This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stepanova, E.
Right arrow Articles by Borukhov, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stepanova, E.
Right arrow Articles by Borukhov, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*Substance via MeSH

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2007, p. 8772-8785, Vol. 189, No. 24
0021-9193/07/$08.00+0     doi:10.1128/JB.00911-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Analysis of Promoter Targets for Escherichia coli Transcription Elongation Factor GreA In Vivo and In Vitro{triangledown} ,{dagger}

Ekaterina Stepanova,1 Jookyung Lee,1 Maria Ozerova,1 Ekaterina Semenova,2 Kirill Datsenko,3 Barry L. Wanner,3 Konstantin Severinov,2,4 and Sergei Borukhov1*

Department of Cell Biology, School of Osteopathic Medicine at Stratford, University of Medicine and Dentistry of New Jersey, Stratford, New Jersey,1 Waksman Institute, Rutgers University, Piscataway, New Jersey,2 Department of Biological Sciences, Purdue University, West Lafayette, Indiana,3 Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, New Jersey4

Received 11 June 2007/ Accepted 16 August 2007


arrow
ABSTRACT
 
Transcription elongation factor GreA induces nucleolytic activity of bacterial RNA polymerase (RNAP). In vitro, transcript cleavage by GreA contributes to transcription efficiency by (i) suppressing pauses and arrests, (ii) stimulating RNAP promoter escape, and (iii) enhancing transcription fidelity. However, it is unclear which of these functions is (are) most relevant in vivo. By comparing global gene expression profiles of Escherichia coli strains lacking Gre factors and strains expressing either the wild type (wt) or a functionally inactive GreA mutant, we identified genes that are potential targets of GreA action. Data analysis revealed that in the presence of chromosomally expressed GreA, 19 genes are upregulated; an additional 105 genes are activated upon overexpression of the wt but not the mutant GreA. Primer extension reactions with selected transcription units confirmed the gene array data. The most prominent stimulatory effect (threefold to about sixfold) of GreA was observed for genes of ribosomal protein operons and the tna operon, suggesting that transcript cleavage by GreA contributes to optimal expression levels of these genes in vivo. In vitro transcription assays indicated that the stimulatory effect of GreA upon the transcription of these genes is mostly due to increased RNAP recycling due to facilitated promoter escape. We propose that transcript cleavage during early stages of initiation is thus the main in vivo function of GreA. Surprisingly, the presence of the wt GreA also led to the decreased transcription of many genes. The mechanism of this effect is unknown and may be indirect.


arrow
INTRODUCTION
 
In bacteria, the transcription process is initiated when the RNA polymerase (RNAP) holoenzyme binds to a promoter DNA sequence and forms an open promoter complex (RPo). In the presence of nucleoside triphosphates (NTPs), RNAP in the RPo synthesizes short (typically 2 to 9 nucleotides [nt] long) transcripts that rapidly dissociate from the complex. However, some of these "abortive" transcripts are extended beyond a threshold of 9 to 12 nt, which allows RNAP to start transcript elongation (36, 30). RNAP in the elongation complex (EC) can transcribe over long distances until it reaches a terminator, where the EC dissociates into individual components (the DNA template, the RNA product, and RNAP, which can reinitiate transcription). Every stage of the transcription cycle can be limiting to the overall process and subject to regulation.

Transcription elongation can be slowed or even blocked at certain points of the template, with the resultant formation of paused or arrested complexes, respectively. In these complexes, RNAP shifts along the DNA template in the direction opposite to that of transcription. As a result of such backtracking (18, 24) the 3' end of RNA disengages from the RNAP catalytic center, making further elongation impossible. An arrested complex can resume transcript elongation only following endonucleolytic cleavage of the nascent RNA that generates a new 3' end of the transcript in the RNAP catalytic center. The endonucleolytic reaction performed by the RNAP catalytic center is slow but greatly stimulated by transcript cleavage factors GreA and GreB. The products of GreA-induced cleavage are di- and trinucleotides, whereas the products of GreB-induced cleavage are RNA fragments 2 to 18 nt long (see references 7 and 13 and references therein).

Gre factors use their C-terminal domain to bind near the opening of the RNAP secondary channel. This channel is thought to serve as a port of entry for NTPs during transcription elongation, as an exit path for the RNA 3' terminus during backtracking (3, 38, 40), and likely as an exit route for abortive transcripts. The N-terminal coiled-coil domain of Gre factors reaches the RNAP catalytic center through the secondary channel and directly stimulates the transcript cleavage reaction (21, 25, 34). Factor-stimulated endonucleolytic cleavage of RNA is followed by the dissociation of the 3'-proximal fragment from the EC; the 5'-proximal fragment remains bound and can be further extended, giving RNAP another opportunity to transcribe through a problematic sequence. Both GreA and GreB can prevent elongating RNAP from falling into an arrested conformation (7, 8) and thus stimulate the overall rate and efficiency of transcription elongation. Backtracking is also observed when nucleotide analogs that disrupt RNA-DNA hybrid are incorporated into RNA in in vitro transcription assays (24, 32). By activating the cleavage reaction, Gre factors remove misincorporated nucleotides and thus may contribute to transcription proofreading and fidelity (13, 39). Another in vitro activity of Gre factors, facilitation of transition from abortive initiation to productive elongation, also appears to involve the stimulation of the transcript cleavage reaction (14, 15, 16). However, which stage of transcription is (are) most dependent on Gre-induced cleavage in vivo is yet unclear.

