JB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JB.01216-06v1
189/4/1254    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Llácer, J. L.
Right arrow Articles by Rubio, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Llácer, J. L.
Right arrow Articles by Rubio, V.
Journal of Bacteriology, February 2007, p. 1254-1265, Vol. 189, No. 4
0021-9193/07/$08.00+0     doi:10.1128/JB.01216-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The Gene Cluster for Agmatine Catabolism of Enterococcus faecalis: Study of Recombinant Putrescine Transcarbamylase and Agmatine Deiminase and a Snapshot of Agmatine Deiminase Catalyzing Its Reaction{triangledown}

José L. Llácer,{dagger} Luis Mariano Polo,{dagger} Sandra Tavárez,{dagger} Benito Alarcón, Rebeca Hilario, and Vicente Rubio*

Instituto de Biomedicina de Valencia (IBV-CSIC), C/Jaime Roig 11, 46010 Valencia, Spain

Received 3 August 2006/ Accepted 29 November 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Enterococcus faecalis makes ATP from agmatine in three steps catalyzed by agmatine deiminase (AgDI), putrescine transcarbamylase (PTC), and carbamate kinase (CK). An antiporter exchanges putrescine for agmatine. We have cloned the E. faecalis ef0732 and ef0734 genes of the reported gene cluster for agmatine catabolism, overexpressed them in Escherichia coli, purified the products, characterized them functionally as PTC and AgDI, and crystallized and X-ray diffracted them. The 1.65-Å-resolution structure of AgDI forming a covalent adduct with an agmatine-derived amidine reactional intermediate is described. We provide definitive identification of the gene cluster for agmatine catabolism and confirm that ornithine is a genuine but poor PTC substrate, suggesting that PTC (found here to be trimeric) evolved from ornithine transcarbamylase. N-(Phosphonoacetyl)-putrescine was prepared and shown to strongly (Ki = 10 nM) and selectively inhibit PTC and to improve PTC crystallization. We find that E. faecalis AgDI, which is committed to ATP generation, closely resembles the AgDIs involved in making polyamines, suggesting the recruitment of a polyamine-synthesizing AgDI into the AgDI pathway. The arginine deiminase (ADI) pathway of arginine catabolism probably supplied the genes for PTC and CK but not those for the agmatine/putrescine antiporter, and thus the AgDI and ADI pathways are not related by a single "en bloc" duplication event. The AgDI crystal structure reveals a tetramer with a five-blade propeller subunit fold, proves that AgDI closely resembles ADI despite a lack of sequence identity, and explains substrate affinity, selectivity, and Cys357-mediated-covalent catalysis. A three-tongued agmatine-triggered gating opens or blocks access to the active center.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In addition to the fermentation of carbohydrates, Enterococcus faecalis (formerly Streptococcus faecalis) is able to use arginine and its decarboxylated derivative agmatine as energy sources for growth (8, 10, 45, 48, 49). Arginine and agmatine are metabolized via the arginine deiminase (ADI) and agmatine deiminase (AgDI) pathways, respectively. The two metabolic routes are very similar and include the sequential action of three enzymes (48, 49) and one antiporter (11), which are analogous in the two pathways. Arginine and agmatine are deiminated by ADI (EC 3.5.3.6) and AgDI (EC 3.5.3.12), respectively, yielding citrulline and carbamoyl putrescine, which are phosphorolyzed by ornithine transcarbamylase (OTC) (EC 2.1.3.3) and putrescine transcarbamylase (PTC) (EC 2.1.3.6). This generates carbamoyl phosphate for use in ADP phosphorylation by pathway-specific carbamate kinase (CK) (EC 2.7.2.2) isozymes, producing one ATP molecule (48, 49). The resulting ornithine and putrescine are exchanged with external arginine or agmatine by an arginine/ornithine antiporter in one pathway and by an agmatine/putrescine antiporter in the other pathway (11).

