This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dale, J. R.
Right arrow Articles by DiChristina, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dale, J. R.
Right arrow Articles by DiChristina, T. J.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2007, p. 1036-1043, Vol. 189, No. 3
0021-9193/07/$08.00+0     doi:10.1128/JB.01249-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Conserved Histidine in Cytochrome c Maturation Permease CcmB of Shewanella putrefaciens Is Required for Anaerobic Growth below a Threshold Standard Redox Potential{triangledown} ,{dagger}

Jason R. Dale, Roy Wade Jr., and Thomas J. DiChristina*

School of Biology, Georgia Institute of Technology, Atlanta, Georgia 30332

Received 8 August 2006/ Accepted 19 November 2006


arrow
ABSTRACT
 
Shewanella putrefaciens strain 200 respires a wide range of compounds as terminal electron acceptor. The respiratory versatility of Shewanella is attributed in part to a set of c-type cytochromes with widely varying midpoint redox potentials (E'0). A point mutant of S. putrefaciens, originally designated Urr14 and here renamed CCMB1, was found to grow at wild-type rates on electron acceptors with high E'0 [O2, NO3, Fe(III) citrate, MnO2, and Mn(III) pyrophosphate] yet was severely impaired for growth on electron acceptors with low E'0 [NO2, U(VI), dimethyl sulfoxide, TMAO (trimethylamine N-oxide), fumarate, {gamma}-FeOOH, SO32–, and S2O32–]. Genetic complementation and nucleotide sequence analyses indicated that the CCMB1 respiratory mutant phenotype was due to mutation of a conserved histidine residue (H108Y) in a protein that displayed high homology to Escherichia coli CcmB, the permease subunit of an ABC transporter involved in cytochrome c maturation. Although CCMB1 retained the ability to grow on electron acceptors with high E'0, the cytochrome content of CCMB1 was <10% of that of the wild-type strain. Periplasmic extracts of CCMB1 contained slightly greater concentrations of the thiol functional group (-SH) than did the wild-type strain, an indication that the Eh of the CCMB1 periplasm was abnormally low. A ccmB deletion mutant was unable to respire anaerobically on any electron acceptor, yet retained aerobic respiratory capability. These results suggest that the mutation of a conserved histidine residue (H108) in CCMB1 alters the redox homeostasis of the periplasm during anaerobic growth on electron acceptors with low (but not high) E'0. This is the first report of the effects of Ccm deficiencies on bacterial respiration of electron acceptors whose E'0 nearly span the entire redox continuum.


arrow
INTRODUCTION
 
Cytochromes with covalently attached heme (c-type cytochromes) are often major components of anaerobic electron transport chains of prokaryotic microorganisms. c-type cytochromes displaying widely varying midpoint reduction potentials (E'0) may confer respiratory versatility on prokaryotes residing in redox-stratified environments (13, 15, 19). The genome of the metal-respiring gammaproteobacterium Shewanella oneidensis MR-1, for example, encodes 42 putative c-type cytochromes, several of which are involved in electron transfer to metals and other anaerobic electron acceptors with E'0 values virtually spanning the entire redox continuum encountered by microorganisms in the environment (26, 37, 46). The molecular mechanism of bacterial metal respiration, however, remains poorly understood.

In several metal-respiring bacteria, c-type cytochromes are involved in electron transport to oxidized forms of metals and radionuclides. In Geobacter sulfurreducens, outer membrane c-type cytochromes OmcB and OmcF are required for respiration on solid Fe(III) oxides, and diheme c-type cytochrome MacA is an intermediate electron carrier (7, 29, 35). Metal-respiring members of the genus Shewanella also require outer membrane c-type cytochromes OmcA and OmcB (MtrC) for respiration on U(VI) and solid Fe(III) or Mn(IV) oxides (3, 39, 44). c-type cytochromes involved in periplasmic electron transport in S. oneidensis include MtrA and CymA (41, 50). CymA oxidizes quinol and transfers electrons to downstream components of the electron transport pathway terminating with the reduction of Fe(III), NO3, NO2, fumarate, and dimethyl sulfoxide (DMSO) (41, 53, 54). A purified cytochrome c3-hydrogenase complex isolated from U(VI)-reducing Desulfovibrio vulgaris Hildenborough displays H2-U(VI) oxidoreductase activity in vitro (38). In addition, cytochrome c3 mutants of Desulfovibrio desulfuricans G20 are deficient in U(VI) reduction activity with H2 as electron donor (47, 48).

Bacteria, archaea, and the mitochondria and chloroplasts of eukarya require maturation systems to complete c-type cytochrome synthesis. Cytochrome c maturation (Ccm) systems attach heme groups to the CXXCH motifs of apocytochrome c via stereospecific thioether covalent bonds. Three Ccm systems are currently known (for recent reviews, see references 57 and 59). System I, found predominantly in alpha- and gammaproteobacteria, land plant and protozoan mitochondria, and some archaea, consists of eight dedicated components (CcmA to -H). System II, commonly found in gram-positive bacteria, cyanobacteria, beta- and deltaproteobacteria, plant and algal chloroplasts, and some archaea, includes the major components ResA to -C and CcdA. The third cytochrome c maturation system, system III, is restricted to fungal and animal mitochondria and consists of a single heme lyase component (CCHL).

Cytochrome c maturation system I is the most extensively studied cytochrome c maturation pathway. System I is organized into two branches that converge at heme lyase (CcmF): a heme delivery branch comprised of CcmA to -E and a thioredoxin branch that includes DsbD and CcmGH (59). The heme delivery branch transfers heme to apocytochrome c and includes ABC transporter subunits CcmABC, membrane protein CcmD, and heme chaperone CcmE. The thioredoxin branch transfers reducing equivalents to the periplasm and ensures that the thiol groups of apocytochrome c remain reduced for heme attachment. Maintenance of redox homeostasis in the periplasm is crucial for optimal Ccm activity (2, 8).

