The RcsCDB Signaling System and Swarming Motility in Salmonella enterica Serovar Typhimurium: Dual Regulation of Flagellar and SPI-2 Virulence Genes

The Rcs phosphorelay is a multicomponent signaling system thatpositively regulates colanic acid synthesis and negatively regulatesmotility and virulence. We have exploited a spontaneously isolatedmutant, IgaA(T191P), that is nearly maximally activated forthe Rcs system to identify a vast set of genes that respondto the stimulation, and we report new regulatory propertiesof this signaling system in Salmonella enterica serovar Typhimurium.Microarray data show that the Rcs system normally functionsas a positive regulator of SPI-2 and other genes important forthe growth of Salmonella in macrophages, although when highlyactivated the system completely represses the SPI-1/SPI-2 virulence,flagellar, and fimbrial biogenesis pathways. The auxiliary proteinRcsA, which works with RcsB to positively regulate colanic acidand other target genes, not only stimulates but also antagonizesthe positive regulation of many genes in the igaA mutant. Weshow that RcsB represses motility through the RcsB box in thepromoter region of the master operon flhDC and that RcsA isnot required for this regulation. Curiously, RcsB selectivelystimulates expression of the flagellar type 3 secretion genesfliPQR; an RcsAB box located downstream of fliR influences thisregulation. We show that excess colanic acid impairs swimmingand inhibits swarming motility, consistent with the inverseregulation of the two pathways by the Rcs system.

INTRODUCTION

Top

INTRODUCTION

The Rcs phosphorelay signaling system appears to be exclusivelypresent only in the family Enterobacteriaceae (30). This systemwas first identified by its role in the positive regulationof capsular polysaccharide or colanic acid synthesis in Escherichiacoli but is now known to also regulate genes involved in themaintenance of cell wall integrity, cell division, the regulationof stationary-phase sigma factor ${sigma}$ ^S, motility, and virulence(Fig. 1) (39). In response to unknown environmental signals,the hybrid kinase RcsC is activated to autophosphorylate a conservedHis residue. From here, the phosphate is transferred first toan Asp residue within RcsC itself, then to a His residue inRcsD, and finally to the response regulator RcsB. RcsB $~$ P (thephosphorylated or functionally active form of RcsB) associateswith an unstable protein, RcsA, to bind to an RcsAB box in thepromoter region of several genes (70), although not all genesrequire RcsA for regulation. Conditions that modestly inducethe Rcs regulon include osmotic and other kinds of membranestress, growth at low temperatures in the presence of glucoseand zinc, and possibly growth on a solid surface (27, 39). Capsulesynthesis also is reported to be activated by acetyl phosphatevia RcsB independently of RcsC (20). Capsular polysaccharidehelps cells survive drying (52) and apparently is importantfor later stages of biofilm formation (10).

View larger version (20K):
[in this window]
[in a new window]

FIG. 1. Rcs signal transduction pathway. Phosphate ( $~$ P) transfer from the RcsC kinase via RcsD to the response regulator RcsB is indicated. H/H₂ and D refer to phosphorylated histidine and aspartate residues in the signaling proteins. Dotted lines indicate a reversal of the pathway due to the phosphatase activity of RcsCD. Acetyl $~$ P or unknown phosphodonors (X $~$ P) are implicated in phosphorylating RcsB independently of RcsC. Pathways positively (arrowhead) or negatively (bar head) influenced by RcsB $~$ P alone, or in conjunction with the coregulator RcsA, are indicated. Lon protease degrades RcsA. RcsF and IgaA respond to the indicated known or unknown (?) signals to regulate RcsC. OM and IM, outer and inner membrane, respectively. See the text for details. Adapted from reference 39 with the permission of the publisher.

While the Rcs system positively regulates capsule synthesis,it negatively regulates flagella synthesis (Fig. 1) (39). Swimmingand swarming motility are both dependent on flagella (28, 36).In E. coli the Rcs system is thought to repress motility bycontrolling the master flagellar operon (18). Purified RcsAenhances the affinity of RcsB for the RcsAB box within the promoterregion of flhDC (18); however, RcsA does not appear to affectthe motility of E. coli in vivo unless expressed at high levelsfrom a plasmid (20). Flagellar biogenesis in both E. coli andS. enterica involves the expression of more than 50 genes thatare transcribed in operons of three temporal classes (8). Theclass 1 genes are included in the master operon flhDC, the proteinsof which direct transcription of class 2 promoters, which encodestructural and assembly proteins required for the biosynthesisof the base of the flagellar structure. FliA ( ${sigma}$ ²⁸) is made atthis stage and regulates class 3 transcription, which producesthe functional flagellar filament. Early in assembly, afterthe inner membrane/supramembrane (MS) ring and the cytoplasmicC ring are assembled, a flagellum-specific type 3 secretion(TTS) apparatus docks at the base of this structure and directsthe export of most extracytoplasmic flagellar subunits comprisingthe rod, the external hook, and the filament. The flagellarTTS system shares sequence and structural similarities withsecretion systems that export virulence proteins into host cells(38).