Possibly no microbial species has been more important for the biochemical characterization of the ADI and AgDI pathways than E. faecalis. It was with this microorganism that both pathways were originally demonstrated (20, 24, 45, 50), the corresponding enzymatic steps were characterized and shown to be coordinately induced by arginine or agmatine (48, 49), the enzymes (except AgDI) were purified (31, 32, 42, 56), and CK (the ADI pathway isozyme) was crystallized and its structure determined at atomic resolution (29, 30). Despite the abundance of biochemical information, there was little genetic information on these routes in E. faecalis until we sequenced the genes and determined the gene structure, organization, and some regulatory features for the components of the ADI pathway (3). However, in the case of the AgDI pathway, for very long time there was no other genetic information than the observation that three mutant strains of E. faecalis that were unable to use agmatine were devoid of either AgDI activity, PTC activity, or both (48). The loss of the two enzymes in one mutant and the triggering by agmatine of coordinated increases in the levels of AgDI and PTC appeared to be consistent with the physical association of the genes for these two enzymes within the same operon, as is the case for the genes for the ADI pathway (3, 48, 49). Only recently, after the identification in Pseudomonas aeruginosa of the gene aguA (38), encoding the AgDI that is involved in putrescine and polyamine biosynthesis in plants and microorganisms that decarboxylate arginine (2) (not the case for E. faecalis), a putative aguA gene was identified in the cariogenic organism Streptococcus mutans (17) and, by sequence similarity, in E. faecalis (gene ef0734 of E. faecalis V583 genome [TIGR database; http://www.tigr.org]). In both species this gene is preceded by the genes for a putative antiporter and for a transcarbamylase (in E. faecalis V583, genes ef0733 and ef0732, respectively) and is followed by a putative gene for carbamate kinase (ef0735) (Fig. 1A). Thus, this gene cluster would contain the genes for all the catalysts required for operation of the AgDI pathway, and indeed, a polar disruption of the first gene in this cluster of S. mutans strongly decreased the AgDI activity measured in permeabilized cells, as expected for the AgDI operon (17). Further, the amino acid sequence predicted to be encoded by ef0732 coincides with the N-terminal sequence reported long ago for E. faecalis PTC (39, 54).


Figure 1
View larger version (78K):
[in this window]
[in a new window]

 
FIG. 1. Agmatine catabolism gene cluster and purification and crystallization of PTC and AgDI. (A) Gene organization of the two strands of the sequenced region, showing the number of amino acid (aa) residues expected for each gene product and the length (in base pairs) of the intergenic regions. Genes are given the identifiers of the TIGR database, together with the agc designations given to them here. The positions of the three predicted stem-loops are indicated by the open circles, and a putative cre box preceding agcB is indicated with a gray rectangle. The gene in the opposite strand corresponds to a luxR regulator. (B and C) SDS-PAGE and Coomassie blue staining analyses of the various steps of the purifications of PTC and AgDI. The crude extracts are the postsonication supernatants. Panel B also includes a blank extract of E. coli BL21 cells transformed with the parental pET-22 plasmid carrying no gene insert, to highlight the differences from the extracts of cells transformed with the plasmids carrying the gene for PTC or for AgDI. Molecular mass marker proteins were from Sigma (Dalton Mark VII-L). Results of enzyme activity assays for PTC and AgDI are shown below the purification steps at which the activities were assayed. The activities obtained when putrescine was replaced by 10 mM ornithine (for OTC) or when agmatine was replaced by 5 mM arginine (for ADI) are also shown. Values of <0.1 or <0.2 are below the detection limits for assays giving no activity. (D) Crystals of both enzymes that were obtained and used for diffraction studies. Bars, 0.1 mm.

 
Nevertheless, the ultimate test for attributing specific functions to genes, i.e., the cloning of the gene, its expression, and the purification and functional characterization of the corresponding gene product, has not been published for the genes for the AgDI pathway. As a consequence of an independent effort to identify and characterize the AgDI pathway genes, we describe here the cloning of the E. faecalis ef0732 and ef0734 genes, their overexpression in Escherichia coli, the purification of the corresponding protein products, the enzymatic characterization of these products as PTC and AgDI, and their crystallization and X-ray analysis. We also report the crystal structure at high resolution of E. faecalis AgDI containing a covalently bound derivative of agmatine at the active center. Our results not only confirm conclusively the nature of the operon but also are the first that functionally characterize an AgDI committed to fermentative ATP production (all previously well characterized examples are involved in polyamine biosynthesis, and only one is bacterial, from Pseudomonas aeruginosa [23, 37, 59]), revealing also the structure of this enzyme during catalysis. For the other gene product studied here, PTC, which was previously characterized from a single source (E. faecalis) (56), we demonstrate that the bisubstrate analog for this enzyme, N-(phosphonoacetyl)-putrescine (PAPU), is a highly selective and very powerful PTC competitive inhibitor (Ki = 10 nM) relative to carbamoyl phosphate, clarifying the substrate binding order in this enzyme. This inhibitor is proven here to be crucial for obtaining good diffracting crystals of PTC, opening the way for crystal structure determination and for clarification of the structural bases for PTC specificity for putrescine. The finding of clear structural similarities between the ADI and AgDI folds indicates that these enzymes, which do not exhibit significant sequence similarity, are homologous. On the basis of this finding, we propose a potential mechanism for the evolutionary relationships between the ADI and AgDI operons.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial growth and characteristics. E. faecalis SD10 was grown overnight at 37°C, without shaking, in medium A (49) supplemented with 25 mM glucose. This strain is highly similar to E. faecalis V583 as judged from previous studies on the ADI operon (3) and also from the comparison of the sequences determined here for genes ef0732 and ef0734, which have revealed, of a total of 2,130 bases, only nine base differences relative to the corresponding sequence of the E. faecalis V583 genome, with only one of them causing an amino acid change (ef0734, H325R). Genomic DNA was isolated according to a standard procedure for bacteria (57).