There are several lines of evidence that emphasize the biological importance of Gre factors in nature. Genes coding for Gre proteins and their homologs have been found in the genomes of most bacteria. Moreover, the greA gene is among ~200 genes that are essential for the viability of Mycoplasma pneumonia, an organism with one of the smallest known genomes (17). In several bacterial species, the deletion of greA leads to hypersensitivity toward environmental assaults, such as ionic detergents, elevated temperatures, and osmotic shock (9, 23, 26, 37). A recent report identified greA as a member of the sigE regulon in E. coli, further underscoring the potential role of GreA in cellular stress response (31). GreA is also found to be one of only few proteins that are upregulated during low-pH growth of Streptococcus mutans (22) and one of only nine proteins that are upregulated in Staphylococcus aureus in response to a challenge by cell wall-active antibiotic (33). In Escherichia coli, the overexpression of GreA confers resistance to toxic levels of divalent metal ions, such as Zn2+ and Mn2+ (35). Collectively, these observations strongly implicate Gre factors in the survival of microorganisms in harsh or restrictive environments. However, the relationship, if any, between the known biochemical functions of Gre proteins and their physiological roles has not yet been established. To find such a link, in this work, we performed an in vivo transcription profiling of E. coli cells lacking GreA and/or overproducing wild-type (wt) GreA, or inactive GreA mutant that binds RNAP but is unable to promote transcript cleavage. Follow-up in vitro studies of several randomly chosen genes whose expression depends on the presence of wt GreA indicate, unexpectedly, that stimulation of promoter escape may be the main function of this transcription elongation factor.


arrow
MATERIALS AND METHODS
 
Construction of E. coli gre deletion strains. Deletions of greA and greB genes were made in the E. coli K-12 derivative BW28357 (41) (Table 1) by using Red-mediated recombination as described previously (10). The greA deletion was constructed by using a PCR product generated on pKD13 as the template with primers greA#1 (5'-AATATTCAAGAGGTATAACAAATGCAAGCTATTCCGTGTAGGCTGGAGCTGCTTCGAAG-3') and greA#2 (5'-TTACAATACATCAACATCTTGAGTATTGGGTAATTCATTCCGGGGATCCGTCGACC TG-3'). The greB deletion was similarly made, except with primers greB#1 (5'-TATTGATTCTGTTGATATGATCACGTTATACCCAATTGTAGGCTG GAGCTGCTTCGAAG-3') and greB#2 (5'-AAATGCCAGCCATCGGCAGGAGGTTAAGACTCTTCCGATCCGTCGACCTGCAGTTC-3'). Mutations were confirmed by PCR as described previously (10). The kanamycin resistance gene was eliminated by using pCP20 helper plasmid. P1kc transduction was carried out as described elsewhere.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Strains and plasmids

Culture conditions and RNA isolation. All growths of liquid culture were carried out at 30°C. Overnight cultures prepared from frozen stocks of individual strains were diluted 200-fold into fresh Luria-Bertani broth (LB; Difco), supplemented with antibiotics and 50 µM IPTG (isopropyl-β-D-thiogalactopyranoside) where necessary, and allowed to grow to mid-exponential phase (an optical density at 600 nm [OD600] of 0.4) under vigorous aeration. Growth was stopped by quick cooling in an ice water bath, and cells were harvested by centrifugation at 2°C. Cell pellets were flash frozen in an ethanol-dry ice bath and stored at –84°C or were processed immediately for RNA isolation. RNA was isolated from frozen cell pellets by using QIAGEN RNeasy mini kit. On-column DNase I digestion (QIAGEN) was used to maximally eliminate the contaminating genomic DNA. RNA concentrations were determined by absorbance at 260 nm on a spectrophotometer, and the quality of RNA preparation was analyzed by agarose gel electrophoresis.

E. coli genome arrays. The GeneChip E. coli Genome 2.0 arrays were purchased from Affymetrix. An array contains approximately 10,000 probe sets for 20,366 genes present in four (K-12 plus three pathogenic) strains of E. coli. The probe sets encompass the entire complement of annotated open reading frames and over 700 intergenic regions of K-12 E.coli genome.

Microarray analyses. cDNA synthesis, fragmentation, 3'-terminal biotin labeling, array hybridization, and computational array data analyses were performed by Cognition Therapeutics LLC. (Rockville, MD) as detailed in Affymetrix protocols (2). After the hybridization of labeled cDNA to Affymetrix E. coli Genome 2.0 array chips, the arrays were washed, stained with R-phycoerythrin streptavidin (Molecular Probes) using the Affymetrix Fluidic Station 400, and scanned by a GeneChip Scanner 3000 (Affymetrix). The scanned probe array images were analyzed and sorted using Affymetrix GeneChip operating software (2). Datasets from three independent experiments were combined and filtered to select for genes consistently showing a change in expression of 1.5-fold or more.

