Previous Article | Next Article ![]()
Journal of Bacteriology, December 2007, p. 8871-8879, Vol. 189, No. 24
0021-9193/07/$08.00+0 doi:10.1128/JB.01272-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Department of Microbiology and Immunology, Dartmouth Medical School, Hanover, New Hampshire 03755
Received 7 August 2007/ Accepted 2 October 2007
|
|
|---|
|
|
|---|
Inhibition of protein synthesis by MazF in E. coli has been found to be attributable to cleavage of cellular mRNA. More specifically, MazF in E. coli is a sequence-specific endoribonuclease, cleaving mRNA at ACA sites independently of ribosomes both in vitro and in vivo (6, 34). The cleavage occurs at the 5' end of ACA sequence to yield a 2',3'-cyclic phosphate as part of the end product. The 2'-OH group of the nucleotide preceding the ACA sequence is essential for MazF cleavage (37). In contrast, the RelE toxin of E. coli was found to cleave mRNA positioned at the ribosomal A-site both in vitro and in vivo (26). Cleavage occurs between the second and third bases of the A-site codon (UAH, where H is usually G or A), with the cleavage efficiency depending on the specific codon at the ribosomal A-site. For instance, UAG and UAA are cleaved more efficiently than the UGA stop codon (26). The toxin systems from other prokaryotes also appeared to represent sequence-specific endoribonucleases. The PemK toxin from plasmid R100 in E. coli cleaves mRNA at UAH (where H is A, C, or U) (36), and ChpBK cleaves at ACY (where Y is A, G, or U) in a single-stranded RNA (38), while the Bacillus subtilis MazF homolog EndoA cleaves mRNA at a UAC sequence (27). Recently, two MazF homologs from Mycobacterium tuberculosis were also found to be endoribonucleases. One of the MazF homologs from M. tuberculosis cleaves mRNA at UAC triplets, while the other homolog cleaves U-rich regions within mRNA (39).
In examining the sigB operon of Staphylococcus aureus, Kullik et al. (18) noted that an open reading frame (ORF) immediately upstream of the sigB operon may encode a mazF homolog (designated the pemK homolog). Senn et al. (30) subsequently demonstrated that the sigB operon in S. aureus strain COL comprises two additional ORFs (SA2059 and SA2058) in addition to rsbU, rsbV, rsbW, and sigB. They also observed, as did Gertz et al. (13), that SA2058 and, to a much lesser extent, SA2059 share some degree of homology with MazF and MazE of E. coli, respectively. SA2059 and SA2058 are cotranscribed with the sigB operon under stress conditions, such as heat and high-salt conditions (30). For brevity and consistency, we propose to name SA2059 and SA2058 (designated as SA1873 and SAS067 in N315) in COL as MazESaand MazFSa, respectively, in S. aureus. Although it has been hinted that the S. aureus MazEFSa may act as a TA module (30), there have been no experimental data supporting this hypothesis. This confusion has been generated in part as a consequence of a general lack of protein sequence similarity between MazESa and its E. coli counterpart.
In this study, we provide definitive evidence that MazEFSa is a TA module in S. aureus, with MazFSa as the toxin. Our data demonstrate that MazFSa is a sequence-specific endoribonuclease which cleaves ctpA mRNA at a consensus U-rich sequence of VUUV' (where V and V' are A, C, or G and may or may not be identical) both in vivo and in vitro. MazFSa showed high cellular toxicity in both E. coli and S. aureus upon induction and inhibited protein synthesis in a cell-free system. Collectively, our results suggest that the activated MazEFSa TA module cleaves mRNA cleavage at a specific site under stressful conditions to affect translation. This finding raises the possibility that inhibition of MazESa may represent a novel approach to antibacterial therapy for S. aureus.