Cloning and expression in E. coli of ef0732 and ef0734. ef0732 and ef0734 were PCR amplified from genomic DNA from E. faecalis SD10 by utilizing a high-fidelity thermostable DNA polymerase (Deep Vent; New England Biolabs) and the primer pairs 5'689512AGGAGGAACACCATATGAAAAGAGATTAC689540and 5'690565AATCAGTGGAAGCTTGGCCGTTAAATGC690538(for ef0732) and 5'691969GAACGAAAGCATATGGCTAAACGAATTG691996and 5'693106ATCACTATTTTTGAATTCTGTTTCCCTCC693078(for ef0734), where the first primer in each pair corresponds to the coding strand and the second to the complementary strand, the superscript numbers are the coordinates in the TIGR database for the E. faecalis genome, underlining indicates mutated bases, and boldface identifies nucleotides belonging to the open reading frame to be amplified. These primers were designed to introduce an NdeI site at the initiator ATG codon and HindIII and EcoRI sites 6 or 11 nucleotides downstream of the stop codon of ef0732 or ef0734, respectively. The PCR products, digested with NdeI-HindIII or NdeI-EcoRI, were inserted directionally in the corresponding sites of plasmid pET-22b behind the promoter recognized by T7 DNA polymerase. The resulting plasmids, isolated from transformed E. coli DH5{alpha} cells grown in Luria-Bertani (LB) medium containing 0.1 mg ml–1 of ampicillin, were mutated at the translation termination codon by using the QuikChange site-directed mutagenesis kit (from Stratagene) and the oligonucleotide pair 5'CAAAGCATTTCAGCGGCCAAGCTTG3' and 5'CTTGGCCGCTGAAATGCTTTGAGTG3' for ef0732, to replace the translation termination codon by serine and to introduce an extra G after this mutated codon, and the pair 5'GAACCAAAGCGCGTAGGAGGGAAACAGAATTCG3'and 5'CTGTTTCCCTCCTACGCGCTTTGGTTCTTGTTG3'for ef0734, to introduce a G before the translation termination codon. These mutations abolish termination at the normal stop codon and place in frame the plasmid sequence for incorporating at the cloned protein C terminus a linker and a His6 sequence. In this way, the ef0732 and ef0734 gene products include, respectively, the 16- and 24-amino acid C-terminal extensions SAAKLAAALEH6 and VGGKQNSSSVDKLAAALEH6. The mutant plasmids, isolated from transformed DH5{alpha} cells and confirmed by sequencing to carry the correct constructions, were used to transform E. coli BL21(DE3) cells. After growth of the cells at 37°C (ef0732) or 30°C (ef0734) in liquid LB medium supplemented with 0.1 mg ml–1 of ampicillin until a turbidity at 600 nm of 0.6 to 0.7 was attained, 0.1 mM isopropyl ß-D-thiogalactopyranoside (IPTG) was added, and the culture was continued for 3 to 4.5 additional hours before the cells were harvested by centrifugation. All subsequent purification steps were carried out at 0 to 4°C.

