development of the squid-vibrio association. Proc. Natl. Acad. Sci. USA 105: 11323-11328 [Abstract] [Full Text]  
  • Duerkop, B. A., Herman, J. P., Ulrich, R. L., Churchill, M. E. A., Greenberg, E. P. (2008). The Burkholderia mallei BmaR3-BmaI3 Quorum-Sensing System Produces and Responds to N-3-Hydroxy-Octanoyl Homoserine Lactone. J. Bacteriol. 190: 5137-5141 [Abstract] [Full Text]  
  • Antunes, L. C. M., Ferreira, R. B. R., Lostroh, C. P., Greenberg, E. P. (2008). A Mutational Analysis Defines Vibrio fischeri LuxR Binding Sites. J. Bacteriol. 190: 4392-4397 [Abstract] [Full Text]  
  • Adin, D. M., Visick, K. L., Stabb, E. V. (2008). Identification of a Cellobiose Utilization Gene Cluster with Cryptic {beta}-Galactosidase Activity in Vibrio fischeri. Appl. Environ. Microbiol. 74: 4059-4069 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Antunes, L. C. M.
Right arrow Articles by Greenberg, E. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Antunes, L. C. M.
Right arrow Articles by Greenberg, E. P.