A random point mutant of S. putrefaciens strain 200 (originally designated Urr14 and here renamed CCMB1) was isolated by combining chemical mutagenesis (ethyl methanesulfonate) procedures with a rapid mutant screen designed to detect respiratory mutants deficient in U(VI) reduction activity (63). Subsequent anaerobic liquid growth experiments demonstrated that CCMB1 was unable to respire U(VI) or NO2 as an anaerobic electron acceptor, yet retained the ability to respire on O2, NO3, MnO2, and Fe(III) citrate. In the present study, CCMB1 was found to contain a mutation in a gene displaying high similarity to ccmB, encoding a permease involved in system I cytochrome c maturation in Escherichia coli (60, 61). A comparison of wild-type and CCMB1 growth rates, cytochrome content, and periplasmic free thiol content indicated that wild-type ccmB was required for growth on electron acceptors with low (but not high) E'0 and for maintaining periplasmic redox homeostasis.


arrow
MATERIALS AND METHODS
 
Growth media and cultivation conditions. A previously isolated rifamycin-resistant strain of Shewanella putrefaciens strain 200 (hereafter referred to as S. putrefaciens) was routinely cultured in the presence of 50 µg ml–1 rifamycin in either Luria broth or a defined salts growth medium (SM, pH 7.5) (14, 16, 42). Anaerobic growth experiments were carried out in 13-ml Hungate tubes (Bellco Glass, Inc.) containing 10 ml SM supplemented with sodium lactate (30 mM) and sealed with black butyl rubber stoppers under an N2 atmosphere. Electron acceptor stocks were added at the indicated final concentrations (electron acceptor stock solutions were prepared as previously described [14, 63], except where indicated): NO3, 20 mM; NO2, 2.0 mM; U(VI) carbonate, 1.0 mM (63); Fe(III) citrate, 50 mM; {gamma}-FeOOH (55), 40 mM; MnO2 (as colloidal MnO2), 10 mM (49); Mn(III) pyrophosphate, 10 mM (31); TMAO (trimethylamine N-oxide), 30 mM; SO32–, 10 mM; S2O32–, 10 mM; DMSO, 50 mM; fumarate, 35 mM. Aerobically grown cells were inoculated in batch cultures vigorously aerated with atmospheric gas. U(VI) growth experiments were carried out in SM with the headspace gas consisting of 10% H2, 5% CO2, and the balance N2. Control experiments consisted of incubating wild-type S. putrefaciens in SM liquid growth medium with electron acceptor omitted or with heat-killed cells as inoculum. Antibiotics were added from filter-sterilized stocks at the indicated concentrations: chloramphenicol, 25 µg ml–1, and tetracycline, 15 µg ml–1.

Genetic complementation and nucleotide sequence analyses. Standard genetic procedures were used in genetic complementation and subcloning experiments (52). A previously constructed clone library of partially digested HindIII chromosomal DNA fragments of the S. putrefaciens strain (harbored in broad-host-range cosmid pVK100 and maintained in Escherichia coli strain HB101) was mobilized into respiratory mutant CCMB1 following previously described triparental mating procedures that included helper strain E. coli HB101(pRK2013) (14). To identify CCMB1 transconjugates with restored U(VI) reduction activity, Rifr and Tetr transconjugate colonies were screened for a positive U(VI) reduction phenotype on SM agar growth medium supplemented with U(VI) carbonate (1 mM) (63). After screening of approximately 1,000 transconjugates, a CCMB1 transconjugate (designated CCMB1-D14) with restored U(VI) reduction ability was identified and subsequently confirmed for wild-type U(VI) reduction activity in liquid culture.

Transconjugate CCMB1-D14 was found to contain a 34-kb complementing cosmid (designated pD14; see Fig. S1 in the supplemental material for subcloning strategy). D14 contained two internal HindIII restriction sites resulting in three HindIII fragments (D14-1, D14-2, and D14-3), each of which was ligated into cosmid pVK100. The three resulting recombinant cosmids were electroporated into E. coli HB101, and the three corresponding transformants were mated triparentally with HB101(pRK2013) and CCMB1. Each CCMB1 transconjugate was tested for anaerobic growth in liquid culture with U(VI) as electron acceptor. CCMB1 transconjugates containing complementing subclone D14-2 were restored for U(VI) reduction activity. Complementing subclone D14-2 was sequenced (sixfold coverage) with an ABI 3700 automated sequencer. Initial sequencing primers complementary to the unique cloning site of cosmid pVK100 included pvkF (GAT CCT GGT ATC GGT CTG CGA TTC CGA CTC GTC) and pvkR (GTA CTC CTG ATG ATG CAT GGT TAC TCA CCA CTG CGA TCC). Overlapping internal regions of D14-2 (designated DC1 to -10) were PCR amplified and cloned into broad-host-range plasmid pBBR1MCS (32) for further genetic complementation analyses (Table 1 shows strains and plasmids; see Table S1 in the supplemental material for primers and restriction sites used for subcloning). The altered nucleotide in mutant CCMB1 was identified via PCR amplification of the CCMB1 chromosomal region that corresponded to complementing fragment DC9 of wild-type S. putrefaciens (primers were identical to those used to PCR amplify the DC9 region of wild-type S. putrefaciens). Nucleotide sequencing of the DC9 region of CCMB1 was carried out as described above.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Bacterial strains and plasmids used in the present study

In-frame deletion mutagenesis of ccmB. ccmB was deleted in frame from the S. putrefaciens chromosome according to recently described procedures (J. L. Burns and T. J. DiChristina, submitted for publication). Briefly, 700-bp fragments (CCMB-A and CCMB-B, see Table S1 in the supplemental material) flanking ccmB were PCR amplified with iProof high-fidelity polymerase (Bio-Rad Laboratories, Hercules, CA). CCMB-A and CCMB-B were fused by overlap extension PCR generating fragment CCMB-C. CCMB-C was cloned into pKO2.0 with BamHI and SpeI restriction endonucleases and electroporated into E. coli strain ß2155. pKO2.0-CCMB-C was mobilized into recipient 200R via biparental mating. A plasmid integrant was identified by PCR analysis, and the mutation was resolved on LB agar containing sucrose (10%). The in-frame deletion of ccmB in S. putrefaciens ({Delta}ccmB) was verified by PCR amplification with primers flanking the deletion (forward, CGCTTGTTATGATGAGTACCG, and reverse, CCTTGGTGGAGGCAGACTCAT) and DNA sequencing.