|
|
|---|
and BL21(DE3)pLysS and S. aureus strains Newman and 178RI (8) for these studies. S. aureus 178RI carries an isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible T7 polymerase gene integrated into the geh locus in the chromosome of RN4220. For transduction, phage
85 was used to produce phage lysates of S. aureus 178RI. The phage lysate was then used to infect S. aureus Newman as described elsewhere (3) to obtain the S. aureus transductant ACL6094 carrying the T7 polymerase gene integrated into the chromosome in the Newman background. Cultures were routinely grown in LB for E. coli and in 03GL or trypticase soy broth for S. aureus with aeration at 37°C. The media were supplemented with either ampicillin (Amp; 70 µg/ml) or chloramphenicol (Cm; 10 µg/ml). Construction of plasmids. The mazESa (GenBank accession number Y16431) and mazFSa (GenBank accession number Y07645) genes were amplified by PCR using S. aureus Newman genomic DNA as a template and cloned into the NcoI and BamHI sites of cloning vectors pCDF1 and pET14b (Novagen) in E. coli to make pCDF1-MazE(His)6 and pET14b-MazF(His)6 with the His6 tag at the N terminus, respectively. The mazEsa gene without the His tag was amplified by PCR and cloned into the NdeI/XhoI sites of pETDuet1 (Novagen). An NcoI-BamHI-digested DNA fragment from pET14b-MazF(His)6 was then inserted to make pETDuet1-MazEF(His)6 with the His6 tag only at the MazFSa N terminus. An NcoI-BamHI- and a BglII-EcoRI-digested DNA fragment from pET14b-MazF(His)6 was further cloned into NcoI- and BamHI-digested pBAD22 (14) and BglII-EcoRI-digested pG164 (8), respectively, to generate pBAD22-MazF(His)6 and pG164-MazF(His)6. The ctpA gene (encoding a carboxy-terminal protease from S. aureus; GenBank accession number NP_374534) was also amplified by PCR using S. aureus Newman genomic DNA as the template and cloned into the NcoI and BamHI sites of pET14b (Novagen) to produce pET14b-ctpA. A BglII-EcoRI-digested fragment from pET14b-ctpA was further cloned into BamHI- and EcoRI-digested pG164-MazF(His)6 to generate pG164-MazF(His)6/ctpA. DNA techniques were performed according to standard procedures (28).
Protein expression and purification. MazE(His)6Sa was expressed in E. coli BL21(DE3)pLysS carrying the plasmid pCDF1-MazE(His)6 under IPTG induction (1 mM) for 4 h. For MazF(His)6Sa expression, the MazESa and MazF(His)6Sa genes were coexpressed in E. coli BL21(DE3)pLysS harboring the plasmid pETDuet1-MazEF(His)6 after IPTG induction (1 mM) for 6 h. The cells were harvested and subjected to lysis by ultrasonication. MazE(His)6Sa and MazE-MazF(His)6Sa complex were purified with a nickel-nitrilotriacetic acid resin affinity column (Novagen) according to the manufacturer's protocol. MazF(His)6Sa was further purified from the MazE-MazF(His)6Sa complex as described previously (35). In brief, MazESa was dissociated from MazF(His)6Sa in the purified MazE-MazF(His)6Sa complex with 6 M guanidine HCl. MazF(His)6Sa was retrapped with the nickel-nitrilotriacetic acid resin affinity column, eluted, and refolded by stepwise dialysis as described previously (25).
Native PAGE. Various amounts of MazE(His)6Sa and MazF(His)6Sa were mixed in binding buffer (50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 1 mM dithiothreitol, and 5% glycerol) at 4°C for 30 min and subjected to native polyacrylamide gel electrophoresis (PAGE) analysis in running buffer containing 82.6 mM Tris-HCl (pH 9.4) and 33 mM glycine as described previously (35). The protein bands were visualized by staining with Coomassie brilliant blue.
Primer extension analyses.