Mutations that activate the Rcs phosphorelay system are reportedto attenuate virulence in S. enterica; the activating mutationswere either in RcsC (25, 48) or in IgaA (14). A point mutationin igaA (intracellular growth attenuator) was first identifiedin a screen for S. enterica mutants able to proliferate in fibroblastcells (5); the mutant was attenuated for growth in macrophages.igaA encodes an inner membrane protein (14) that is homologousto yrfF in E. coli and to umoB in Proteus mirabilis (15). TheigaA mutant in Salmonella was mucoid and showed reduced motility,and the locus was shown to be essential (4). Lethality was suppressedby mutations in rcsB, rcsC, or rcsD, suggesting that IgaA repressesthe Rcs signaling system in both E. coli and S. enterica (Fig.1) (4, 9, 14). In the absence of IgaA, an overactive Rcs signalingpathway is lethal, likely because of the inappropriate regulationof an Rcs regulon member(s). The role of IgaA in virulence apparentlyis to prevent the activation of the RcsCDB system during earlystages of infection. We show in this study, however, that theRcs system is required for the activation of some virulencegenes required for later stages of infection.

Our study began with the isolation of a spontaneous mutant ofS. enterica that was simultaneously mucoid and completely defectivein both swimming and swarming motility. We mapped the mutationto igaA. A literature search revealed that the particular missensemutation we had isolated (T191P) had been reported earlier,and it was the strongest of the five mutations assayed for theinduction of colanic acid synthesis (14). An initial microarrayanalysis of the igaA mutant revealed a 20- to 400-fold inductionof genes for colanic acid synthesis and a similarly impressiverepression of flagellar and SPI-1/SPI-2 (SPI is short for "Salmonellapathogenicity island") virulence genes. We therefore exploitedthis mutant, which apparently is nearly maximally activatedfor the Rcs signaling pathway, to identify a vast set of genes( $~$ 20% of the Salmonella genome) positively and negatively regulatedby RcsB in both mid-log and stationary phases of growth. Wealso have identified RcsA-dependent and -independent targetsof RcsB. We provide most of these microarray data as supplementarymaterial, but we present the novel results showing dual regulationof SPI-2 and other virulence genes by the Rcs system. The experimentalfocus of this paper is on the regulation of flagellar genesand motility.

We report that RcsB regulates flagellar gene expression bothnegatively and positively. We show that the negative regulationoccurs solely at the initiation of transcription of the masteroperon and operates through an RcsB box within the flhDC promoter;RcsA appears to have no effect on flhDC transcription. Positiveregulation involves the three TTS genes fliPQR; RcsA does notpromote this regulation but instead antagonizes it. An RcsABbox located downstream of fliR appears to be required for theelevated transcript levels of fliPQR. We also show that excesscolanic acid inhibits swarming motility. Thus, while polysaccharidesin general favor surface motility (28), the colanic acid polysaccharidedoes not.

MATERIALS AND METHODS

Top

MATERIALS AND METHODS

Bacterial strains, growth conditions, and procedures. Strains are listed in Table 1. Bacteria were grown in L broth(LB) base (20 g/liter). LB swim plates were solidified with0.3% agar, while LB swarm plates were supplemented with 0.5%glucose and were solidified with 0.6% agar (65). Eiken agar(Eiken Chemical Co., Tokyo, Japan) was used in most experiments.For preparation of RNA samples, cultures were harvested at anoptical density at 600 nm (OD₆₀₀) of 0.6 ( $~$ 2.5 h) for mid-logphase and at 6 h for stationary phase. The growth curve forwild-type bacteria has been published already (65). Strainswith the igaA mutant allele had a slightly slower growth ratethan the wild type and reached mid-log phase (OD₆₀₀ of 0.6)with a delay of $~$ 0.5 h; they were harvested for stationary phaseby an equivalent delay. Procedures for motility assays, viewingbacteria on plates, and photography have been described previously(42). Antibiotics used in this study are ampicillin (100 µg/ml),chloramphenicol (30 µg/ml), tetracycline (12.5 µg/ml),and kanamycin (25 µg/ml). Deletion of genes and regulatoryregions was achieved by the one-step mutagenesis procedure (11)as described previously (68). Mutant combinations were constructedby P22 transduction where appropriate.

View this table:
[in this window]
[in a new window]

TABLE 1. Strains and plasmids used

Mapping and identification of the igaA mutation. P22 was grown on TH341 carrying Tn10dCm (defective Tn10, lackingthe transposase, and carrying chloramphenicol resistance [Cm^r])and used to generate a random pool of Tn10dCm hops into thespontaneous mucoid mutant, which was transformed with pNK972,a plasmid expressing the transposase gene of Tn10. Transducinglysates prepared from $~$ 25,000 Cm^r pooled colonies were crossedwith the wild-type strain 14028, selecting for mucoid and nonmotilecolonies resistant to Cm. One such transductant was named QW119,and it was crossed back with 14028 to determine the distance( $~$ 14 kb) between the Cm^r marker and the mutated locus using cotransductionfrequencies. The Cm^r marker was located at a noncoding regionbetween genes bigA and yhfL by using semirandom-primed PCR fromboth ends of the Cm coding sequence and subsequent sequencingof the PCR products. TH1793 carrying a tetracycline resistance(Tc^r) insertion in dam, 3.6 kb down from bigA, then was crossedwith QW119, and the distance between dam::Tc^r and the mutatedlocus was determined to be $~$ 11 kb by cotransduction frequencies,establishing the order of the markers as Cm^r-dam::Tc^r-mucoidlocus. DNA sequencing around the predicted position of the mutationrevealed a point mutation of A to C at nucleotide 571 in igaA(Table 1).