Analytical techniques. Cell growth was monitored by simultaneously measuring cell number and electron acceptor depletion or end product production. Acridine orange-stained cells were counted directly via epifluorescence microscopy (Nikon Diaphot 300 microscope). Fe(III) reduction was monitored by measuring HCl-extractable Fe(II) with the ferrozine technique (58). MnO2 reduction was monitored by measuring MnO2 depletion with the benzidine blue colorimetric assay (6). Mn(III) pyrophosphate depletion was monitored spectrophotometrically at 480 nm (31). U(VI) was measured colorimetrically with Arsenazo III reagent (33). NO2 was measured spectrophotometrically with sulfanilic acid-N-1-naphthylethylene-diamine dihydrochloride reagent (40). Growth on O2, TMAO, DMSO, fumarate, S2O32–, and SO32– was monitored by cell growth only. Free thiol equivalents (exposed thiol functional groups [-SH] free to react with Ellman's reagent) were determined with 5,5'-dithio-bis-2-nitrobenzoic acid (17) standardized with reduced glutathione per µg protein. Protein concentration was determined with the Coomassie Plus Bradford assay (Pierce Biotechnology) standardized with bovine serum albumin. Homologous and orthologous protein sequences were identified by BLAST analysis and aligned with ClustalW (1, 27). Membrane topology was predicted in silico with World Wide Web-interfaced software HMMTOP and TopPred2 (9).

Cytochrome detection. Wild-type and CCMB1 mutant cell cultures were grown on the array of electron acceptors in SM liquid medium supplemented with lactate (30 mM) as a carbon and energy source. Cells were harvested during late logarithmic growth phase and washed three times in anaerobic phosphate-buffered saline (130 mM NaCl, 50 mM sodium phosphate, pH 7.2, 4°C). Cell extracts were prepared as in previously described procedures (18). Briefly, cells were resuspended in cold extraction buffer (50 mM sodium phosphate, 2 mg/ml polymyxin B sulfate, 300 mM NaCl, 5 mM EDTA, pH 7.2, 4°C). The suspension was stirred gently for 1 h at 4°C and centrifuged (Beckman Coulter Optima L-100 XP Ultracentrifuge, 40,000 x g for 20 min at 4°C). Extracts from each sample were collected, and specific cytochrome content was determined by measuring dithionite-reduced-minus-ferricyanide-oxidized difference spectra on a Shimadzu UV-1601 spectrophotometer operated in the split-beam mode. Estimates of total cytochrome content were based on the difference between absorbance values at the peak and trough of the Soret peak standardized per mg total protein (10, 43). Protein fractions were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis on a linear gradient gel (4% to 20% resolving) with 200 µg/ml total protein loaded per well (34). Gels were stained for heme peroxidase activity by being incubated in a solution containing 3,3-dimethoxybenzidine-peroxide (1 µg ml–1) and H2O2 (30% stock solution, 0.0025 µl ml–1) (24).

Nucleotide sequence accession number. The nucleotide sequence of D14-2 has been submitted to the GenBank database under accession number DQ682922.


arrow
RESULTS
 
Genetic complementation analysis of S. putrefaciens respiratory mutant CCMB1. A transconjugate (designated CCMB1-D14) displaying wild-type U(VI) reduction activity was identified by reapplying the respiratory mutant screen that was originally used to identify U(VI) reduction-deficient mutant CCMB1 (Fig. 1) (63). Subsequent subcloning and anaerobic growth experiments demonstrated that only those subclones containing a wild-type copy of ccmB restored anaerobic growth capability to CCMB1 (see Fig. S1 in the supplemental material). The CCMB1 chromosomal region corresponding to the wild-type DC9 subclone was PCR amplified and sequenced with sixfold coverage. A single nucleotide transversion (H108Y) was identified in ccmB at amino acid position 108 (Fig. 2).


Figure 1
View larger version (121K):
[in this window]
[in a new window]

 
FIG. 1. U(VI) reduction screening plate from which complementing transconjugate CCMB1-pD14 (second colony from left in fourth row) was identified. Strains 200-pVK100 (colony in top row) and CCMB1-pVK100 (first colony from left in second row) were included as U(VI) reduction-positive and U(VI) reduction-negative control strains, respectively.


Figure 2
View larger version (87K):
[in this window]
[in a new window]

 
FIG. 2. CcmB amino acid sequence of S. putrefaciens (Sputr) aligned with E. coli (Ecoli), orthologous Ccb206 of Arabidopsis thaliana (Athal), Orf206 of Triticum aestivum (Taest), Orf277 of Marchantia polymorpha (Mpoly), and YejV of Cyanidioschyzon merolae (Cmero). Identical residues are highlighted. H108 of S. putrefaciens and corresponding identical residues are boxed. Predicted transmembrane domains in S. putrefaciens are indicated by bars above the sequence.

Sequence analysis of S. putrefaciens ccmB. ccmB is the second gene in a five-gene cluster that includes ccmA to -E (Table 2). The ccm gene cluster is conserved among all Shewanella species sequenced to date and, in S. putrefaciens and S. oneidensis MR-1, is flanked by divergently transcribed c-type cytochrome scyA and an operon encoding RNA polymerase subunits. Gene assignments are based on The Institute for Genomic Research's annotation of the MR-1 genome sequence (www.tigr.org) (26). The ccm gene cluster has been studied most extensively in E. coli, and the translated amino acid sequences from the ccmABCDE genes of S. putrefaciens share high similarity with these proteins (40 to 61% identity, 62 to 74% similarity; Table 2).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Sequence analysis of S. putrefaciens CcmABCDE gene cluster

Topology prediction analysis indicated that CcmB contains six transmembrane helices (Fig. 2). Based on similarity to previous results of C-terminal tagging analysis and prior topology models in E. coli, the N and C termini of CcmB in S. putrefaciens are both predicted to face the cytoplasm (11, 25). Residue H108 is predicted to reside at the interface of a cytoplasmic loop and the third transmembrane helix. Residue H108 of S. putrefaciens CcmB is highly conserved among alpha-, beta- and gammaproteobacteria (Fig. 2) and is one of six CcmB residues strictly conserved among several land plant mitochondrial orthologs such as those found in Marchantia polymorpha, Arabidopsis thaliana, Triticum aestivum, and Oenothera berteriana and in the red alga Cyanidioschyzon merolae (20).