For in vitro primer extension, the ctpA mRNA was transcribed from BamHI-linearized pET14b-ctpA plasmid, using the T7 large-scale transcription kit (Promega) according to the manufacturer's protocol. Five µg of ctpA mRNA was partially digested with 15 pmol of MazFSa in a 20-µl reaction mixture containing 40 U of RNase inhibitor, 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, and 1 mM dithiothreitol at 37°C for 90 min. The digestion mixture was then extracted with phenol-chloroform followed by ethanol precipitation to remove the proteins. Primer extension (Promega primer extension kit) analysis of the digested mRNA was carried out with labeled primers pEa d(GCTTGATCAGTTTTGTTTAAACCAC), pEb d(TGACCATGCCATCAATTGCAGC), pEc d(AGGACGAATGCCAGCACGTTCTGCTGG), and pEd d(CTTCACTACCT CGTTGAACAGTTA), following the manufacturer's protocol. The primers were 5'-end labeled with [
-32P]ATP using T4 polynucleotide kinase. For in vivo primer extension analysis of ctpA mRNA cleavage sites in E. coli, we isolated total cellular RNA from E. coli BL21(DE3)pLysS cells harboring both pBAD22-MazF(His)6 and pET14b-ctpA. Cultures were induced with 1 mM IPTG to transcribe the ctpA mRNA for 30 min. MazFSa was then induced by adding arabinose to a final concentration of 0.2%. For in vivo primer extension in S. aureus, 178RI harboring pG164-MazF(His)6/ctpA was induced with 1 mM IPTG. The ctpA mRNA was cotranscribed with the mazFSa mRNA. After induction, total cellular RNA from a 10-ml culture was then extracted at the indicated time point as described previously (4). Trace DNA was further removed by digestion with RNase-free DNase I (Roche) followed by extraction with phenol-chloroform and ethanol precipitation to clean the RNA. Primer extension was then carried out with different primers as described previously (16). The primer extension product was analyzed on a 6% sequencing gel with the DNA sequencing ladder prepared with the same primer running side by side, followed by autoradiography.
Cleavage of synthetic RNAs by MazFSa.
All RNAs were commercially synthesized (IDT, Coralville, IA) and 5'-end labeled with [
-32P]ATP using T4 polynucleotide kinase. The native sequence, 5'-UUGGCAAUUCAUAUCAAU-3', corresponding to the sense RNA, was named AUUC, with AUUC as the target cleavage site. Seven other RNA substrates with the center AUUC sequences changed to AGUC, AUGC, AUUU, UUUC, AUUG, GUUC, and GUUG sequences were also synthesized and named AGUC, AUGC, AUUU, UUUC, AUUG, GUUC, and GUUG, respectively. The synthesized native DNA sequence, 5'-TTGGCAATTCATATCAAT-3', named ATTC, was used as a control. A 19-base synthetic RNA (5'-UGCAAUUCAUAUGAAUUGU-3') that can form hairpin structure with the AUUC sequence located in the duplex region was named RB-1. Another 19-base RNA (5'-UGCAAUUCAUAUCAAUAUG-3'), which cannot form the hairpin structure, was named RB-2. An antisense RNA to the native AUUC RNA sequence (5'-AUUGAUAUGAAUUGCCAA-3'), was named RB-3. The labeled RNA substrates were digested with MazFSa at 37°C for 30 min in a 10-µl reaction mixture containing 20 U of RNase inhibitor, 15 pmol of MazFSa, 1 pmol labeled RNA, and 10 mM Tris-HCl (pH 7.9). The formation of RNA-RNA duplex with the sense RNA AUUC and RB-3-, the antisense RNA-, or MazFSa-mediated cleavage was analyzed as described elsewhere (36). Briefly, 1 pmol of labeled sense RNA was annealed with its antisense RNA in different ratio combinations and incubated with 15 pmol of MazFSa at 37°C for 30 min. The reactions were stopped by adding loading buffer and analyzed by separating on a 20% sequencing gel. The RNA ladder was prepared by partial alkaline hydrolysis (Ambion) of the 5'-end-labeled 18-base sense RNA, AUUC, according to the manufacturer's protocol.
Northern blot hybridization.
Total RNA from S. aureus was prepared by using a TRIzol isolation kit (Invitrogen, CA) and a reciprocating shaker (4). For detection of specific transcripts, gel-purified DNA probes were radiolabeled with [
-32P]dCTP by use of a random-primed DNA labeling kit (Roche Diagnostics GmbH) and hybridized under aqueous-phase conditions at 65°C. The blots were subsequently washed with 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 0.1% sodium dodecyl sulfate (SDS) twice at room temperature and 1x SSC, 0.1% SDS twice at 65°C and autoradiographed as previously described (20).