Introducing point mutations on the chromosome. Point mutations within the chromosomal RcsAB box sequence inflhDC were created as follows. The flhDC coding sequence firstwas replaced with tetRA (encoding tetracycline resistance genes[7]) by a modification of the one-step mutagenesis procedure(11). The modification involved using genomic DNA from TH338(carrying tetRA) as the template to amplify the tetRA sequenceusing hybrid primers that included 40 to 50 nucleotides homologousto sequences flanking either side of the region to be deletedwithin flhDC, followed by 20 nucleotides homologous to sequenceson either side of the tetRA cassette. The amplified PCR productwas introduced into the wild-type strain as described previously(11), and the resulting strain, flhDC::tetRA, was named QW215.The region replaced by tetRA in flhDC started at the +1 transcriptionstart site of flhD and extended to the termination codon TAAof flhC. Point mutations in the RcsAB box (Table 1) were introducedinto QW215 by designing appropriate PCR primers carrying themutations. The basic forward primer containing the RcsAB boxwas 5'CTCCGTTGTATGTCACGAAGCTGACGAGTAGAGTTGCGTCGAATTAGGAAAAATCTTAGGCATTTGTAAAAATTGATGTA(the box is underlined). In mutant primers, the G, A, and Cresidues shown in boldface in the wild-type sequence were changedto T, C, and A, respectively, either singly or in combinations.Each of the forward primers, together with the reverse primer(5'GACATCATCCTTCCGCTGTT), was used to generate PCR productsusing wild-type flhDC as the template. The PCR products wereelectroporated into QW215 with pKD46 (a helper plasmid encodingphage lambda recombinase [11] to replace the tetRA cassette).Tet^s transformants were selected on media described previously(41) on which Tet^s colonies appear much bigger than Tet^r colonies;these were further verified by replica plating on tetracyclineand unmodified LB plates. All point mutations finally were verifiedby DNA sequencing. The Cm^r-linked igaA allele was moved intothe RcsAB box mutants by transduction and screening for mucoidy,and the construct was verified by DNA sequencing.

Microarray experiments and reverse transcription-PCR (RT-PCR). RNA preparation and microarray analyses were done as describedpreviously (65). The microarray data in all tables representtwo to five independent experimental repeats. A list of differentiallyexpressed (DE) genes for each comparison (e.g., wild type comparedto ${Delta}$ rcsB at one growth phase) was selected by using the significanceanalysis of microarrays method, which assigns a score to eachgene on the basis of the change in gene expression relativeto the standard deviation of repeated measurements (63). Briefly,significance analysis of microarrays orders the genes by usinga modified statistic t and declares a gene to be up- or down-regulatedif the observed modified statistic t is above or below the globalcutoff point, which is chosen to control the estimated medianfalse discovery rates. The false discovery rate was set to 5%.Each DE list was further screened stringently according to thebehavioral consistency of each DE gene in two genetic backgrounds(RcsB⁺⁺ [high levels of active RcsB] and ${Delta}$ rcsB) and in two growthphases (mid-log phase and stationary phase).

RT-PCR was performed essentially as described previously (66),using a one-step RT-PCR kit (Qiagen). Briefly, DNase (Ambion)-treatedRNA samples initially were diluted to 20 ng/µl and werefurther normalized against RT-PCR-amplified 30S rRNA as an internalcontrol. An RT-PCR of 50 µl consisted of 10 µl buffer(5x), 1 µl of deoxynucleoside triphosphates (10 mM), 2µl each of forward and reverse primers (25 µM),1 µl of RT-PCR enzyme mix, and $~$ 40 ng of RNA and RNase-freewater supplemented to 50 µl. RT-PCR cycling conditionswere as follows: 50°C for 35 min and 95°C for 15 min,followed by 26 cycles of 94°C for 30 s, 55°C for 30s, and 72°C for 40 s, and then an extra step of elongationat 72°C for 10 min.

RESULTS

Top

RESULTS

IgaA(T191P) is strongly induced for colanic acid synthesis and simultaneously is repressed for flagellar, fimbriae, and SPI-1/SPI-2 virulence genes. A spontaneous mucoid mutant of S. enterica (QW119) (Table 1)was found to be completely defective in swimming and swarmingmotility (Fig. 2A). The mutation was mapped to the igaA locusby three-factor crosses, and sequence analysis identified themutation as IgaA(T191P) (see Materials and Methods). We willrefer to this allele as igaA*. Consistent with the mutant phenotype,microarray analysis of this mutant showed a dramatic inductionof colanic acid synthesis genes (20- to 400-fold) that are amajor target of the Rcs signaling system (see Table S1 in thesupplemental material). These data, along with experiments reportedpreviously (14), suggest that the Rcs system is nearly maximallyinduced in the igaA* strain QW119 (indicated by RcsB⁺⁺ in TableS1 in the supplemental material). Comparison of the RcsB⁺⁺ to ${Delta}$ rcsB strains therefore should give us the whole range of genespositively and negatively regulated by RcsB. These microarrayexperiments showed that RcsB regulates nearly one-fifth of theSalmonella genome. Data for genes that are strongly regulatedin both mid-exponential and stationary phases of growth areprovided in Tables S1 and S2 in the supplemental material. Alist of 445 other genes regulated in either one or the othergrowth phase (but not in both phases) is available from theauthors upon request. We also have examined the contributionof RcsA to this regulation (see Tables S3 and S4 in the supplementalmaterial). We first summarize the overall findings from thesestudies and then focus on the regulation of flagellar genesand motility.

View larger version (68K):
[in this window]
[in a new window]

FIG. 2. Swimming and swarming motility of the Rcs signaling pathway and regulatory mutants. (A) The motility of the indicated mutant strains on 0.3% swim or 0.6% swarm Eiken agar. Mutations introduced in the promoter region of flhD are indicated in parenthesis after p_flhD. (B) The motility of the indicated mutant strains on 0.3% swim (white bars) or 0.6% swarm (gray bars) Eiken agar. Similar results were obtained with Bacto agar. The data are averages from three independent experiments conducted in triplicate. Error bars are standard deviations from the means. Plates in both panels were incubated at 37°C for 6 h.