Respiratory mutant CCMB1 retains the ability to respire on electron acceptors with high (but not low) reduction potentials (E'0). To determine the overall respiratory capability of CCMB1, anaerobic growth experiments were carried out on a set of 13 electron acceptors. CCMB1 retained the ability to grow at wild-type rates with O2, MnO2, Mn(III) pyrophosphate, NO3, and Fe(III) citrate, yet was severely impaired for growth on NO2, U(VI), DMSO, TMAO, fumarate, Fe(III) oxide, SO32–, or S2O32– as an electron acceptor (Fig. 3; see also Fig. S2 in the supplemental material). CCMB1 transconjugates containing plasmid pDC9 in trans displayed wild-type rates of growth and reduction of each electron acceptor (see Fig. S2 in the supplemental material). CCMB1 was unable to grow at wild-type rates on electron acceptors with E'0 values below a threshold value of approximately 0.36 V (NO2/NH4+ couple) (Fig. 4; see also Fig. S2 in the supplemental material). CCMB1 grew at wild-type rates on NO3 yet was unable to grow on NO2. After stoichiometric reduction of NO3 to NO2, growth of the wild-type strain continued on NO2 until all NO2 was depleted (see Fig. S2D in the supplemental material). CCMB1, on the other hand, was able to grow at wild-type rates on NO3 and to stoichiometrically convert NO3 to NO2 at a rate similar to that of the wild-type strain, yet was unable to sustain growth or deplete NO2 after all NO3 was reduced. CCMB1 cell density and NO2 concentrations remained unchanged after NO3 was completely reduced to NO2.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 3. Growth rate of CCMB1 on a set of 13 electron acceptors (rates normalized to the wild-type strain of S. putrefaciens). Wild-type growth rates are as indicated (h–1): O2, 1.39; MnO2, 0.71; Mn(III) pyrophosphate, 0.32; NO3, 0.38; Fe(III) citrate, 0.21; NO2, 0.23; DMSO, 0.87; TMAO, 0.36; fumarate, 0.91; U(VI), 0.04; SO32–, 0.18; {gamma}-FeOOH, 0.25; S2O32–, 0.14. See Fig. S1 in the supplemental material for individual growth curves. Error bars represent the standard deviations of three parallel yet independent incubations.


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 4. Reduction potential (E'0) of electron acceptors included in the present study. E'0 values were obtained from published values for the indicated couples at neutral pH. CCMB1 displayed wild-type growth rates on the set of electron acceptors that are boxed. DMS, dimethyl sulfide.

CCMB1 contains low c-type cytochrome content. CCMB1 retained the ability to grow anaerobically on electron acceptors with high E'0 [MnO2, Mn(III) pyrophosphate, NO3, and Fe(III) citrate]. To determine if CCMB1 produced c-type cytochromes at wild-type levels during growth on these electron acceptors, the cytochrome content of CCMB1 cell extracts was determined via reduced-minus-oxidized difference spectra and by staining SDS-polyacrylamide gels for covalently attached heme (Fig. 5; see also Table S2 in the supplemental material). For comparison, wild-type S. putrefaciens cells were grown and extracts were prepared under identical conditions. Prominent c-type cytochrome bands in the heme stain and pronounced reduced-minus-oxidized difference spectra at 552 nm were observed for wild-type cells grown on Fe(III) citrate and fumarate. The cytochrome content of CCMB1, however, was nearly undetectable for cells grown on any electron acceptor (Fig. 5). Wild-type levels of mature cytochrome c, therefore, do not appear essential for anaerobic growth on electron acceptors with high E'0.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 5. Analysis of cytochrome content of wild-type S. putrefaciens and respiratory mutant CCMB1. (A and B) SDS-polyacrylamide gel electrophoresis heme stains of periplasmic fractions of S. putrefaciens (A) and CCMB1 (B) cells grown on the indicated electron acceptors. Horse heart cytochrome c was included as a positive control. Molecular mass markers (daltons) are indicated with arrows. (C) Reduced-minus-oxidized difference spectra of cell extracts from S. putrefaciens (spectra 1 and 2) and CCMB1 (3 and 4) grown on Fe(III) citrate (1 and 3) and fumarate (2 and 4). The scale bar corresponds to absorbance units.

Thiol content of the CCMB1 periplasm is slightly greater than that of the wild-type strain. Previous studies with a variety of other proteobacteria containing ccm mutations indicated that periplasmic redox homeostasis was disrupted (2, 8). To determine if the periplasm of CCMB1 was more oxidizing or reducing than the wild-type strain, the thiol (-SH) content in periplasmic extracts of CCMB1 and wild-type S. putrefaciens cells was determined after growth on 13 alternate electron acceptors. The thiol content of periplasmic extracts from S. putrefaciens after growth on O2, NO3, NO2, TMAO, DMSO, Mn(III) pyrophosphate, and MnO2 ranged from 40 to 238 pmol µg protein–1 (Fig. 6). Although CCMB1 grew on NO2, TMAO, and DMSO at rates less than 25% of that of the wild-type strain, the periplasmic thiol concentration of CCMB1 grown on the identical set of electron acceptors was slightly greater than that of the wild-type strain (Fig. 6). Periplasmic fractions could not be recovered from CCMB1 cultures grown on U(VI), SO32–, {gamma}-FeOOH, or S2O32– as electron acceptor due to low growth rates (and correspondingly low cell yields) under these growth conditions (data not shown). Periplasmic extracts from the wild-type strain contained the highest thiol content after growth on {gamma}-FeOOH, SO32–, or S2O32– as electron acceptor, ranging from 682 to 1,130 pmol µg protein–1 (approximately 5 to 10 times greater than those of the other electron acceptors). Overall, the periplasmic extracts recovered from CCMB1 contained a slightly greater concentration of thiol groups than the wild-type strain did (Fig. 6).