Primer extension. For total RNA purification, E. coli cells were grown under the same conditions as those for gene array analysis and total RNA was purified as described above. RNA concentrations were estimated from the absorbance at 260 nm, and verified by denaturing agarose gel electrophoresis, followed by ethidium bromide staining. For each primer extension reaction, 10 µg of total RNA was used. Primers (30 pmol) were radiolabeled by 10 U of T4 polynucleotide kinase (NEB) using 9 pmol of [{gamma}-32P]ATP (4,500 Ci/mmol). Three picomoles of 32P-labeled, gene-specific primers (0.45 µCi/pmol) (see Table S1 in the supplemental material) was annealed to RNA under identical conditions, using a temperature gradient from 65°C to 56°C for 20 min. The primer extension reaction was carried out by using 200 U of SuperScript III reverse transcriptase (Invitrogen) for 50 min at 55°C in the presence of deoxynucleoside triphosphates (1 mM each) in 20 µl. The reaction was stopped by the addition of 20 µl of formamide sample buffer, and reverse transcripts were separated in 8 M urea-10% polyacrylamide gel along with 32P-labeled {phi}X174 DNA/Hinf I markers (Promega). Reverse transcripts were identified by using standard size markers and by DNA sequencing and quantified by a Typhoon PhosphorImager (GE Healthcare) by using ImageQuant (Molecular Dynamics).

Immunoblotting. To estimate the expression level of chromosomally encoded wt GreA and plasmid-encoded wt and mutant GreA in vivo, we used quantitative immunoblotting analysis (see Fig. S1 in the supplemental material). Two ml of E. coli cell cultures was grown as described above to an OD600 of 0.6 and harvested by centrifugation, and the pellets were resuspended in 300 µl of lysis buffer containing 40 mM Tris HCl, pH 7.9, 300 mM NaCl, 1 mM EDTA, 5% glycerol, 5 mM β-mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride. Cells were lysed by sonication and centrifuged to remove debris. Total protein concentration in clear lysates was determined with Bradford assay reagent (Bio-Rad). Indicated amounts of total soluble protein were resolved by Tris-glycine sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (PAGE) and electroblotted onto nitrocellulose membranes (Advantec MFC, Inc.) Blots were probed with rabbit polyclonal anti-GreA antibodies (a generous gift from R. Landick) and developed by a standard protocol using goat anti-rabbit horseradish peroxidase conjugate antibodies (Sigma) with the ECL+ reagent kit (GE Healthcare). Developed immunoblots were scanned by PhosphorImager and quantified by ImageQuant (GE Healthcare).

In vitro transcription assay. The E. coli RNAP was purified from greA greB mutant E. coli strain as described previously (5, 26). E. coli wt GreA, GreA-D41E mutant, and Thermus thermophilus GreA proteins were overexpressed and purified as described previously (6, 21).

Transcription assays were performed using PCR-amplified promoter DNA fragments that include about 150 bp both upstream and downstream of the transcription start site. For a list of the primers used for PCRs, see Table S1 in the supplemental material. Because RNAP may become arrested at the end of the DNA fragment during transcription on some templates it may impede the multiround transcription. Therefore, to avoid this problem and to analyze and compare transcription efficiency of RNAP in the absence and in the presence of GreA on different promoters in the multiround runoff transcription assay, we included terminator in all our templates. Thus, all templates contained an additional 115 bp, including tR2 terminator (68 bp), downstream from the initial transcribed region of a promoter, followed by an additional 47 bp. Reactions were carried out in standard transcription buffer (40 mM Tris-HCl, pH 7.9, 70 mM KCl, 0.1 mM dithiothreitol, 10 mM MgCl2) by using 0.06 µM RNAP holoenzyme, 0.1 mM NTP, 5 µCi [{alpha}-32P]CTP (3,000 Ci/mmol), 0.02 µM template DNA, and 4.5 µM Gre factors in a total volume of 10 µl. DNA, RNAP, Gre proteins, and NTPs were premixed on ice, and the samples were incubated for 5 or 15 min at 37°C. We found that the efficiency of transcription termination was not affected by GreA factors (data not shown). To observe the accumulation of abortive products during the multiround runoff assay, transcription reactions were carried out as above by using 30 µM NTP and the incubation time was increased to 30 or 60 min. All reactions were stopped with formamide sample buffer, and the RNA products were separated by 8 M urea-10% or 23% PAGE. Runoff and termination RNA products were identified by using 32P-labeled {phi}X174 DNA/HinfI markers (Promega) and quantified by the Typhoon PhosphorImager (GE Healthcare) by using ImageQuant software (Molecular Dynamics). The identity of short abortive RNAs was verified by RNA sequencing by using {gamma}-32P-radiolabeled initiating NTP and terminating 3' deoxy NTPs as described previously (15).


arrow
RESULTS AND DISCUSSION
 
Of the two Gre factors encoded in the E. coli genome, GreA appears to be more important based on its higher abundance and stronger evolutionary conservation. Moreover, previous analysis showed that while cells lacking GreB are virtually indistinguishable from wt cells, greA mutants exhibit several growth defects, including sensitivity to salt and divalent metal ions (data not shown) (35). For this work, we constructed isogenic single (greA+ greB mutant) and double (greA greB mutant) E. coli mutants and used them, together with appropriate analysis methods, to compare the global expression profiles of the two strains (see Materials and Methods). We reasoned that the comparison of transcriptomes from these two strains would allow us to identify those E. coli genes whose expression depends, directly or indirectly, on chromosomally encoded GreA.