Purification of the product of the cloned ef0732 gene. The cells were suspended in 1/100 of the original culture volume of 20 mM K-phosphate, pH 7.4, containing 10 mM putrescine and 20 mM imidazole; they were then broken by sonication (four pulses of 30 s each; MSE Soniprep 150 fitted with the standard probe), and the sonicate was centrifuged at 15,800 x g for 10 min. The supernatant was loaded onto a 5-ml His-trap Ni affinity column (Amersham Biosciences) mounted on an ÁKTA fast protein liquid chromatography (FPLC) system (Amersham Biosciences), equilibrated, and run at 1 ml min–1 with 50 mM K-phosphate, pH 7.0, containing 20 mM imidazole. The column was washed with the same buffer until the optical absorption of the effluent returned to baseline, and then a 100-ml linear gradient of 20 to 500 mM imidazole in 50 mM K-phosphate, pH 7, was applied and 3-ml fractions were collected. Fractions containing the essentially pure protein (monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE] and Coomassie blue staining) were pooled and concentrated to ~20 mg ml–1 by centrifugal ultrafiltration (Amicon Ultra 30K device from Millipore), 20% (vol/vol) glycerol was added, and the protein was stored at –20°C.

Purification of the product of the cloned ef0734 gene. The purification of the product of the cloned ef0734 gene was as for the product of the ef0732 gene except for (i) the utilization as cell suspension buffer of 50 mM K-phosphate, pH 7, containing 1 mM dithiothreitol (DTT) and 0.5 mM phenylmethylsulfonyl fluoride; (ii) the inclusion of 1 mM DTT in all the solutions; (iii) the use with the His-trap step of a 25-ml gradient; and (iv) the incorporation of two additional purification steps as follows. The fractions (2 ml each) of the first His-trap column step containing the purer protein (by SDS-PAGE monitoring) were pooled, concentrated, and placed in 50 mM K-phosphate (pH 7.0)-1 mM DTT-0.5 M NaCl by repeated centrifugal ultrafiltration and then were subjected to repurification through the 5-ml His-trap column as in the first step, except for the inclusion in all the solutions of 0.5 M NaCl. The fractions containing the purer protein were concentrated again, freed from imidazole by centrifugal ultrafiltration, and subjected to size exclusion chromatography (~10 mg per injection to the column) on a Superdex 200HR 10/30 column (Amersham Biosciences) mounted on an ÁKTA FPLC system equilibrated and run at 0.25 ml min–1, using a solution of 50 mM K-phosphate (pH 7.0), 1 mM DTT, and 0.5 M NaCl. The fractions containing the essentially pure protein were pooled, concentrated to ~20 mg ml–1, and placed in 50 mM Tris-HCl (pH 7.4)-0.5 M NaCl-1 mM DTT by centrifugal ultrafiltration and were then supplemented with 10% (vol/vol) glycerol and stored at –20°C.

Enzyme activity assays. AgDI and PTC activities were assayed at 37°C by the production of carbamoyl putrescine, determined colorimetrically at 465 nm in an assay for ureido groups (40) based on the Archibald procedure (1). The color yield of carbamoyl putrescine in this color reaction (24,320 M–1 cm–1) was estimated after complete conversion of agmatine to carbamoyl putrescine by using a large excess of AgDI and was found to be 25% higher than the color yield of citrulline. The AgDI assay mixture (33) contained 50 mM EDTA brought to pH 7.8 with NaOH, 1 mg ml–1 bovine serum albumin (at the high dilutions used, the enzyme was unstable unless 1 mg ml–1 bovine serum albumin was added), and 5 mM agmatine (unless varied) or the compounds tested to replace agmatine (L-arginine, L-argininamide, or arcaine). The PTC assay mixture contained 50 mM Tris-HCl (pH 7), 0.1 mg ml–1 bovine serum albumin, and 10 mM of both carbamoyl phosphate and putrescine (unless otherwise indicated). When varying the concentration of one substrate, the other was fixed at 10 mM. In both assays the amount of the enzyme was adjusted to ensure that there was no consumption of >20% of any substrate, even at the low substrate concentrations used in the investigation of Km values. The reactions were terminated after 5 to 15 min with 7% cold trichloroacetic acid, and the amount of carbamoyl putrescine was determined. Results at variable substrate concentrations were fitted to hyperbolae by using the program GraphPad Prism (GraphPad Software, San Diego, CA). One enzyme unit corresponds to the production of 1 µmol carbamoyl putrescine min–1.