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 6. Free thiol content of periplasmic fractions of S. putrefaciens and CCMB1 cells grown on the indicated electron acceptors. The box below the bar graph indicates CCMB1 growth ability on the electron acceptor (a). +, growth rate >80% of wild-type rate; –, growth rate <25% of wild-type rate.

The CcmB deletion mutant is incapable of anaerobic growth on any electron acceptor. An in-frame deletion mutant of ccmB ({Delta}ccmB) was constructed and subsequently tested for growth on the entire suite of 13 electron acceptors respired by the wild-type strain. The {Delta}ccmB strain was unable to grow anaerobically on any electron acceptor, yet retained the ability to grow aerobically (see Fig. S3 in the supplemental material). Transconjugates of the {Delta}ccmB strain, containing a wild-type copy of ccmB in trans, were restored for the ability to respire at wild-type rates on all electron acceptors (see Fig. S3 in the supplemental material).


arrow
DISCUSSION
 
The main objective of the present study was to identify the gene mutated in CCMB1, an S. putrefaciens respiratory mutant originally isolated for its inability to respire U(VI) as anaerobic electron acceptor. Subcloning and nucleotide sequence analyses indicate that CCMB1 contains an H108Y mutation in a protein similar to the CcmB permease subunit of an ABC transporter required for cytochrome c maturation in E. coli (system I). CcmABC works in concert with membrane protein CcmD and heme chaperone CcmE to transfer heme to apocytochrome c (59).

S. putrefaciens respiratory mutant CCMB1 grows on electron acceptors with E'0 values greater than a threshold level of approximately 0.36 V [O2, Fe(III) citrate, MnO2, Mn(III) pyrophosphate, and NO3]. This finding is unexpected for several reasons. First, anaerobic respiration by S. oneidensis on Fe(III) citrate, MnO2, and NO3 as electron acceptor involves several c-type cytochromes including CymA, MtrA, MtrC, and OmcA (3, 41, 44, 50). Second, ccmC mutants of S. oneidensis are unable to produce mature cytochrome c or grow anaerobically on U(VI), fumarate, TMAO, DMSO, Fe(III) citrate, MnO2, NO3, or NO2 as electron acceptor (4, 39). Several possibilities may explain these differences in the anaerobic growth capability of the Shewanella ccm mutants: (i) S. putrefaciens ccmB and S. oneidensis ccmC mutant genotypes display different respiratory deficiencies, (ii) S. putrefaciens contains cytochrome c-independent respiratory pathways, or (iii) replacement of the histidine residue at position 108 with tyrosine permits limited, but sufficient, CcmB activity to sustain growth of CCMB1 on electron acceptors with high E'0. Results from the present study favor the third possibility. The {Delta}ccmB deletion mutant does not respire anaerobically on any electron acceptor, indicating that anaerobic electron transport pathways in S. putrefaciens require mature c-type cytochromes. Point mutant CCMB1, on the other hand, retains growth on anaerobic electron acceptors with an E'0 of >0.36 V, despite lacking the ability to produce c-type cytochromes at detectable levels. These findings suggest that the H108Y CcmB mutant may retain partial Ccm activity and produce low levels of mature cytochrome c that are adequate to sustain wild-type growth rates on electron acceptors above a threshold E'0.

Mutations in ccmA, ccmB, or ccmC in other bacteria often result in mutant phenotypes not associated with cytochrome c activity. Legionella pneumophila CcmB and CcmC mutants, for example, display defective iron acquisition capability and aberrant virulence phenotypes (8, 45, 62). Pseudomonas fluorescens CcmC mutants are unable to complete synthesis of the siderophore pyoverdine (2). CcmC mutants of Pantoea citrea, Gluconacetobacter diazotrophicus, and Pseudomonas putida are unable to oxidize gluconate and 2-ketogluconate, synthesize indole-3-acetic acid, or isomerize (cis-trans) unsaturated fatty acids, respectively (28, 36, 51). The seemingly unrelated Ccm mutant phenotypes are postulated to reflect improper redox homeostasis in the periplasm (2, 8).

To determine if CcmB plays a similar role in maintaining periplasmic redox homeostasis in S. putrefaciens, CCMB1 and wild-type S. putrefaciens were grown on the suite of 13 electron acceptors and free thiol content was determined in the corresponding periplasmic fractions. The wild-type strain contained approximately 100 pmol µg protein–1 free thiol after growth on O2, NO3, Mn(III) pyrophosphate, and Mn(IV). Free thiol content was approximately two to three times greater after growth on NO2, TMAO, DMSO, Fe(III) citrate, and fumarate and approximately 10 times greater after growth on {gamma}-FeOOH, SO32–, and S2O32–. The pattern of free thiol content in the wild-type strain reflects the ability of CCMB1 to grow on electron acceptors with an E'0 of >0.36 V (NO3/NO2 threshold). Periplasmic redox conditions corresponding to a free thiol content of >300 pmol µg protein–1 require wild-type CcmB activity to sustain growth. These results parallel those obtained with P. fluorescens ccmC mutants that are unable to complete pyoverdine biosynthesis (2). The periplasm of the P. fluorescens mutant strain was abnormally reducing and contained high free thiol content.

Increased free thiol in the periplasm of CCMB1 after growth on electron acceptors with low E'0 may result from several factors. First, the low redox poise associated with growth of CCMB1 on electron acceptors with low E'0 may result in inadvertent reduction of disulfide bonds that otherwise remain unaltered in the wild-type strain. In contrast, the redox poise associated with growth of CCMB1 on electron acceptors with high E'0 does not dramatically alter disulfide bond formation. Second, increased periplasmic free thiol content in CCMB1 may reflect an overabundance of periplasmic apocytochrome c (i.e., immature cytochrome c with CXXCH heme binding motifs not bound by heme). Finally, CcmABC may mediate periplasmic redox homeostasis via an as-yet-unknown mechanism (2, 8).