In vivo gene expression analysis. The presence of chromosomally expressed GreA affected the transcription of only a few genes, a finding which is consistent with results obtained by others (35). Nineteen genes were upregulated in the greA+ greB mutant relative to the greA greB mutant (Table 2), indicating that GreA is required for their optimal expression. The most prominent effect was observed for the tna genes of the tryptophanase operon. At the same time, the expression of 82 genes was downregulated in the greA+ greB mutant compared to the greA greB mutant (Table 3), suggesting that chromosomally encoded GreA normally suppresses the expression of these genes.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Genes that are activated by wt GreA under both native and overexpressed conditions


View this table:
[in this window]
[in a new window]

 
TABLE 3. Genes that are down-regulated by wt GreA under both native and overexpressed conditions

That expression levels of only few genes are affected by GreA under the conditions used for microarray experiments may be due to the fact that, normally, greA expression is relatively low but is upregulated under certain stress conditions, such as heat shock, acid shock, or antibiotic treatment (22, 33). Recently it was shown that in E. coli greA expression is under the control of a {sigma}E-dependent promoter (31). Indeed, the intracellular levels of GreA were observed to increase about six- to eightfold upon the overexpression of SigE (31), a condition designed to mimic the activation of {sigma}E in response to heat shock, hyperosmotic stress, divalent metal ion exposure, etc. (1, 4, 12, 11). The relatively modest effects caused by the absence of GreA may also be due to the fact that under normal growth conditions, GreA is present in a conformation that prevents its interaction with RNAP (20). Finally, Gre activity may be obscured by antagonists, such as DksA, an abundant protein that shares a common RNAP binding site with GreA and conceivably may outcompete GreA for binding to RNAP (27, 28, 29).

The aforementioned stress conditions that activate the SigE regulon, and that in turn may induce GreA expression, have a complex effect on cellular physiology that is unrelated to GreA activity. Therefore, to identify all or at least the majority of E. coli genes that are specifically responsive to GreA, we compared the expression profile of greA greB mutant cells harboring a pTRC99A vector plasmid with that of an isogenic strain harboring a pTRC99A plasmid carrying wt greA gene under control of an IPTG-inducible tac promoter. Upon induction with 0.05 mM IPTG, the level of plasmid-encoded GreA increases about 10-fold compared to that of chromosomally expressed GreA at our standard growth conditions (based on the results of immunoblotting with anti-GreA antibodies [see Materials and Methods]). Thus, the amount of GreA overproduced from a plasmid is comparable to the amount of chromosomally encoded GreA present in the cell upon derepression of the SigE regulon (31). Since we are specifically interested in genes whose expression is affected by the transcript cleavage activity of GreA, we also performed transcription profiling of similarly induced greA greB mutant cells harboring a pTRC99A plasmid containing a greA gene with a point mutation that substitutes Asp41 for Glu (GreA-D41E). Previously, we showed that such a substitution severely impairs the transcript cleavage activity of GreA without affecting its ability to interact with E. coli RNAP or EC (21). Western blot analysis revealed that upon IPTG induction, the expression levels of GreA-D41E were identical to those of the wt GreA (see Materials and Methods).

The induction of the wt but not the mutant GreA led to changes in the expression levels of 189 genes (Tables 2 to 5). The set of genes downregulated by the wt GreA overexpression was almost the same as that of genes downregulated by chromosomally encoded GreA. These "GreA-repressed" genes are listed in Table 3. Twelve additional genes whose expression is downregulated only by plasmid-encoded wt GreA are presented in Table 5. In most cases, the magnitude of the inhibitory effect was more pronounced at conditions of GreA overexpression, suggesting that GreA-mediated downregulation of transcript levels is concentration dependent. Follow-up primer extension analysis confirmed that several genes selected from Table 3 are indeed downregulated in the presence of overexpressed wt GreA but not the mutant protein (Fig. 1). However, GreA failed to inhibit transcription from the corresponding promoters in vitro (data not shown). Therefore, the in vivo inhibitory effect of GreA may depend on additional factors (repressors or activators) that are present in the cell. Elucidation of the mechanism of GreA-mediated inhibition will have to await the identification of these factors and is the subject of our ongoing research.


View this table:
[in this window]
[in a new window]

 
TABLE 5. Genes that are downregulated by wt GreA only under overexpressed conditions


Figure 1
View larger version (88K):
[in this window]
[in a new window]

 
FIG. 1. Comparison of the results of microarray and primer extension analyses of the effects of chromosome-encoded or plasmid-encoded wt GreA or of plasmid-encoded mutant GreA-D41E on the cellular RNA levels of selected transcript units. The gene array and primer extension columns of each panel show the average n-fold difference in the RNA level of an indicated gene quantified from the results of at least three independent experiments of gene array and primer extension analysis between the control strain lacking gre genes and experimental strain expressing gre. Positive and negative values indicate, respectively, an increase or decrease in the RNA level in gre-expressing strain relative to control. NC, no change; SD, small decrease; SI, small increase. The third column of each panel shows an autoradiogram of denaturing PAGE of a typical result of a primer extension reaction. Each band represents a cDNA product obtained using specific primer complementary to a region located at about 100 to 150 nt downstream from the transcription start site (see Materials and Methods).