Bacterial viability assay. Bacteria were stained with the membrane-permeable SYTO9 and the membrane-impermeable propidium iodide using the Live/Dead BacLight bacterial viability kit (Molecular Probes, Eugene, OR) and quantitated with fluorescence microplate readers according to the manufacturer's protocol. Bacteria with intact cell membranes stain fluorescent green, whereas bacteria with damaged membranes stain fluorescent red.
|
|
|---|
![]() View larger version (47K): [in a new window] |
FIG. 1. Inhibition of cell growth by S. aureus MazFSa. (A) Schematic representation of genetic organization of the S. aureus mazEFSa and sigB operons. (B) S. aureus ACL6094 cells were transformed with pG164-MazF(His)6. The cells were then streaked on a 03GL agar plate with or without induction with IPTG (1 mM) followed by incubation overnight at 37°C. (C) Reduction of CFU with S. aureus ACL6094 harboring pG164-MazF(His)6 under induction. The cultures were induced at an optical density at 650 nm of 0.4 with IPTG (1 mM). To determine the CFU, samples were withdrawn at various time points, spread on TSA plates supplemented with chloramphenicol (10 µg/ml), and incubated at 37°C overnight. (D) Characterization of MazESa/MazFSa. The MazE(His)6Sa and MazF(His)6Sa proteins were purified as described in Materials and Methods. The proteins were analyzed by 16% SDS-PAGE. (i) lane 1, protein molecular mass markers; lane 2, MazE(His)6Sa; lane 3, MazF(His)6Sa; (ii) lane 4, purified MazE-MazF(His)6Sa complex. The upper band is MazF(His)6Sa, and the lower band is the copurified MazESa. (E) Native PAGE analysis of MazEFSa complex formation. MazE(His)6Sa was mixed with MazF(His)6Sa as described in Materials and Methods and subjected to native PAGE analysis. Lane M, molecular mass markers; lane 1, MazE(His)6Sa (32 pmol); lane 2, MazF(His)6Sa (30 pmol); lanes 3 to 5, MazE(His)6Sa (32 pmol). Samples were mixed with 7.5 pmol, 15 pmol, and 30 pmol of MazF(His)6Sa, respectively. The MazESa/MazFSa complex is indicated by the arrow.
|
To further characterize the MazEFSa TA module, we expressed and purified MazF(His)6Sa and MazE(His)6Sa (both N-terminally tagged) (Fig. 1D) in E. coli as described in Materials and Methods. MazE(His)6Sa and MazF(His)6Sa were mixed together in a dose-dependent manner and subjected to native PAGE analysis. Despite the noticed migration of MazE(His)6Sa (pI 4.2), no obvious mobility was observed for MazF(His)6Sa alone (Fig. 1E, lane 2), presumably due to its basic pI (9.5), which approaches the pH (9.4) of the running buffer used in native PAGE. Nevertheless, the MazEFSa complex, appearing as a higher-molecular-weight species than that of MazE(His)6Sa alone, was observed at the top of the gel (Fig. 1E, lanes 3 to 5). The quantity of the MazEFSa complex rose with increasing concentrations of MazF(His)6Sa, while the amount of free MazE(His)6Sa at the bottom of the gel continued to diminish (Fig. 1E). These results indicated that MazESa and MazFSa, as a paired TA module, interact in vitro and possibly in vivo.
MazFSa inhibits protein synthesis in a cell-free system.
We then examined the effect of the purified MazFSa on protein synthesis in a cell-free system. The synthesis of the truncated CtpA protein (
15 kDa), representing part of the carboxy-terminal protease from S. aureus, from the plasmid pET14b-ctpA was carried out at 37°C for 1 h using an E. coli T7 S30 extract system with and without MazFSa (Fig. 2A). The synthesis of CtpA was inhibited with increasing concentrations of MazFSa and was almost completely blocked with 30 pmol added (Fig. 2A). Addition of MazESa to the cell-free system containing MazFSa rescued CtpA synthesis in a dose-dependent manner (Fig. 2B). As expected, the MazFSa protein also inhibited the synthesis of β-lactamase from the bla gene present in the pET14b-ctpA vector in E. coli (Fig. 2). Preincubation of the E. coli cell-free protein synthesis system with MazFSa for 20 min at 37°C prior to adding the plasmid pET14b-ctpA and MazESa did not have any significant effect on subsequent CtpA synthesis (data not shown). These results suggest that the primary target for MazFSa is not the ribosome, tRNA, or other factors required for protein synthesis in this system, but rather the mRNA of the cell.