Positive regulation of colanic acid and a subset of flagellar biosynthesis genes. Positively regulated genes are those for which the transcriptionlevels are elevated in an RcsB⁺⁺ background or decreased ina ${Delta}$ rcsB background. The most strongly positively regulated genesbelong to the colanic acid biosynthesis cluster (see Table S1in the supplemental material), followed by those associatedwith membrane and periplasmic functions. Among genes with knownfunctions, inclusion of the class 2 flagellar genes fliQ andfliR (see Table S1 in the supplemental material) in the setof strongly induced genes is curious, because the rest of theflagellar genes are repressed by RcsB (see Table S2 in the supplementalmaterial); fliQR are members of an export system specific forextracytoplasmic flagellar proteins (37).

Negative regulation of flagellar and virulence genes. Negatively regulated genes are those for which the transcriptionlevels are decreased in an RcsB⁺⁺ background or increased ina ${Delta}$ rcsB background. Among the most strongly negatively regulatedgenes are those encoding flagellar motility (up to 117-foldrepression) (see Table S2 in the supplemental material). Besidesthe well-known flagellar biosynthetic pathway, the more recentlyidentified motility genes (mcpC, STM3155, yhjH, etc. [21, 67])also were repressed by RcsB. Equally striking was the repressionof virulence genes encoded on the pathogenicity island SPI-1(up to 270-fold) (see Table S2 in the supplemental material)as well as virulence genes encoded on the pathogenicity islandSPI-2 (up to 150-fold) and genes for fimbriae (up to 37-fold)(Table 2). The latter class of genes (SPI-2 and fim) showeda novel regulation that is discussed separately below.

View this table:
[in this window]
[in a new window]

TABLE 2. Dual regulation of virulence and other genes by the Rcs system^a

Dual regulation of SPI-2 and other virulence genes. The microarray data revealed a third class of genes that wereboth positively and negatively regulated depending of the activitylevel of RcsB (Table 2). The transcription ratios at normallevels of RcsB (wild type compared to ${Delta}$ rcsB) show that RcsB isrequired for expression of the indicated genes, i.e., the genesare positively regulated by RcsB. The transcription ratios atelevated levels of RcsB (wild type compared to RcsB⁺⁺) showthat the same genes are repressed when RcsB is highly active,i.e., negatively regulated by RcsB. The largest functionallyrelated group of genes showing dual regulation included genesencoding the TTS system on the pathogenicity island SPI-2 (ssa,ssb, sse, etc.). This system is required for the intracellularsurvival of Salmonella and the remodeling of the Salmonella-containingvacuole (69). Genes for the SsrAB two-component signaling systemencoded within SPI-2 also show dual regulation. This systemcontrols the expression of components of the SPI-2 TTS apparatusas well as its translocated effectors. Other genes grouped underpathogenicity also are required for growth of Salmonella inmacrophages. For example, the genes pagC, pagD, ugtL, mig-14,virK, pgtE, pipB, sopD, and pagK have functions associated withthe bacterial envelope, and some have been directly implicatedin virulence and resistance to antimicrobial peptides (50).Fimbrial genes (fim) belonged to the dual category as well;fimbriae are thought to play a role only during the intestinalphase of infection (32). RcsB recently has been reported toinfluence the piliation state of E. coli (57).

RcsA both stimulates and antagonizes a subset of RcsB-regulated genes. Earlier array studies do not distinguish between RcsA-dependentand RcsA-independent targets. In order to study these, we firstcompared gene expression of the wild type to that of an rcsAmutant but found no genes that were significantly differentiallyexpressed. We therefore performed microarray analysis of thewild-type and RcsB⁺⁺ strains with or without RcsA. RcsA hadeither a stimulatory or an antagonistic effect on the positiveregulation of several genes by RcsB (some of these are indicatedin Tables S1 and S2 in the supplemental material). The effectof RcsA on the negative regulation of genes by RcsB was lessclear in that the effect either was small, not observed in allmembers of a regulon, or not consistently observed in all experimentalrepeats. The data showing all the positively regulated genesfor which expression either was stimulated or antagonized byRcsA are presented in Tables S3 and S4 in the supplemental material,respectively.

RcsA was not required for the negative or the positive regulationof flagellar genes. However, an antagonistic effect was seenon the positive regulation of fliPQR; i.e., the absence of RcsAincreased the positive stimulation by RcsB (see Tables S1 andS4 in the supplemental material). An antagonistic effect alsowas observed on the positive regulation of rcsA, the gene immediatelydownstream of fliR (see Tables S1 and S4 in the supplementalmaterial). Note that the ${Delta}$ rcsA strain QW327 used in these experimentshad removed most of the gene, leaving $~$ 100 bp at the beginningand at the end (Table 1); the rcsA transcript correspondingto residual regions of the gene is being detected in the microarrays.An antagonistic effect may result from competition between thetwo proteins for binding the RcsAB box and could be interpretedas a moderating influence of RcsA on the positive regulationof genes by RcsB.