Genes whose expression increased either in the presence of chromosomally encoded GreA or upon the overexpression of plasmid-encoded wt GreA are presented in Table 2. Genes whose transcript levels increased only under conditions of GreA overexpression are listed in Table 4. Of the 105 genes listed in Table 4, 52 are ribosomal protein genes, 7 are translation apparatus genes, 1 is a replication gene, and 3 are genes encoding RNAP subunits {alpha}, β, and β', all of which belong to ribosomal protein operons. The remaining 42 genes code for proteins involved in carbohydrate catabolism, respiration, and proton transport and proteins of unknown function. The overexpression of GreA-D41E did not lead to any gene activation and caused only mild inhibitory effects on a subset of genes whose expression was affected by the wt GreA (data not shown). We therefore conclude that most (or perhaps all) changes in gene expression levels listed in Tables 2 to 5 are caused, directly or indirectly, by the cleavage activity of the wt GreA.


View this table:
[in this window]
[in a new window]

 
TABLE 4. Genes that are activated by wt GreA only under overexpressed conditions

Next we analyzed the operon structure of GreA-responsive genes. A list of operons that respond positively and negatively to the presence of the wt GreA is given in Tables 6 and 7, respectively. Promoters of operons upregulated by GreA contain two major groups: (i) operons of translational apparatus/ribosome biosynthesis (most do not require activators), and (ii) operons involved in cellular respiration/energy metabolism, all of which are tightly regulated by activators and repressors. Two additional small groups of promoters include four monocistronic operons involved in cell structure and transcriptional regulation (Table 6). Almost all upregulated promoters are transcribed by the {sigma}70-RNAP holoenzyme. Among upregulated operons, three were involved in stress response (acid/alkaline resistance): yfiD, gadW, and tna. Promoters of operons downregulated by GreA can be divided into two large groups and one small group (Table 7). The first large group is involved in cell metabolism (central intermediary metabolism, carbohydrate catabolism, aerobic and anaerobic respiration, glycerol metabolism, trichloroacetic acid cycle, etc.), and most of operons are positively and negatively regulated; the second large group is involved in stress response, such as heat and cold shock, oxidative and osmotic stress, protein folding and degradation, etc., with some of the operons regulated by activators and repressors. Most of these operons are under control of alternative {sigma} factors, such as heat shock {sigma}32 and stationary phase {sigma}38. Finally, a small group of promoters includes two operons involved in cell structure (Table 7).


View this table:
[in this window]
[in a new window]

 
TABLE 6. Operons that are upregulated by wt GreA


View this table:
[in this window]
[in a new window]

 
TABLE 7. Operons that are downregulated by wt GreAa

Detailed analysis of Tables 6 and 7 and raw microarray data reveal that if a gene in an operon was affected by GreA, so were the other genes in the same operon, though the magnitude of the effect varied and was sometimes below the arbitrarily chosen cutoff level of 1.5 that was used to select individual genes listed in Tables 2 to 5. Importantly, in all cases, all the genes in an operon responded to GreA in the same (positive or negative) way. Together, these results suggest that GreA affects transcription initiation (see below).

The results of global transcription profiling were further confirmed by primer extension analysis using primers specific to several randomly chosen promoter-proximal genes in GreA-responsive operons identified in microarray experiments. The results presented in Fig. 1 show that there is a good correlation between the microarray and primer extension data and further support the notion that GreA regulates gene expression at the level of transcription initiation and/or promoter escape.

In vitro transcription analysis of GreA-responsive genes. To determine whether the stimulatory effect of GreA can be demonstrated in vitro, steady-state runoff transcription from six DNA fragments containing promoters activated by GreA in vivo was carried out in the absence or in the presence of wt or mutant D41E GreA. As a control, we used T. thermophilus GreA. This protein does not bind to E. coli RNAP or its ECs (21, 19). The amount of the runoff product from each of the promoter DNA fragments tested was increased in the presence of the wt GreA (Fig. 2, compare lanes 3 and 4 with lanes 1 and 2, respectively). The stimulatory effect was promoter dependent and under our assay conditions varied from 1.5- to 6-fold. Very little if any stimulation was observed in the presence of GreA-D41E (lanes 5 and 6) and no stimulation was evident in the presence of T. thermophilus GreA (Fig. 2, lanes 7 and 8).


Figure 2
View larger version (57K):
[in this window]
[in a new window]

 
FIG. 2. Effect of GreA factors on multiround runoff transcription from promoters of selected genes. For each DNA fragment used, the terminal nucleotide positions relative to transcription start site are indicated in the left column. Each panel is an autoradiogram of the denaturing 10% PAGE of radiolabeled RNA products. Transcription reactions were conducted at 37°C for 5 and 15 min under standard reaction conditions (see Materials and Methods) using 0.5 µM RNAP, 0.15 µM DNA, 100 µM NTPs, and 0.2 µCi [{alpha}-32P]CTP in 10 µl of reaction volume, in the absence or presence of 4 µM GreA factor. Positions of the runoff products (RO) and terminated transcripts (T) are indicated on the right. The average n-fold difference between the amount of total RNA product (terminated transcript plus runoff) synthesized after 15 min in the absence of GreA factors and in the presence of wt GreA, mutant GreA-D41E, or T. thermophilus GreA is shown below each panel. Positive and negative values indicate, respectively, stimulatory and inhibitory effect of GreA factors on transcription relative to control. The average values were calculated from at least four independent experiments. Standard deviation from experiment to experiment was typically less than 20%.