![]() View larger version (35K): [in a new window] |
FIG. 2. Effects of MazFSa and MazESa on cell-free protein synthesis. (A) Inhibition of protein synthesis by MazFSa. Protein synthesis was carried out with the plasmid pET14b-ctpA in an E. coli T7 S30 extract system at 37°C for 1 h. Lane 1, control without MazFSa; lanes 2 to 6, various amounts of MazFSa were added at 3.75 pmol, 7.5 pmol, 11.25 pmol, 15 pmol, and 30 pmol, respectively. (B) Protein synthesis was rescued by the addition of MazESa. Lane 1, control without MazFSa; lane 2, 15 pmol of MazFSa; lanes 3 to 6, 8 pmol, 16 pmol, 32 pmol, or 64 pmol of MazESa, respectively, was added together with 15 pmol of MazFSa. The synthesis of β-lactamase and CtpA are indicated by arrows.
|
![]() View larger version (64K): [in a new window] |
FIG. 3. Endoribonuclease activity of MazFSa. Five µg of ctpA mRNA was digested with 15 pmol of MazFSa as described in Materials and Methods. (A) Cleavage of ctpA mRNA by MazFSa. Lane 1, control without MazFSa; lanes 2 to 4, mRNA substrates were digested for 60 min, 90 min, and 120 min, respectively. (B) Inhibition of cleavage with the addition of MazESa. Lane 1, mRNA with MazFSa; lanes 2 to 4, mRNA substrates digested by MazFSa together with 4 pmol, 8 pmol, or 16 pmol of MazESa; lane 5, mRNA with 32 pmol of MazESa.
|
![]() View larger version (56K): [in a new window] |
FIG. 4. In vitro primer extension analysis of the MazFSa cleavage sites in ctpA mRNA. Primer extension was carried out as described in Materials and Methods. Each primer extension product was analyzed on a 6% sequencing gel with the DNA sequencing ladder prepared with the same primer. (A and B) Cleavage sites in ctpA mRNA detected with the primer pEa. (C and D) Cleavage sites in ctpA mRNA detected with the primer pEb. The RNA sequences complementary to the DNA sequence ladder are shown to the right of each figure, and corresponding cleavage sites are indicated by arrows.
|
|
View this table: [in a new window] |
TABLE 1. ctpA mRNA sequences around cleavage sites
|
![]() View larger version (56K): [in a new window] |
FIG. 5. Cleavage of synthetic RNA by MazFSa. All RNA substrates labeled at the 5' end with [ -32P]ATP were digested with MazFSa and subjected to analysis in a 20% sequencing gel run with an RNA ladder by alkaline hydrolysis as described in Materials and Methods. (A) Cleavage of a synthetic 18-base RNA, AUUC. Lane 1, RNA ladder generated by alkaline hydrolysis; lane 2, RNA substrate without the addition of MazFSa; lane 3, RNA substrate digested by15 pmol of MazFSa. The corresponding RNA sequence is shown to the right. The cleavage product and site are indicated by arrows. (B) Cleavage specificity of MazFSa with synthetic 18-base RNA substrates. Seven RNA substrates with the center AUUC sequence were changed to AGUC, AUGC, GUUG, UUUC, AUUG, GUUC, and AUUU sequences and named correspondingly. The ATTC indicates the same length of DNA substrate. Lanes 1, 3, 5, 7, 9, 11, 13, 15, and 17 contained no MazFSa; lanes 2, 4, 6, 8, 10, 12, 14, 16, and 18 are with 15 pmol of MazFSa added. The background in the absence of MazFSa was attributed to impurities or incomplete synthesis of the full-length RNA substrates. Nevertheless, cleavage can be seen with MazFSa, as indicated by the arrows. (C) Predicted secondary structure formed by RB-1 (5'-UGCAAUUCAUAUGAAUUGU-3') using the RNA secondary prediction website (http://www.genebee.msu.su/services/rna2_reduced.html). (D) Cleavage of highly purified synthetic RNA substrates with different secondary structures. An 18-base sense RNA, AUUC, and AUUC antisense RNA RB-3, were digested separately by MazFSa. The 19-base RNAs RB-1 and RB-2 (an RB-1 variant) were also digested with MazFSa. Lanes 2, 4, 6, and 8 are with no MazFSa addition; lanes 3, 5, 7, and 9 are with 15 pmol of MazFSa added. The cleavage products are indicated by arrows. (E) Effects of RNA-RNA duplex formation on cleavage by MazFSa. Lane 1, RNA ladder generated by alkaline hydrolysis; lane 2, labeled sense RNA alone; lane 3, labeled sense RNA digested with 15 pmol of MazFSa; lanes 4 to 7, the labeled 18-base sense RNA, AUUC, was annealed with AUUC antisense RNA RB-3 in ratios of 1: 0.2, 1:0.4, 1:0.8, and 1:1, respectively, as indicated and then digested with 15 pmol of MazFSa at 37°C for 30 min.