The present study is the first to identify an amino acid residue critical for CcmB function. Residue H108 is conserved in >88% of the 185 bacterial and land plant mitochondrial CcmB orthologs currently available in the nonredundant database. Residue H108 may therefore play a pivotal role in CcmB activity. Membrane protein topology prediction in S. putrefaciens indicates that residue H108 is found at the interface of a hydrophobic transmembrane helix and a hydrophilic cytoplasmic loop, well situated for controlling CcmB complex formation with other Ccm subunits or for allocrite recognition and subsequent transport across the cytoplasmic membrane. The identity of the CcmB allocrite in E. coli, however, remains controversial. Initial studies of E. coli indicate that heme is the CcmB allocrite and that CcmABC functions as a high-affinity heme transporter (21, 22). More recent results suggest that E. coli CcmABC drives the release of holo-CcmE (CcmE with covalently attached heme) from CcmC by coupling the release with ATP hydrolysis (22). Current work is aimed at identifying the CcmABC allocrite and determining the role that H108 plays in cytochrome c maturation in S. putrefaciens.


arrow
ACKNOWLEDGMENTS
 
Financial support for this work was provided by the Department of Energy and the National Science Foundation.

We thank Alana Reed, Amanda Payne, David Bates, and Justin Burns for laboratory assistance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: School of Biology, Georgia Institute of Technology, 310 Ferst Drive, Atlanta, GA 30332-0230. Phone: (404) 894-8419. Fax: (404) 385-4440. E-mail: thomas.dichristina{at}biology.gatech.edu. Back