Regulation of flagellar genes and motility. (i) Negative regulation of flagellar genes occurs through the RcsB-binding box in the master flagellar operon flhDC: excess colanic acid inhibits swarming motility. An RcsAB box was identified within a footprint of RcsAB proteinsin the promoter region of flhDC in E. coli (18). An identicalsequence (TAGGAAA/AATCTTA) is present at a similar locationin S. enterica, at +5 to +19 from the +1 transcription startsite (71). We shall refer to this sequence as the RcsB box inS. enterica, since RcsA is not required for repression. To testif the inhibition of motility genes was entirely through repressionof the flhDC master operon, we created point mutations in theGA (left half site) and C (right half site) residues of theRcsB box (in boldface), alone and in combinations, in the igaA*strain QW119 (see Materials and Methods). These three residueswere seen to be conserved between several RcsA-independent targetsand an RcsA-dependent target (18). All of these mutant derivativesremained mucoid. While most of the mutant strains had regainedswimming motility to various extents when assayed on 0.3% agarplates, none of them showed swarming motility on 0.6% agar plates(Table 3). Motility assays for representative mutants are shownin Fig. 2A. Of the five combinations of point mutants, the singlemutants g8t (QW220) and c15a (QW227) showed the lowest recoveryof motility, while all mutants that included the a9c mutation(QW221, QW222, and QW226) had recovered half the swimming motilityof the wild type (Table 3 and Fig. 2A, compare QW119 to QW226).In order to test if mucoidy was interfering with motility, weintroduced a deletion mutation of wza, the first gene in thecolanic acid biosynthesis operon, into the igaA* strain (resultingin strain QW200) as well as in all of its RcsB box mutant derivatives(resulting in strains QW228 to QW233). Mutation of wza abolishedthe mucoid phenotype of the mutants but did not reverse themotility defect in the igaA* parent (Fig. 2A, compare QW200to QW119). However, both swarming and swimming motility nowcould be observed in the RcsB box mutants (Table 3). The resultsconfirmed that the a9 residue was critical, the g8 residue lesscritical, and the c15 residue not critical for RscB-mediatedrepression of motility (only QW231 is shown in Fig. 2A). A controlstrain with the wza deletion alone (QW184) swarmed as well asthe wild type, showing that colanic acid was not required forswarming (also see reference 62). Gene expression was assayedonly in the mutant with all three RcsB box residues altered(QW226); repression of motility operons was completely relievedin this strain, while the expression pattern of all other genesremained unchanged (some of the microarray data for this strainwere reported previously [67]; the rest of the data are notshown). The motility defect of QW226, despite the relief offlhDC repression, demonstrates that the excess colanic acidstill being produced by this strain impairs swimming and inhibitsswarming (Fig. 2A, compare QW226 to QW231).

View this table:
[in this window]
[in a new window]

TABLE 3. Effect of RcsAB box mutations on recovery of motility^a

In an earlier study, we had reported that a Tn10 insertion inrcsD (formerly yojN) in S. enterica serovar Typhimurium inhibitedswarming on medium solidified with one commercial source ofagar (Bacto) but not another (Eiken) (62). In light of the reportedstimulation of swarming motility by insertion mutations in rcsDin both E. coli (60) and P. mirabilis (2), we decided to reexamineour results by creating specific deletions in each of the rcsgenes by the method of Datsenko and Wanner (11) and by assayingthe motility phenotypes of the resulting mutants (Fig. 2B).The ${Delta}$ rcsB mutant (QW434) showed better swimming and swarmingmotility than the wild type, consistent with the negative effectof RcsB on the expression of flhDC. ${Delta}$ rcsA (QW327) had no effecton swimming, also as expected; however, swarming motility wasinhibited $~$ 25%. A ${Delta}$ rscAB double mutant (QW329), however, showedthe same phenotype as the rscB mutant. ${Delta}$ rcsC (QW398) and ${Delta}$ rcsD(QW459) mutants showed a small inhibition of swimming but $~$ 40to 60% inhibition of swarming. A ${Delta}$ rcsCD double mutant (QW436)was similar to the single mutants for swimming, but it was slightlyworse at swarming. We attribute the modest inhibition of swimmingmotility in the rcsC and rcsD mutants to the loss of phosphataseactivity of RcsCD and a consequent accumulation of RcsB $~$ P dueto phosphorylation from other phosphor donors (20, 39) (Fig.1) (see Discussion). The more pronounced effect of these mutantson swarming motility is due to the development dynamics of theswarmer colony, in which motility initiates only after a substantiallag. Both mutants initiated swarming later than the wild type,the delay being longer for rcsD than for rcsC. A small initialdelay was observed in the rcsA mutant as well (see Discussion).

In summary, our mutation data show that only conserved residuesin the left half of the RcsB box are important for the repressionof flhDC in S. enterica and that RcsB-mediated inhibition ofmotility occurs entirely through the repression of the flhDCpromoter. Colanic acid is not required for swarming, and excesscolanic acid inhibits swarming motility completely. Deletionof rcsB has a positive effect on motility, but deletion of rcsCor rcsD had a slightly negative effect on swimming motilityand a more pronounced negative effect on swarming motility.

(ii) Positive regulation of flagellar genes fliPQR. The fliL flagellar operon encodes seven genes, fliL throughfliR (Fig. 3A) (36). rcsA is located 281 bp after fliR (45).An RcsAB box, homologous to the one identified in E. coli, occurs18 bp downstream from the stop codon of fliR. The RcsA and RcsBproteins have been shown to bind to this box and to positivelyregulate rcsA expression in E. coli (70).