GreA-dependent increase in steady-state levels of runoff transcripts could, in principle, be due to the stimulation of (i) promoter binding by RNAP, (ii) promoter melting, (ii) promoter clearance, (iv) transcription elongation, (v) RNAP recycling. To determine which of these possibilities are realized, we performed a series of discriminative assays. Each aimed to reveal the effect of GreA on a particular step of the transcription cycle. We observed no difference in the ability of RNAP to form closed (i) or open (ii) promoter complexes in the presence or the absence of GreA on any of the promoter DNA fragments tested (by using specific DNA band-shift assays and by KMnO4 and DNase footprinting assays) (data not shown). Furthermore, GreA had no visible effect on the rate of transcription elongation on the templates used (data not shown). However, an analysis of abortive transcription reactions (Fig. 3) revealed that for each promoter tested, the addition of wt but not the mutant or T. thermophilus GreA decreased the amount of abortive synthesis relative to the amount of the runoff product (compare Fig. 2 and 3). The exception was the ompX gene promoter where no abortive products were observed in the presence or the absence of GreA (data not shown). In all cases, the decrease of abortive transcripts was accompanied by accumulation of shorter radiolabeled products (di- and trinucleotides) visible on denaturing PAGE. The mobility of these products decreased upon treatment with alkaline phosphatase (data not shown), indicating that they contain 5' phosphate and thus represent 3' end-proximal products of GreA-induced cleavage. Together, these data suggest that in most cases, (i) the stimulatory effect of GreA is exerted during the early stages of transcription initiation, and (ii) this stimulation requires the presence of the transcript cleavage activity of GreA. This finding is an unexpected one, as heretofore GreA was mostly thought to be a bona fide "elongation" factor influencing transcription pausing and arrest (8, 7, 13). Recently it has been proposed that GreA may increase the rate of promoter escape by affecting an equilibrium between productive and the so-called "moribund" promoter complexes that are unable to leave the promoter (35). While the structural characteristics of the moribund complexes are unknown, the effect of GreA was not associated with the transcript cleavage activity but was rather thought to be due to a conformational change in RNAP that occurs upon GreA binding (35). Clearly, the stimulatory effect on GreA-responsive genes studied here is different as it is dependent on the transcript cleavage activity of the factor. For example, transcript cleavage by GreA may be necessary to relieve early transcriptional arrest during promoter clearance (14, 16). Even if only a small fraction of RNAP molecules becomes arrested, in a multiround transcription, this can lead to a significant decrease in the overall number of runoff product. Thus, GreA-induced cleavage of such arrested complexes would enhance promoter clearance and the overall efficiency of productive initiation. Alternatively, GreA may increase the efficiency of promoter escape directly by promoting the retention (and therefore elongation) of short transcripts by RNAP. The latter scenario is possible if the 5' end-proximal cleavage products are more stably associated with RNAP than are the transcripts GreA acts upon. Availability of GreA-responsive promoters uncovered in this work will allow us to determine which of these (or other) possibilities is realized.


Figure 3
View larger version (60K):
[in this window]
[in a new window]

 
FIG. 3. Effect of GreA factors on the pattern of abortive transcripts generated during multiround transcription reactions from promoters of selected genes. Each panel is an autoradiogram of the denaturing 23% PAGE separating short radiolabeled RNA products. Transcription reactions were carried out as described in the legend for Fig. 2, except that 30 µM NTPs were used and reactions were incubated for 30 and 60 min. Positions of abortive RNAs and products of GreA-induced cleavage are indicated on the right.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Robert Landick for providing anti-GreA antibodies and to Andrei Parshin for help with purification of wt and mutant GreA.

This work was supported by NIH grants GM54098 to S.B., GM59295 to K.S., and GM62662 to B.L.W.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Cell Biology, UMDNJ-SOM at Stratford, 2 Medical Center Drive, Rm. 108b, Stratford, NJ 08084-1489. Phone: (856) 566-6271. Fax: (856) 566-6965. E-mail: serbor{at}aol.com Back