Analytical gel filtration chromatography. Analytical gel filtration chromatography was done with a Superdex 200HR (10/30) column mounted on an ÁKTA FPLC and equilibrated and eluted at 24°C, at a flow rate of 0.25 ml min–1, with a solution of 50 mM Tris-HCl, pH 7.5, containing 0.15 M NaCl. The sample contained 0.1 mg of the protein of interest in 0.25 ml. Protein in the effluent was monitored by the optical absorption at 280 nm. A semilogarithmic plot of the molecular masses of marker proteins (from Amersham Biosciences or Sigma or produced in our laboratory [14, 28, 44]) versus the distribution coefficient (Kd) for each protein was used for estimating the masses of AgDI and PTC. Kd values were calculated from the expression Kd = (VeV0)/(ViV0), where V0, Vi, and Ve are the elution volumes of dextran blue, water (estimated by monitoring conductivity), and the protein of interest, respectively.

Growth of protein crystals and data collection by X-ray diffraction. The sparse-matrix sampling vapor-diffusion method (22) was used for crystallization tests carried out in hanging drops in multiwell plates with commercial kits (Crystal Screen I and II from Hampton Research). The drops contained equal volumes (1 to 1.5 µl) of reservoir solution and of a 10-mg ml–1 solution of PTC or AgDI, prepared by repeated centrifugal ultrafiltration of the enzyme in 50 mM Tris-HCl, pH 7.45, containing also, in the case of AgDI, 1 mM dithiothreitol and 20 mM NaCl. Crystals of the two enzymes grew in about 1 week at 21°C. The best PTC crystals were obtained in the presence of 430 µM PAPU, using a crystallization solution consisting of 125 mM (NH4)2SO4, 17% polyethylene glycol 3.35K (Hampton Research), and 0.1 M bis-Tris, pH 5.5. The best AgDI crystals were obtained in the presence of 5 mM agmatine, using as reservoir fluid 0.1 M HEPES (pH 7.5), 1.5 M sodium chloride, and 1.6 M ammonium sulfate. The crystals were harvested in the corresponding crystallization solution supplemented with 15% (vol/vol) glycerol as cryoprotectant, flash-cooled in liquid nitrogen, and diffracted at 100 K (Oxford Cryo-Systems) using synchrotron radiation (ESRF, Grenoble, France; beamline ID 23-2 for PTC and BM-16 for AgDI). The PTC and AgDI data sets, collected to 3 and 1.65-Å resolutions, respectively, were processed and scaled with MOSFLM and SCALA (CCP4 suite [6]). Table 1 gives the results of the data collection as well as the spatial group and size of the cell for each of the proteins.


View this table:
[in this window]
[in a new window]

 
TABLE 1. X-ray data and structure refinement statistics

 
Phasing, model building, and refinement with the AgDI crystal data. Molecular replacement using MOLREP (55), utilizing as a model the deposited (although not yet analyzed or reported) structure at 2.9 Å of the subunit of AgDI from Streptococcus mutans (PDB accession number 2EWO), yielded a solution consisting of eight subunits in the asymmetric unit. Rigid-body and restrained refinements were performed using REFMAC (36), alternating with graphic model-building sessions with the program Coot (12). B factors and positional noncrystallographic symmetry restraints were used and gradually released as refinement progressed. TLS (58) was used in the last step of refinement.

All of the diffraction data were used throughout the refinement process, except the 5% randomly selected data for calculating Rfree. Refinement converged to a final R value of 16.8% (Rfree = 19.2%). The final model, at 1.65-Å resolution, consisted of the chain spanning residues 2 to 367, 2 to 364, 2 to 368, 2 to 373, 1 to 368, 2 to 368, 2 to 367, and 2 to 366 for subunits A, B, C, D, E, F, G, and H, respectively. The model includes in all of the subunits one molecule of agmatine (as an amidine derivative [see Results]) covalently bound to Cys357. The stereochemistry of the model, checked with PROCHECK (27), is reasonably good. Table 1 summarizes the data on the refinement process and on the final model.

Other methods. Protein was assayed by the method of Bradford (5), using a commercial reagent from Bio-Rad and bovine serum albumin as a standard. SDS-PAGE was carried out as described by Laemmli (26). Sequence alignments were carried out with ClustalW (53), using default values. Superposition of structures was carried out with the program SSM (25). Buried surface areas were calculated using NACCESS (http://wolf.bms.umist.ac.uk/naccess). Figures of protein structures were generated using BOBSCRIPT (13), Raster3D (34), and Pymol (http://pymol.sourceforge.net/).