|
In vivo cleavage of ctpA RNA by MazFSa. To determine the MazFSa-specific cleavage sites in mRNA in vivo, primer extension analysis of ctpA mRNA was performed with total RNA extracted from both E. coli and S. aureus carrying the corresponding plasmids at various time points after induction as described in Materials and Methods. A clear in vivo cleavage site was determined in E. coli with primer pEa, as shown in Fig. 6A. A primer extension product appeared at 30 min after induction of MazFSa, with subsequent time points showing cleavage in a time-dependent manner (lanes 2 to 5). However, the effect of MazFSa in E. coli likely occurs within seconds of initiation of the reaction, as this extension product can almost be detected at time zero (Fig. 6A, lane 1). In vivo cleavage was also detected in S. aureus 178RI carrying plasmid pG164-MazF(His)6/ctpA with primer pEa (Fig. 6B), but the cleaved ctpA mRNA with the extension product was faintly detected only after 30 min of induction (Fig. 6B). We speculate this may be due to a lower copy number of the cotranscribed ctpA mRNA. Nevertheless, the cleavage recognition site in vivo in both E. coli and S. aureus (Fig. 6A and B) was found to be identical to the one in vitro (Fig. 4A), but the cleavage site was shifted two bases upstream. Collectively, these results indicated that MazFSa recognizes the same site on ctpA mRNA both in vivo and in vitro, but the exact cleavage site may differ by one to two bases between those in vivo and in vitro, which could be due to trimming of the RNA ends by cellular RNases.
![]() View larger version (31K): [in a new window] |
FIG. 6. In vivo cleavage of ctpA mRNA after induction for MazFSa expression. Expression of MazFSa in E. coli BL21(DE3)pLysS carrying plasmids pET14b-ctpA and pBAD-MazF(His)6 was induced by arabinose (0.2%) (A). The expression of MazFSa in S. aureus 178RI carrying plasmid pG164-MazF(His)6/ctpA was induced by 1 mM IPTG (B). Total cellular RNAs were extracted at the indicated time points. Primer extension was then carried out as described in Materials and Methods. The DNA sequencing ladder was prepared using the same primer. The cleavage sites in the ctpA mRNA are indicated by arrows. The two panels represent in vivo primer extension with primer pEa from E. coli and S. aureus, respectively.
|
![]() View larger version (33K): [in a new window] |
FIG. 7. DOX stress induced increasing expression of mazEFSa transcripts. The S. aureus Newman culture was treated with 50 ng/ml DOX at optical density at 650 nm of 1.0. Total cellular RNAs were extracted at the indicated time points. Northern blot analysis was carried out with the mazEFSa probe as described in Materials and Methods. (A) Transcripts detected with the probe. (B) 23S and 16S served as the internal loading control.
|
|
|
|---|
In S. aureus, SA2059 and SA2058 have been shown to cotranscribe with the sigB operon, particularly under stressful conditions (30). Given that both mazEF and the sigB operons are modulated under stress and that SA2058 is homologous with mazF of E. coli, it is reasonable to speculate that SA2058 and SA2059 may represent a MazEF-like system in S. aureus, despite a lack of supporting experimental data. In this study, we demonstrated that MazEFSa of S. aureus is a TA module wherein MazFSa is the toxin and MazESa is the antitoxin that binds MazFSa to inhibit its toxicity. Our data showed that MazFSa is toxic to both E. coli and S. aureus after induction for its expression (Fig. 1). It inhibits protein synthesis in a cell-free system by cleaving mRNA substrates. MazESa, on the other hand, inhibits the toxicity of MazFSa by preventing cleavage of the target mRNA and hence releases the inhibition in protein synthesis by MazFSa (Fig. 2 and 3). This inhibition was due to the formation of the MazESa/MazFSa complex (Fig. 1D), which prevents the free form of MazFSa from cleaving the target RNA (Fig. 3B). However, the exact stoichiometry by which the C-terminal arm of MazESa mimics the similarly charged sugar-phosphate backbone of RNA to inhibit MazFSa toxin activity by occupying the RNA binding site on the MazFSa toxin as described for E. coli (19) will require further detailed crystal structure studies of the MazE/MazFSa complex.