{triangledown} Published ahead of print on 1 December 2006. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Altschul, S., T. Madden, A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. 2
  3. Baysse, C., H. Budzikiewicz, D. Fernandez, and P. Cornelis. 2002. Impaired maturation of the siderophore pyoverdine chromophore in Pseudomonas fluorescens ATCC 17400 deficient for the cytochrome c biogenesis protein CcmC. FEBS Lett. 523:23-28.[CrossRef][Medline]
  4. 3
  5. Beliaev, A., D. Saffarini, J. McLaughlin, and D. Hunnicutt. 2001. MtrC, an outer membrane decahaem c cytochrome required for metal reduction in Shewanella putrefaciens MR-1. Mol. Microbiol. 39:722-730.[CrossRef][Medline]
  6. 4
  7. Bouhenni, R., A. Gehrke, and D. Saffarini. 2005. Identification of genes involved in cytochrome c biogenesis in Shewanella oneidensis using a modified mariner transposon. Appl. Environ. Microbiol. 71:4935-4937.[Abstract/Free Full Text]
  8. 5
  9. Boyer, H., and D. Roulland. 1969. A complementation analysis of restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-463.[CrossRef][Medline]
  10. 6
  11. Burnes, B. S., M. J. Mulberry, and T. J. DiChristina. 1998. Design and application of two rapid screening techniques for isolation of Mn(IV) reduction-deficient mutants of Shewanella putrefaciens. Appl. Environ. Microbiol. 64:2716-2720.[Abstract/Free Full Text]
  12. 7
  13. Butler, J., F. Kaufmann, M. Coppi, C. Nunez, and D. Lovley. 2004. MacA, a diheme c-type cytochrorne involved in Fe(III) reduction by Geobacter sulfurreducens. J. Bacteriol. 186:4042-4045.[Abstract/Free Full Text]
  14. 8
  15. Cianciotto, N., P. Cornelis, and C. Baysse. 2005. Impact of the bacterial type I cytochrome c maturation system on different biological processes. Mol. Microbiol. 56:1408-1415.[Medline]
  16. 9
  17. Claros, M. G., and G. von Heijne. 1994. TopPred II: an improved software for membrane protein structure predictions. Comput. Appl. Biosci. 10:685-686.[Free Full Text]
  18. 10
  19. Collins, M. L. P., and R. A. Niederman. 1976. Membranes of Rhodospirillum rubrum: isolation and physiochemical properties of membranes from aerobically grown cells. J. Bacteriol. 126:1316-1325.[Abstract/Free Full Text]
  20. 11
  21. Daley, D., M. Rapp, E. Granseth, K. Melen, D. Drew, and G. von Heijne. 2005. Global topology analysis of the Escherichia coli inner membrane proteome. Science 308:1321-1323.[Abstract/Free Full Text]
  22. 12
  23. Dehio, C., and M. Meyer. 1997. Maintenance of broad-host-range incompatibility group P and group Q. plasmids and transposition of Tn5 in Bartonella henselae following conjugal plasmid transfer from Escherichia coli. J. Bacteriol. 179:538-540.[Abstract/Free Full Text]
  24. 13
  25. DiChristina, T. J., D. J. Bates, J. L. Burns, J. R. Dale, and A. N. Payne. 2006. Shewanella: novel strategies for anaerobic respiration, p. 443-469. In L. Neretin (ed.), Past and present water column anoxia, 1st ed., vol. 64. Springer-Verlag, Berlin, Germany.
  26. 14
  27. DiChristina, T. J., and E. F. DeLong. 1994. Isolation of anaerobic respiratory mutants of Shewanella putrefaciens and genetic analysis of mutants deficient in anaerobic growth on Fe3+. J. Bacteriol. 176:1468-1474.[Abstract/Free Full Text]
  28. 15
  29. DiChristina, T. J., J. K. Fredrickson, and J. M. Zachara. 2005. Enzymology of electron transport: energy generation with geochemical consequences. Rev. Mol. Geomicrobiol. 59:27-52.
  30. 16
  31. DiChristina, T. J., C. M. Moore, and C. A. Haller. 2002. Dissimilatory Fe(III) and Mn(IV) reduction by Shewanella putrefaciens requires ferE, a homolog of the pulE (gspE) type II protein secretion gene. J. Bacteriol. 184:142-151.[Abstract/Free Full Text]
  32. 17
  33. Ellman, G. 1959. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82:70-77.[CrossRef][Medline]
  34. 18
  35. Enggist, E., and L. Thony-Meyer. 2003. The C-terminal flexible domain of the heme chaperone CcmE is important but not essential for its function. J. Bacteriol. 185:3821-3827.[Abstract/Free Full Text]
  36. 19
  37. Esteve-Núñez, A., C. Núñez, and D. R. Lovley. 2004. Preferential reduction of Fe(III) over fumarate by Geobacter sulfurreducens. J. Bacteriol. 186:2897-2899.[Abstract/Free Full Text]
  38. 20
  39. Faivre-Nitschke, S., P. Nazoa, J. Gualberto, J. Grienenberger, and G. Bonnard. 2001. Wheat mitochondria ccmB encodes the membrane domain of a putative ABC transporter involved in cytochrome c biogenesis. Biochim. Biophys. Acta 1519:199-208.[Medline]
  40. 21
  41. Feissner, R. E., C. L. Richard-Fogal, E. R. Frawley, J. A. Loughman, K. W. Earley, and R. G. Kranz. 2006. Recombinant cytochromes c biogenesis systems I and II and analysis of haem delivery pathways in Escherichia coli. Mol. Microbiol. 60:563-577.[CrossRef][Medline]
  42. 22
  43. Feissner, R. E., C. L. Richard-Fogal, E. R. Frawley, and R. G. Kranz. 2006. ABC transporter-mediated release of a haem chaperone allows cytochrome c biogenesis. Mol. Microbiol. 61:219-231.[CrossRef][Medline]
  44. 23
  45. Figurski, D., and D. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652.[Abstract/Free Full Text]
  46. 24
  47. Francis, R. T., Jr., and R. R. Becker. 1984. Specific indication of hemoproteins in polyacrylamide gels using a double-staining process. Anal. Biochem. 136:509-514.[CrossRef][Medline]
  48. 25
  49. Goldman, B., D. Beck, E. Monika, and R. Kranz. 1998. Transmembrane heme delivery systems. Proc. Natl. Acad. Sci. USA 95:5003-5008.[Abstract/Free Full Text]
  50. 26
  51. Heidelberg, J., I. Paulsen, K. Nelson, E. Gaidos, W. Nelson, T. Read, J. Eisen, et al. 2002. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis. Nat. Biotechnol. 20:1118-1123.[CrossRef][Medline]
  52. 27
  53. Higgins, D., J. Thompson, and T. Gibson. 1996. Using CLUSTAL for multiple sequence alignments. Comput. Methods Macromol. Seq. Anal. 266:383-402.[CrossRef]
  54. 28
  55. Holtwick, R., H. Keweloh, and F. Meinhardt. 1999. cis/trans isomerase of unsaturated fatty acids of Pseudomonas putida P8: evidence for a heme protein of the cytochrome c type. Appl. Environ. Microbiol. 65:2644-2649.[Abstract/Free Full Text]
  56. 29
  57. Kim, B., C. Leang, Y. Ding, R. Glaven, M. Coppi, and D. Lovley. 2005. OmcF, a putative c-type monoheme outer membrane cytochrome required for the expression of other outer membrane cytochromes in Geobacter sulfurreducens. J. Bacteriol. 187:4505-4513.[Abstract/Free Full Text]
  58. 30
  59. Knauf, V., and E. Nester. 1982. Wide host range cloning vectors; a cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8:45-54.[CrossRef][Medline]
  60. 31
  61. Kostka, J. E., G. W. Luther, and K. H. Nealson. 1995. Chemical and biological reduction of Mn(III)-pyrophosphate complexes: potential importance of dissolved Mn(III) as an environmental oxidant. Geochim. Cosmochim. Acta 59:885-894.