View larger version (39K):
[in this window]
[in a new window]

FIG. 3. Positive regulation of fliPQR by RcsB. (A) Schematic showing the fliL operon and rcsA. The lengths of the region corresponding to the individual genes within the operon are drawn approximately to scale with respect to each other. Arrows indicate the transcription start sites. The square box in the intergenic region between fliR and rcsA is the RcsAB box (not drawn to scale). (B) Microarray data showing positive or negative regulation of the indicated genes during mid-exponential and stationary phases of growth. QW119 is the igaA* (RcsB⁺⁺) mutant, and QW441 its isogenic ${Delta}$ rcsA derivative. The data are extracted from Table S4 in the supplemental material. (C) RT-PCR results for RNA isolated from strains indicated on the left. QW556 is deleted for residues 1 to 48 in the intergenic region between fliR and rcsA, starting at the first base pair after the stop codon of fliR. Primers pairs were designed to anneal within the coding region of the genes indicated at the top. RNA for the wild-type (WT) strain was isolated at mid-log phase, at which point flagellar gene expression is maximal, while that for the igaA* strains was isolated at stationary phase, at which point the activity of the Rcs system is maximal.

The maximum induction of fliPQR genes was seen at stationaryphase in the RcsB⁺⁺ igaA* strain QW119 (Fig. 3B) (note thatfliP is not included in Table S1 in the supplemental material,because that table lists only genes upregulated in both exponentialand stationary phases of growth). The stimulation of fliQ andfliR was strong (14- and 54-fold, respectively), and the stimulationof fliP was moderate in comparison (threefold). This stimulationwas increased in the absence of rcsA, an effect also seen onexpression of rcsA itself, as noted earlier (Fig. 3B; also seeTable S4 in the supplemental material). Curiously, there appearedto be a reverse gradient of expression of these genes, in thatthe last gene in the operon was expressed at higher levels thanthe previous gene; thus, the order of expression levels wasfliR > fliQ > fliP (Fig. 3B).

RT-PCR was used to confirm all three findings from microarrayexperiments; i.e., the elevated expression of only fliPQR inthe RcsB⁺⁺ mutant, the RcsB dependence of the response, andthe increased stimulation of expression in the absence of RcsA.These results are presented in Fig. 3C, in which fliM is usedas a representative early gene in the operon and fliO is usedas the nearest neighbor of the positively regulated gene fliP.In the wild-type strain 14028, the gradient of gene expressionfollows proximal genes >> distal genes in the fliL operon;the fliR message is barely detected. In the RcsB⁺⁺ strain QW119,however, the fliM transcript is barely detected, while expressionof fliQR is elevated, along with some elevation of fliP. Theincreased expression of rcsA in the RcsB⁺⁺ background (QW119)is consistent with the positive regulation of this gene by RcsB(see Table S1 in the supplemental material). In the absenceof RcsB (QW442), transcription of fliM is restored due to therelease of flhDC repression, and the positive regulation ofboth fliR and rcsA is abolished. In the absence of RcsA, however,the expression of fliPQR is enhanced further (Fig. 3B), andthe reverse transcription gradient extends into fliO (Fig. 3C).Deletion of 48 bp containing the RcsAB box in the fliR-rcsAintergenic region decreases both the fliPQR and rcsA transcripts.Since RcsB binding to the RcsAB box is required for stimulationof rcsA transcription (70), the positive regulation of fliPQRlikely also is promoted by RcsB binding here.

Given that the transcription of the fliL operon is repressedin the igaA* background, it follows that fliPQR must be transcribedfrom an internal RcsB-dependent cryptic promoter in this operonor that a basal level of the transcript is being stabilizedin the igaA* background. The detailed nature of this positiveregulation, which apparently does not affect motility as determinedby similar levels of swimming and swarming observed for thewild type and igaA* mutant QW231 (wherein flhDC repression isrelieved and excess colanic acid synthesis is abrogated [Fig.2A, compare 14028 to QW231]), will be explored in future studies.

DISCUSSION

Top

DISCUSSION

In this study, we have exploited a spontaneously arising pointmutant, IgaA(T191P) (or igaA*), which is nearly maximally inducedfor the Rcs signaling system, to glean information about motility,virulence, and other genes regulated by this system in S. enterica.Microarray experiments revealed that the Rcs system regulatesnearly one-fifth of the S. enterica genome under these conditions.Flagellar genes were the largest group of functionally relatedgenes that were strongly negatively regulated, the other largegroup being the SPI-1 and SPI-2 virulence genes. Within theflagellar regulon, three flagellar genes, fliPQR, were selectivelyupregulated. A large set of SPI-2 and other virulence genesprimarily involved in the growth of Salmonella in macrophageswere activated or repressed, depending on the level of RcsB.We have followed up further only on the microarray results pertainingto motility.

The Rcs system and regulation of motility. (i) Repression of the flagellar regulon. A sequence identical to that of the RcsAB-binding box consensusderived from E. coli studies is present in S. enterica at anequivalent position within the flhDC promoter. We have calledthis the RcsB box in S. enterica, because microarray data didnot show a requirement for RcsA in the repression of the flagellargenes by RcsB. These results are consistent with those of earlierstudies on S. enterica that showed no effect of an rcsA mutationon the expression of flhDC::lac in an igaA1 mutant background(4). They also are consistent with results of studies on E.coli that showed no effect of rcsA on motility when presentas a single copy (20). We note that the RcsB box is part ofa large region bound by the osmoregulator OmpR in E. coli; OmpRrepresses flhDC under conditions of high osmolarity (59). However,deletion of ompR does not affect motility under our experimentalconditions (our unpublished data; also see reference 62).

Our mutational analysis showed that the conserved GA residues(+8 and +9) in the left half of the RcsB box were importantfor repression, while the C residue (+11) was not, as determinedby assays for the restoration of motility (Table 3 and Fig.2A). Microarray analysis of the triple-conserved-residue RcsBbox mutant determined that transcription of the flagellar regulonwas restored to wild-type levels (data not shown), showing thatthe repression of motility by RcsB is solely through flhDC.