In S. aureus and some gram-positive bacteria (e.g., B. subtilis and Listeria monocytogenes), mazEF homologs are located immediately upstream of the sigB operon, which encodes
B, the main alternative transcription factor involved in the stress response of many gram-positive bacteria, and a series of anti-sigma factors to control the concentration of free
B (10, 13, 27, 30). In contrast, the mazEF genes in E. coli are located downstream of the relA gene. relA encodes a synthase for ppGpp and is upregulated in response to uncharged tRNA at the ribosomal A-site during amino acid starvation and other stressful conditions, including antibiotic exposure (1, 15, 29). It was shown that overproduction of ppGpp (by overproducing RelA', a truncated version of ppGpp synthetase I of E. coli) in a strain derived from MC4100 represses expression from the mazEF promoter. Those authors then suggested that physiological conditions that confer increased levels of ppGpp would reduce synthesis of MazE antitoxin, hence enabling degradation of the more labile MazE antitoxin by the ClpPA protease system and unleashing the toxic effect of MazF to execute programmed cell death (PCD) (1). However, Christensen et al. (6) investigated whether the transcription pattern of mazEF during amino acid starvation induced by serine hydroxamate was stimulated strongly by amino acid starvation, and this stimulation depended on Lon. No TA locus-dependent cell killing was observed during this amino acid starvation. Penersen et al. (25) also showed that the toxicity of MazF in E. coli can be rescued by the antitoxin MazE, expressed within 6 h after MazF induction. They further proposed that MazF does not mediate cell killing but rather induces a bacteriostatic condition. Both studies have shed doubt on the notion of PCD proposed by Aizenman et al. (1). Indeed, even with the overproduction of MazF, E. coli cells can retain transcriptional and translational competence for 4 days despite their growth arrest (31). Although Sat et al. (29), Amitai et al. (2), and Hazan et al. (15) suggested PCD is mediated by mazEF from E. coli upon exposure to some antibiotics, controversial results were presented for the same PCD experiments by Tsilibaris et al. (33); thus, the physiological roles of the toxin proteins remain under debate.
Our results demonstrated that the expression of the mazEFSa transcripts was up-regulated (Fig. 7) when the culture was exposed to sub-MIC levels of some antibiotics, with no great loss of cell viability. Given the divergent structural arrangement between E. coli and S. aureus with respect to MazEF and the stress operon, the regulation of the S. aureus MazEFSa TA module in response to stress warrants additional investigation (unpublished data). Pedersen et al. (25) reported that RelE-induced cell stasis exhibited increased sensitivity towards environmental stresses, e.g., heat shock, oxygen radicals, and osmotic stress. The above studies have led to the suggestion that TA complexes might constitute a novel approach toward the potential development of a new class of antimicrobial compounds which activate or mimic bacterial toxins. Compounds could function through several different mechanisms, such as preventing or reducing the association between a given TA pair or manipulating the signaling pathway that leads to toxin activation (9, 12, 22).
As with E. coli MazF, the MazFSa of S. aureus was also found to be a ribosome-independent endoribonuclease, but with very different sequence specificity compared with other MazF homologs. In particular, it cleaves the RNA substrate in a U-rich region with the consensus sequences VUUV' as demonstrated both in vivo and in vitro (Fig. 4 and 5). Most commonly, the cleavage sites reside in the 5' end of the first U residue and at the 3' end of the second U (Fig. 4; Table 1). Importantly, the two U residues are essential for the MazFSa cleavage, since replacement of either U residue abolishes the cleavage while the V and V' residues can be A, C, and G. When V or V' residues were changed to U, the cleavage efficiency was significantly reduced (Fig. 5). Previously, the MazF of E. coli was demonstrated to cleave RNA substrates specifically at the 5' end of ACA sequences (34). Similarly, two MazF homologs from Mycobacterium tuberculosis were also found to cleave at UAC triplets and (U/C)U
(A/U)C(U/C) in the mRNA (39). Another PemK family toxin, EndoA from Bacillus subtilis, which shares homology with MazF of E. coli, was also shown to cleave at a UAC sequence (27). These results suggest that the cleavage sites of different MazF homologs in prokaryotes can differ. In particular, MazFSa is the first example of a toxin that cleaves most commonly at the 5' or 3' end an invariant UU residue with a consensus sequence of VUUV'. How various toxins contribute to bacterial cell physiology and metabolism in response to stress by cleaving mRNAs at specific sites is of general interest and merits further studies.