{triangledown} Published ahead of print on 31 August 2007. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Ades, S. E., I. L. Grigorova, and C. A. Gross. 2003. Regulation of the alternative sigma factor {sigma}E during initiation, adaptation, and shutoff of the extracytoplasmic heat shock response in Escherichia coli. J. Bacteriol. 185:2512-2519.[Abstract/Free Full Text]
  2. 2
  3. Affymetrix, Inc. 2004. GeneChip E. coli Genome 2.0 array technical manual. Affymetrix, Inc., Santa Clara, CA. http://www.affymetrix.com/support/technical/manuals.affx.
  4. 3
  5. Batada, N. N., K. D. Westover, D. A. Bushnell, M. Levitt, and R. D. Kornberg. 2004. Diffusion of nucleoside triphosphates and role of the entry site to the RNA polymerase II active center. Proc. Natl. Acad. Sci. USA 101:17361-17364.[Abstract/Free Full Text]
  6. 4
  7. Bianchi, A. A., and F. Baneyx. 1999. Hyperosmotic shock induces the sigma32 and sigmaE stress regulons of Escherichia coli. Mol. Microbiol. 34:1029-1038.[CrossRef][Medline]
  8. 5
  9. Borukhov, S., and A. Goldfarb. 1993. Recombinant Escherichia coli RNA polymerase: purification of individually overexpressed subunits and in vitro assembly. Protein Expr. Purif. 4:503-511.[CrossRef][Medline]
  10. 6
  11. Borukhov, S., and A. Goldfarb. 1996. Purification and assay of Escherichia coli transcript cleavage factors GreA and GreB. Methods Enzymol. 274:315-326.[Medline]
  12. 7
  13. Borukhov, S., J. Lee, and O. Laptenko. 2005. Bacterial transcription elongation factors: new insights into molecular mechanism of action. Mol. Microbiol. 55:1315-1324.[CrossRef][Medline]
  14. 8
  15. Borukhov, S., V. Sagitov, and A. Goldfarb. 1993. Transcript cleavage factors from E. coli. Cell 72:459-466.[CrossRef][Medline]
  16. 9
  17. Campbell, G. R., L. A. Sharypova, H. Scheidle, K. M. Jones, K. Niehaus, A. Becker, and G. C. Walker. 2003. Striking complexity of lipopolysaccharide defects in a collection of Sinorhizobium meliloti mutants. J. Bacteriol. 185:3853-3862.[Abstract/Free Full Text]
  18. 10
  19. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
  20. 11
  21. Egler, M., C. Grosse, G. Grass, and D. H. Nies. 2005. Role of the extracytoplasmic function protein family sigma factor RpoE in metal resistance of Escherichia coli. J. Bacteriol. 187:2297-2307.[Abstract/Free Full Text]
  22. 12
  23. Erickson, J. W., and C. A. Gross. 1989. Identification of the sigma E subunit of Escherichia coli RNA polymerase: a second alternate sigma factor involved in high-temperature gene expression. Genes Dev. 3:1462-1471.[Abstract/Free Full Text]
  24. 13
  25. Fish, R. N., and C. M. Kane. 2002. Promoting elongation with transcript cleavage stimulatory factors. Biochim. Biophys. Acta 1577:287-307.[Medline]
  26. 14
  27. Hsu, L. M. 2002. Promoter clearance and escape in prokaryotes. Biochim. Biophys. Acta 1577:191-207.[Medline]
  28. 15
  29. Hsu, L. M., I. M. Cobb, J. R. Ozmore, M. Khoo, G. Nahm, L. Xia, Y. Bao, and C. Ahn. 2006. Initial transcribed sequence mutations specifically affect promoter escape properties. Biochemistry 45:8841-8854.[CrossRef][Medline]
  30. 16
  31. Hsu, L. M., N. V. Vo, and M. J. Chamberlin. 1995. Escherichia coli transcript cleavage factors GreA and GreB stimulate promoter escape and gene expression in vivo and in vitro. Proc. Natl. Acad. Sci. USA 92:11588-11592.[Abstract/Free Full Text]
  32. 17
  33. Hutchison, C. A., S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. C. Venter. 1999. Global transposon mutagenesis and a minimal Mycoplasma genome. Science 286:2165-2169.[Abstract/Free Full Text]
  34. 18
  35. Komissarova, N., and M. Kashlev. 1997. Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3' end of the RNA intact and extruded. Proc. Natl. Acad. Sci. USA 94:1755-1760.[Abstract/Free Full Text]
  36. 19
  37. Laptenko, O., and S. Borukhov. 2003. Biochemical assays of Gre factors of Thermus thermophilus. Methods Enzymol. 371:219-232.[Medline]
  38. 20
  39. Laptenko, O., S. S. Kim, J. Lee, M. Starodubtseva, F. Cava, J. Berenguer, X. P. Kong, and S. Borukhov. 2006. pH-dependent conformational switch activates the inhibitor of transcription elongation. EMBO J. 25:2131-2141.[CrossRef][Medline]
  40. 21
  41. Laptenko, O., J. Lee, I. Lomakin, and S. Borukhov. 2003. Transcript cleavage factors GreA and GreB act as transient catalytic components of RNA polymerase. EMBO J. 22:6322-6334.[CrossRef][Medline]
  42. 22
  43. Len, A. C., D. W. Harty, and N. A. Jacques. 2004. Stress-responsive proteins are upregulated in Streptococcus mutans during acid tolerance. Microbiology 150:1339-1351.[Abstract/Free Full Text]
  44. 23
  45. Nogales, J., R. Campos, H. BenAbdelkhalek, J. Olivares, C. Lluch, and J. Sanjuan. 2002. Rhizobium tropici genes involved in free-living salt tolerance are required for the establishment of efficient nitrogen-fixing symbiosis with Phaseolus vulgaris. Mol. Plant-Microbe Interact. 15:225-232.[Medline]
  46. 24
  47. Nudler, E., A. Mustaev, E. Lukhtanov, and A. Goldfarb. 1997. The RNA-DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell 89:33-41.[CrossRef][Medline]