(ii) Positive regulation of fliPQR. Microarray experiments showed that three class 2 flagellar genes,fliPQR, were positively regulated by RcsB (Fig. 3). These resultswere confirmed by RT-PCR experiments. A curious aspect of thisregulation is what we have termed a reverse gradient of expression;i.e., expression levels in the order fliR > fliQ > fliP.Whether this regulation involves the initiation of transcriptionfrom an internal cryptic promoter and/or stabilization of abasal-level transcript remains to be determined. The fliR-rcsAintergenic region containing an RcsAB box appears to be importantfor the regulation (Fig. 3).

We had reported earlier that fliQR showed a different expressionpattern from that of class 2 flagellar genes, in that unlikeclass 2 genes they continued to be expressed in stationary phase(65). Their expression during log phase also was not significantlyaffected in flhDC and fliA mutant backgrounds (our unpublisheddata). It appears, therefore, that these two genes can be regulatedindependently of flagellar operon control. The exact role ofthe fliPQR genes in flagellar export is not known, but alongwith fliO they are essential for flagellar biogenesis, and theirgene products are found in the basal body (37). The existenceof a natural FliR/FlhB fusion in Clostridium (51) suggests anassociation of FliR with the membrane protein FlhB, which playsa role in determining export substrate specificity (37). Thepositive regulation of these flagellar export-related genesby RcsB, for which other positively regulated functions areinvolved in responding to membrane stress, including capsuleand other polysaccharide synthesis, suggests that perhaps FliPQRhave a dual role in the cell. Thus, these proteins may participatein the export of flagellar components when conditions favormotility but export other molecules when conditions call fora sessile existence.

(iii) rcs genes and swarming. Deletion of rcsB had a positive effect on motility, consistentwith a role of the Rcs system in the repression of motility(Fig. 2B). However, deletion of rcsC or rcsD had a slightlynegative effect on swimming motility and a more pronounced negativeeffect on swarming motility. The motility phenotype of the rcsCmutant could be related to the dual function of RcsC as botha phosphatase and a kinase (39). The loss of phosphatase activitycould result in the accumulation of RcsB $~$ P due to cross-talkfrom other sources. Indeed, acetyl phosphate-mediated activationof RscB has been reported to delay transcription of the flagellaroperon in an rcsC mutant in E. coli (20). A similar mechanismmay be invoked to explain the phenotype of the rcsD mutant,since RcsD links RcsC and RcsB in the signaling pathway (Fig.1). The more severe effect on swarming motility of both thercsC and rcsD mutations is due to a longer lag in the initiationof swarming in these mutants. The rcsA mutation, which doesnot affect swimming, affects swarming at the initiation stageas well. We speculate that this may be due to an antagonisticeffect of RcsA on the repression of flhDC, i.e., more inhibitionin the absence of RcsA; we observed such an effect in one ofthree microarray experimental repeats. Swarming apparently ismore sensitive to changes in the transcription profile of flagellargenes, likely because of other factors that influence the initiationof motility on the surface (28).

(iv) Colanic acid and swarming. Moist surface conditions are of paramount importance duringswarming (28). Swarming bacteria often secrete special wettingagents and surfactants that aid in trapping sufficient moistureand decreasing surface tension to facilitate the spreading ofthe swarming colony. For example, P. mirabilis produces an acidiccapsular polysaccharide (19, 54), Serratia marcescens and Serratialiquefaciens produce the surfactant serrawettin (35, 43, 44),Pseudomonas aeruginosa makes rhamnolipids (13), and Bacillussubtilis makes the surfactant surfactin (33, 46), all of whichaid the advancement of the surface colony. In E. coli and S.enterica, the lipopolysaccharide is proposed to play this role(62). We therefore were curious to learn whether excess colanicacid would promote swarming. We have found that not only doesexcess colanic acid not promote swarming, but in fact it inhibitsswarming while moderately inhibiting swimming motility. Consistentwith our earlier findings that genes for colanic acid synthesisare not induced during swarming or growth on an agar surface(65), deletion of wza does not affect swarming (Fig. 2A). Thus,colanic acid is not required for swarming, is not induced duringswarming, and does not promote swarming if overproduced. Inhibitionof motility by excess colanic acid is consistent with the transcriptionalshutdown of motility functions by the organism in an apparentpreparation for a sessile existence. Our results are inconsistentwith the finding that cps genes are induced upon growth on anagar surface in E. coli (17). It is possible that E. coli andSalmonella respond differently to the induction of these geneson surfaces.

The Rcs system and regulation of virulence genes. S. enterica encodes two virulence systems that operate at differentsteps of the infection cycle (31). The SPI-1 system is involvedin the intestinal phase of infection and is essential for theinvasion of nonphagocytic cells (22). The SPI-2 system is requiredfor intracellular survival and proliferation and is essentialfor systemic infection (29, 58, 69). Consequently, the expressionof these systems is differentially regulated: the expressionof SPI-1 is stimulated by environmental cues (e.g., high osmolarityand low oxygen tension) present in the intestinal tract, whilethe expression of SPI-2 is stimulated by conditions presentwithin host cells (e.g., low Mg²⁺ concentrations and acidicpH) (23). The results reported in this study suggest that theRcs signaling system is an important player in fine-tuning thebacterial response to different environmental challenges. Wediscuss below only our new results with respect to SPI-2.