As there are other VUUV' sequences within the ctpA mRNA that are not amenable to cleavage, we investigated the role of the secondary structure of RNA, including the stem-loop structure and RNA duplex, in mRNA cleavage by MazFSa. Our data clearly showed that the VUUV' sequence can be cleaved as part of a loop, but not as part of the stem where the VUUV' sequence may form a partial RNA duplex (Fig. 5C and D). To confirm this, we incubated MazFSa with a perfect RNA-RNA duplex where the antisense RNA was complementary to the sense RNA strand, which is amenable to cleavage under in vitro conditions. As predicted from the stem-loop study and in concordance with the data for the MazF of E. coli (37), MazFSa can only cleave the single-stranded RNA at the predicted VUUV' site but not the perfect RNA-RNA duplex (Fig. 5E). Curiously, the MazFSa toxin cannot cleave the complementary antisense RNA strand with the 5'-GAAUUG-3' sequence, where the first four bases are complementary to the AUUC consensus sequence in the sense strand and the last four nucleotides constitute the putative AUUG cleavage site (see the description of the AUUC antisense RB-3 in Materials and Methods). The reason for the difference in cleavage between the sense and the AUUC antisense strand is not entirely clear, but it may be due to the secondary structure, or the adjacent sequence may contribute to recognition of the putative site. Our data also demonstrated that MazFSa recognizes the same site on ctpA mRNA both in vivo and in vitro, but the exact cleavage site differed by one to two bases (Fig. 6). These differences may be due to changes in the buffering environment, which could affect the folding of the ctpA mRNA substrate. It is also quite possible that there may be another protein interacting with MazFSa besides MazESa, which could change the conformation of this endoribonuclease, or that the RNA ends may be trimmed by RNases in vivo.
Recently, Moritz and Hergenrother showed that the mazEF TA system was found to be ubiquitous among plasmids obtained from vancomycin-resistant enterococci (22). Consistent with the early discovery of TA system in plasmids (11, 24), they proposed that the MazEF system functions to stabilize the plasmid in Enterococcus species. Since the vanA gene, the critical component of vancomycin resistance in enterococci (22), resides on the same plasmid as that of the mazEF genes in over 90% of the strains, this raises the possibility that TA systems may also serve to maintain the vancomycin-resistant gene in Enterococcus species. Given that gene transfer has been shown to occur between staphylococci and enterococci, it remains to be seen if the MazEFSa system plays an important role in maintenance of antibiotic resistance genes in S. aureus.
Although the MazFSa toxin shares sequence similarity to its counterparts in E. coli and B. subtilis, the antitoxin MazESa was found to be homologous to MazE-like molecules only in Staphylococcus epidermis, Staphylococcus hemolyticus and Staphylococcus saprophyticus, but not to other paralogs in gram-positive species (e.g., YdcD in B. subtilis). Studies in another TA module called yefM/yoeB in Streptococcus pneumoniae showed that the toxicity of YoeB could be reverted by its cognate antitoxin YefM, but not by the YefM homolog from E. coli (23). The above findings clearly indicate that antitoxins are different between species within the same TA systems, while the toxins are more homologous.
Collectively, our findings indicate that the MazFSa of S. aureus differs in cleavage specificity from its E. coli counterpart. Based on the arrangement of mazEFSa together with the sigB operon as a single transcription unit and that the sigB operon is a known stress-induced transcription unit, we speculate that the toxic effect of MazFSa for S. aureus in response to stress likely diverges from that of E. coli. Finally, genomic mining reveals that MazESa may be unique in staphylococcal species. Accordingly, we predict that a successful anti-MazESa strategy will be active against other staphylococcal species as well.
This work was supported by research grants AI47441 (to A.L.C.) from NIH.
Published ahead of print on 12 October 2007. ![]()
|
|
|---|
B-dependent transcription of sigB and asp23 in two different Staphylococcus aureus strains. Mol. Gen. Genet. 261:558-566.[CrossRef][Medline]
B in Staphylococcus aureus reveals its function as a global regulator of virulence genes. J. Bacteriol. 180:4814-4820.
B operon in Staphylococcus aureus. J. Bacteriol. 187:8006-8019.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»