  62. 32
  63. Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop II, and K. M. Peterson. 1994. pBBR1MCS: a broad-host-range cloning vector. BioTechniques 16:800-802.[Medline]
  64. 33
  65. Kressin, I. 1984. Spectrophotometric method for the determination of uranium in urine. Anal. Chem. 56:2269-2271.[Medline]
  66. 34
  67. Laemmli, U. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  68. 35
  69. Leang, C., M. Coppi, and D. Lovley. 2003. OmcB, a c-type polyheme cytochrome involved in Fe(III) reduction in Geobacter sulfurreducens. J. Bacteriol. 185:2096-2103.[Abstract/Free Full Text]
  70. 36
  71. Lee, S., M. Flores-Encarnacion, M. Contreras-Zentella, L. Garcia-Flores, J. E. Escamilla, and C. Kennedy. 2004. Indole-3-acetic acid biosynthesis is deficient in Gluconacetobacter diazotrophicus strains with mutations in cytochrome c biogenesis genes. J. Bacteriol. 186:5384-5391.[Abstract/Free Full Text]
  72. 37
  73. Lovley, D., and J. Coates. 2000. Novel forms of anaerobic respiration of environmental relevance. Curr. Opin. Microbiol. 3:252-256.[CrossRef][Medline]
  74. 38
  75. Lovley, D., P. Widman, J. Woodward, and E. Phillips. 1993. Reduction of uranium by cytochrome c3 of Desulfovibrio vulgaris. Appl. Environ. Microbiol. 59:3572-3576.[Medline]
  76. 39
  77. Marshall, M. J., A. S. Beliaev, A. C. Dohnalkova, D. W. Kennedy, L. Shi, Z. M. Wang, M. I. Boyanov, B. Lai, K. M. Kemner, J. S. McLean, S. B. Reed, D. E. Culley, V. L. Bailey, C. J. Simonson, D. A. Saffarini, M. F. Romine, J. M. Zachara, and J. K. Fredrickson. 2006. c-type cytochrome-dependent formation of U(IV) nanoparticles by Shewanella oneidensis. PLoS Biol. 4:1324-1333.
  78. 40
  79. Montgomery, H. A. C., and J. F. Dymock. 1961. The determination of nitrite in water. Analyst 86:414-416.
  80. 41
  81. Myers, C., and J. Myers. 1997. Cloning and sequence of cymA, a gene encoding a tetraheme cytochrome c required for reduction of iron(III), fumarate, and nitrate by Shewanella putrefaciens MR-1. J. Bacteriol. 179:1143-1152.[Abstract/Free Full Text]
  82. 42
  83. Myers, C. R., and K. H. Nealson. 1988. Bacterial manganese reduction and growth with manganese oxide as the sole terminal electron acceptor. Science 240:1319-1321.[Abstract/Free Full Text]
  84. 43
  85. Myers, C. R., and J. M. Myers. 1992. Localization of cytochromes to the outer membrane of anaerobically grown Shewanella putrefaciens MR-1. J. Bacteriol. 174:3429-3438.[Abstract/Free Full Text]
  86. 44
  87. Myers, J., and C. Myers. 2001. Role for outer membrane cytochromes OmcA and OmcB of Shewanella putrefaciens MR-1 in reduction of manganese dioxide. Appl. Environ. Microbiol. 67:260-269.[Abstract/Free Full Text]
  88. 45
  89. Naylor, J., and N. Cianciotto. 2004. Cytochrome c maturation proteins are critical for in vivo growth of Legionella pneumophila. FEMS Microbiol. Lett. 241:249-256.[CrossRef][Medline]
  90. 46
  91. Nealson, K., and D. Saffarini. 1994. Iron and manganese in anaerobic respiration; environmental significance, physiology and regulation. Annu. Rev. Microbiol. 48:311-343.[CrossRef][Medline]
  92. 47
  93. Payne, R., L. Casalot, T. Rivere, J. Terry, L. Larsen, B. Giles, and J. Wall. 2004. Interaction between uranium and the cytochrome c3 of Desulfovibrio desulfuricans strain G20. Arch. Microbiol. 181:398-406.[CrossRef][Medline]
  94. 48
  95. Payne, R., D. Gentry, B. Rapp-Giles, L. Casalot, and J. Wall. 2002. Uranium reduction by Desulfovibrio desulfuricans strain G20 and a cytochrome c3 mutant. Appl. Environ. Microbiol. 68:3129-3132.[Abstract/Free Full Text]
  96. 49
  97. Perez-Benito, J. F., and E. Brillas. 1989. Identification of a soluble form of colloidal manganese(IV). Inorg. Chem. 28:390-392.[CrossRef]
  98. 50
  99. Pitts, K., P. Dobbin, F. Reyes-Ramirez, A. Thomson, D. Richardson, and H. Seward. 2003. Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA. J. Biol. Chem. 278:27758-27765.[Abstract/Free Full Text]
  100. 51
  101. Pujol, C. J., and C. I. Kado. 2000. Genetic and biochemical characterization of the pathway in Pantoea citrea leading to pink disease of pineapple. J. Bacteriol. 182:2230-2237.[Abstract/Free Full Text]
  102. 52
  103. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  104. 53
  105. Schwalb, C., S. Chapman, and G. Reid. 2002. The membrane-bound tetrahaem c-type cytochrome CymA interacts directly with the soluble fumarate reductase in Shewanella. Biochem. Soc. Trans. 30:658-662.[CrossRef][Medline]
  106. 54
  107. Schwalb, C., S. Chapman, and G. Reid. 2003. The tetraheme cytochrome CymA is required for anaerobic respiration with dimethyl sulfoxide and nitrite in Shewanella oneidensis. Biochem US 42:9491-9497.
  108. 55
  109. Schwertmann, U., and R. M. Cornell. 2000. Iron oxides in the laboratory; preparation and characterization, 2nd ed. Wiley-VCH, New York, NY.
  110. 56
  111. Simon, R., U. Priefer, and A. Puhler. 1983. A broad-host-range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-791.[CrossRef]
  112. 57
  113. Stevens, J. M., O. Daltrop, J. W. Allen, and S. J. Ferguson. 2004. C-type cytochrome formation: chemical and biological enigmas. Acc. Chem. Res. 37:999-1007.[CrossRef][Medline]
  114. 58
  115. Stookey, L. L. 1970. Ferrozine: a new spectrophotometric reagent for iron. Anal. Chem. 42:779-782.[CrossRef]
  116. 59
  117. Thony-Meyer, L. 2002. Cytochrome c maturation: a complex pathway for a simple task? Biochem. Soc. Trans. 30:633-638.[CrossRef][Medline]
  118. 60
  119. Thöny-Meyer, L., F. Fischer, P. Kunzler, D. Ritz, and H. Hennecke. 1995. Escherichia coli genes required for cytochrome c maturation. J. Bacteriol. 177:4321-4326.[Abstract/Free Full Text]
  120. 61
  121. Throne-Holst, M., L. Thony-Meyer, and L. Hederstedt. 1997. Escherichia coli ccm in-frame deletion mutants can produce periplasmic cytochrome b but not cytochrome c. FEBS Lett. 410:351-355.[CrossRef][Medline]
  122. 62
  123. Viswanathan, V., S. Kurtz, L. Pedersen, Y. Abu Kwaik, K. Krcmarik, S. Mody, and N. Cianciotto. 2002. The cytochrome c maturation locus of Legionella pneumophila promotes iron assimilation and intracellular infection and contains a strain-specific insertion sequence element. Infect. Immun. 70:1842-1852.[Abstract/Free Full Text]
  124. 63
  125. Wade, R., and T. J. DiChristina. 2000. Isolation of U(VI) reduction-deficient mutants of Shewanella putrefaciens. FEMS Microbiol. Lett. 184:143-148.[CrossRef][Medline]


Journal of Bacteriology, February 2007, p. 1036-1043, Vol. 189, No. 3
0021-9193/07/$08.00+0     doi:10.1128/JB.01249-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dale, J. R.
Right arrow Articles by DiChristina, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dale, J. R.
Right arrow Articles by DiChristina, T. J.