Dual regulation of SPI-2 genes. A majority of the genes showing dual regulation by RcsB in ourstudies, i.e., genes positively regulated at normal levels andnegatively regulated at highly activated levels of RcsB, eitherbelong to the SPI-2 group or are virulence determinants knownto be involved in survival in macrophages, which are endowedwith robust and varied antimicrobial defenses (55) (Table 2).The SPI-2-encoded TTS system and the two-component PhoPQ systemare absolutely required to withstand these defenses (26, 34,69). The SPI-2 effectors remodel the Salmonella-containing vacuole(SCV) by a variety of functions, which include an inhibitionof various aspects of endocytic trafficking, an avoidance ofNADPH oxidase-dependent killing, the induction of a delayedapoptosis-like host cell death, the control of SCV membranedynamics, the assembly of a meshwork of F-actin around the SCV,an accumulation of cholesterol around the SCV, and interferencewith the localization of inducible nitric oxide synthase tothe SCV (69). ugtL, virK, mig-14, and pgtE are PhoPQ-regulatedgenes that play a role in resistance to polymyxin B and/or cationicantimicrobial peptides (50). pagC, pagD, pipB, sopD, and pagKalso are controlled by the PhoPQ signaling system (73). Positiveregulation of all of these virulence genes by the Rcs systemis consistent with the report that an rcsC mutant of S. entericaserovar Typhimurium was attenuated for systemic infection (12).

PhoPQ controls a large number of genes in Salmonella (47, 72,73); why only a subset of these is affected by the Rcs systemis not clear. We note that a connection between the Rcs andthe PhoPQ systems has been seen in several studies (24, 27,61). Both OmpR/EnvZ and PhoPQ have been implicated in the expressionof SPI-2 genes and associated effectors by controlling the SsrABsystem, which regulates transcription of the SPI-2 genes (3,16). It appears from our studies that the Rcs system is thethird signaling system that also regulates SsrAB (Table 2).Multiple regulation of the SPI-2 pathway may be designed torespond to different stimuli at different stages of infection(1). The Salmonella ugd gene, for example, which is requiredfor the incorporation of 4-aminoarabinose in the lipopolysaccharideand resistance to the antibiotic polymyxin B, also is controlledby three two-component systems: PhoPQ, PmrAD, and RcsCDB systems(49, 61). The dual regulation of SPI-2 we have observed in anisolated system is only an indicator of the more complex regulationinside the bacterial host, where the Rcs system must activateSPI-2 gene expression in macrophages while repressing motilityand SPI-1 virulence. The significance of the degree of RcsBactivation for SPI-2 expression may be related to the differenthost signals encountered by the bacteria en route to their siteof proliferation or within their specific niches. The IgaA proteinmust play an important role during these transitions.

How is the dual regulation of the virulence genes by RcsB achieved?Identification of promoters that are directly regulated by RcsBwill allow a dissection of the molecular mechanism of this regulation.The 14-bp RcsAB box consensus (70) generally occurs in the promoterregion but can be found as far upstream as 50 to 300 bp fromthe transcription start site (27). The consensus sequence thereforedoes not have enough sequence or position specificity to reliablypredict which genes may be directly regulated. The identificationof genes directly regulated by these regulators must await amore direct analysis, such as chromatin immunoprecipitation-on-chip.

Function of the Rcs regulon. The specific signals that activate the Rcs system are not known,although the general physiological conditions that trigger thesystem are accepted to be osmotic or other membrane stressesacting through RcsF and IgaA upstream of RcsC (6, 39, 40) (Fig.1). rcs genes are not present in endosymbionts, which have onlyan intracellular existence. Consideration of the pathways thatare the most strongly regulated suggests that the Rcs systeminitially evolved to protect the organism from osmotic changesin the environment as well as to support a sessile existencewithin biofilms. Colanic acid is reported to be required formaintaining a proper biofilm architecture (10, 53). Motilityand pathogenicity (including SPI-1/SPI-2) are not required insuch an environment, and the Rcs system is expected to be mostactivated in such a sessile state. A transition from a sessileto a motile state requires the system to be deactivated. Insidethe host, motility and SPI-1 virulence are important for theintestinal phase of infection but then must be selectively turnedoff in the macrophages while still allowing SPI-2 gene expression.IgaA must be an important player in these transitions, whichclearly are influenced by other signaling pathways as well.

S. enterica contains more than 30 two-component systems (64).Of these, the PhoPQ system has been reported to control as muchas 2 to 3% of genes in E. coli and S. enterica (47, 72). Thissystem often mediates its effects indirectly via activationof other regulatory systems, such as the PmrAB two-componentsystem (1, 56). While we do not yet have information on whichgenes are directly regulated by RcsB, our analysis suggeststhat the RcsCDB signaling system interacts with the PhoPQ andSsrAB systems, shares signals and regulatory pathways with theEnvZ/OmpR system, and likely controls the largest genetic programidentified to date.

ACKNOWLEDGMENTS

We thank Kelly Hughes for strains and advice with mapping, SteffenPorwollik for arrays and assistance with data processing, andSusana Mariconda for technical assistance.

This work was supported by NIH grant GM57400. M.M. was supportedin part by grants AI034829, AI057733, and AI52237-06.

FOOTNOTES

* Corresponding author. Mailing address: Section of Molecular Genetics and Microbiology & Institute of Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712. Phone: (512) 471-6881. Fax: (512) 471-7088. E-mail: rasika{at}uts.cc.utexas.edu

Published ahead of print on 28 September 2007.

Supplemental material for this article may be found at http://jb.asm.org/.

REFERENCES

Top