  48. 25
  49. Opalka, N., M. Chlenov, P. Chacon, W. J. Rice, W. Wriggers, and S. A. Darst. 2003. Structure and function of the transcription elongation factor GreB bound to bacterial RNA polymerase. Cell 114:335-345.[CrossRef][Medline]
  50. 26
  51. Orlova, M., J. Newlands, A. Das, A. Goldfarb, and S. Borukhov. 1995. Intrinsic transcript cleavage activity of RNA polymerase. Proc. Natl. Acad. Sci. USA 92:596-600.
  52. 27
  53. Paul, B., M. Barker, W. Ross, D. Schneider, C. Webb, J. Foster, and R. L. Gourse. 2004. DksA: a critical component of the transcription initiation machinery that potentiates the regulation of rRNA promoters by ppGpp and the initiating NTP. Cell 118:311-322.[CrossRef][Medline]
  54. 28
  55. Perederina, A., V. Svetlov, M. N. Vassylyeva, T. H. Tahirov, S. Yokoyama, I. Artsimovitch, and D. G. Vassylyev. 2004. Regulation through the secondary channel—structural framework for ppGpp-DksA synergism during transcription. Cell 118:297-309.[CrossRef][Medline]
  56. 29
  57. Potrykus, K., D. Vinella, H. Murphy, A. Szalewska-Palasz, R. D'Ari, and M. Cashel. 2006. Antagonistic regulation of Escherichia coli ribosomal RNA rrnB P1 promoter activity by GreA and DksA. J. Biol. Chem. 281:15238-15248.[Abstract/Free Full Text]
  58. 30
  59. Record, M. T., Jr., W. Reznikoff, M. Craig, K. McQuade, and P. Schlax. 1996. Escherichia coli RNA polymerase (E{sigma}70) promoters and the kinetics of the steps of transcription initiation, p. 792-820. In F. C. Neidhart et al. (ed.), Escherichia coli and Salmonella, 2nd ed. ASM Press, Washington, DC.
  60. 31
  61. Rhodius, V. A., W. C. Suh, G. Nonaka, J. West, and C. A. Gross. 2006. Conserved and variable functions of the sigmaE stress response in related genomes. PLoS Biol. 4:e2.[CrossRef][Medline]
  62. 32
  63. Shaevitz, J. W., E. A. Abbondanzieri, R. Landick, and S. M. Block. 2003. Backtracking by single RNA polymerase molecules observed at near-base-pair resolution. Nature 426:684-687.[CrossRef][Medline]
  64. 33
  65. Singh, V. K., R. K. Jayaswal, and B. J. Wilkinson. 2001. Cell wall-active antibiotic induced proteins of Staphylococcus aureus identified using a proteomic approach. FEMS Microbiol. Lett. 199:79-84.[Medline]
  66. 34
  67. Sosunova, E., V. Sosunov, M. Kozlov, V. Nikiforov, A. Goldfarb, and A. Mustaev. 2003. Donation of catalytic residues to RNA polymerase active center by transcription factor Gre. Proc. Natl. Acad. Sci. USA 100:15469-15474.[Abstract/Free Full Text]
  68. 35
  69. Susa, M., T. Kubori, and N. Shimamoto. 2006. A pathway branching in transcription initiation in Escherichia coli. Mol. Microbiol. 59:1807-1817.[CrossRef][Medline]
  70. 36
  71. von Hippel, P. 1998. An integrated model of the transcription complex in elongation, termination, and editing. Science 281:660-665.[Abstract/Free Full Text]
  72. 37
  73. Wei, W., J. Jiang, X. Li, L. Wang, and S. S. Yang. 2004. Isolation of salt-sensitive mutants from Sinorhizobium meliloti and characterization of genes involved in salt tolerance. Lett. Appl. Microbiol. 39:278-283.[CrossRef][Medline]
  74. 38
  75. Westover, K. D., D. A. Bushnell, and R. D. Kornberg. 2004. Structural basis of transcription: nucleotide selection by rotation in the RNA polymerase II active center. Cell 119:481-489.[CrossRef][Medline]
  76. 39
  77. Zenkin, N., Y. Yuzenkova, and K. Severinov. 2006. Transcript-assisted transcriptional proofreading. Science 313:518-520.[Abstract/Free Full Text]
  78. 40
  79. Zhang, G., E. A. Campbell, L. Minakhin, C. Richter, K. Severinov, and S. A. Darst. 1999. Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell 98:811-824.[CrossRef][Medline]
  80. 41
  81. Zhou, L., S. K. Kim, L. Avramova, K. A. Datsenko, and B. L. Wanner. 2003. Use of conditional-replication, integration, and modular CRIM plasmids to make single-copy lacZ fusions, p. 65-89. In M. Blot (ed.), Methods and tools in biosciences and medicine. Prokaryotic genomics. Birkhäuser Verlag, Basel, Switzerland.


Journal of Bacteriology, December 2007, p. 8772-8785, Vol. 189, No. 24
0021-9193/07/$08.00+0     doi:10.1128/JB.00911-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • van Hijum, S. A. F. T., Medema, M. H., Kuipers, O. P. (2009). Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation. Microbiol. Mol. Biol. Rev. 73: 481-509 [Abstract] [Full Text]  
  • Aberg, A., Fernandez-Vazquez, J., Cabrer-Panes, J. D., Sanchez, A., Balsalobre, C. (2009). Similar and Divergent Effects of ppGpp and DksA Deficiencies on Transcription in Escherichia coli. J. Bacteriol. 191: 3226-3236 [Abstract] [Full Text]  
  • Lewis, P. J., Doherty, G. P., Clarke, J. (2008). Transcription factor dynamics. Microbiology 154: 1837-1844 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stepanova, E.
Right arrow Articles by Borukhov, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stepanova, E.
Right arrow Articles by Borukhov, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*Substance via MeSH