Materials. Purified recombinant E. faecalis ornithine transcarbamylase (3, 31) (specific activity, 4,021 U mg–1) was a gift of J. Sellés, from this laboratory. PAPU was prepared and purified as previously reported (41) and had the expected contents of phosphate (determined after hot-acid digestion [4]) and free amino groups (assayed with ninhydrin [51] or by reverse-phase high-pressure liquid chromatography after ortho-phtaldialdehyde derivatization [43]; phosphoethanolamine was used as the standard). It yielded a mass (4700 Proteomic matrix-assisted laser desorption ionization-time-of-flight analyzer from Applied Biosystems; CIPF, Valencia, Spain) of 212.05 Da (expected mass of the monopositive ion, 211.2 Da). Agmatine, putrescine, cadaverine, ornithine, carbamoyl phosphate, and arcaine were from Sigma.

Atomic coordinate and structure factor accession number. The coordinates and structure factors have been deposited in the Protein Data Bank (http://www.rcsb.org/) with the accession code 2J2T.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Agmatine catabolism gene cluster of E. faecalis V583. The predicted genes ef0732, ef0733, ef0734, and ef0735 (Fig. 1) are on the same DNA strand of the E. faecalis V583 chromosome; separated by proposed intergenic distances of 66, 76, and 11 bp; and annotated in the current version of the TIGR database as the genes for putative ornithine transcarbamylase, an amino acid permease, a hypothetical conserved protein, and a putative carbamate kinase, respectively. By analogy with the operon for arginine catabolism, in which the genes for arginine deiminase, ornithine transcarbamylase, carbamate kinase, and the arginine/ornithine antiporter are designated arcABCD (for arginine catabolism), we here designate the ef0734, ef0732, ef0735, and ef0733 genes agcABCD (for agmatine catabolism), respectively (Fig. 1A). No open reading frames have been identified on the same DNA strand within the 1,143 bases preceding agcB or within the 197 bases following agcC. The latter 197-base region hosts a predicted good, highly stable, protein-independent transcription terminator hairpin (terminator 851 in the E. faecalis V583 genome [TransTerm v 2.0 Beta program; http://www.cbcb.umd.edu/software/TransTerm]) that may limit the span of the transcriptional unit downstream. A less stable terminator hairpin is predicted in the 66-residue intergenic region between agcB and agcD (terminator 850 in the E. faecalis genome), thus resembling the observation for the ADI operon of an internal hairpin of suboptimal stability after the gene for ornithine transcarbamylase, which caused only partial termination (3).

The identification in the TIGR database of the first codon of the open reading gene for agcA is in error: there are two more upstream in-frame ATG codons, at 12 and 28 triplets from the proposed initiator ATG, of which the most upstream one is the genuine one because (i) it is the only one that is preceded, 12 bases upstream, by a good Shine-Dalgarno ribosomal binding sequence (AGAAGG [the base differing from the canonical sequence is underlined]); (ii) the protein expressed from this ATG is a highly active AgDI (see below); (iii) there is correspondence between these 28 N-terminal residues and the N-terminal sequence of the AgDI from P. aeruginosa (38); and (iv) in the crystal structure of E. faecalis AgDI presented here, all these residues except Met1 are well ordered and integrated into the enzyme crystal structure, as expected for a genuine portion of the natural enzyme. Therefore, this ATG is eight bases into the preceding agcD gene, and thus agcD and agcA overlap.

The product of the cloned agcB gene is genuine putrescine transcarbamylase. The amino acid sequence encoded by the first gene of the cluster, agcB (open reading frame spanning nucleotides 689526 to 690545 of the E. faecalis genome), has the same length (339 amino acids) and exhibits 31% sequence identity with the OTC encoded by the arcB gene of the ADI operon of E. faecalis (3). The identity extends to the carbamoyl phosphate and ornithine binding signature sequences 52STRTR and 268HCLP (the amino acid numbering corresponds to the agcB-encoded protein sequence) and to 58 of the 85 residues that are totally conserved in the anabolic and catabolic OTCs of P. aeruginosa and in the arcB-encoded E. faecalis OTC (3). However, as might be expected if the product of the agcB gene were a transcarbamylase that carbamylates a substrate different from ornithine (although not much different, given the conservation of the ornithine signature), 11 of the 14 residues that are invariant in these three OTCs but that are not conserved or conservatively replaced in the agcB product map in the C-terminal half of the enzyme, corresponding to the putative ornithine domain of OTC. Further, the invariant SMG sequence of OTCs, which belongs to a mobile loop that encircles the substituents around the ornithine C{alpha} (47), is not conserved in the putative product of agcB.

Cloning of agcB into the expression plasmid pET-22b(+) and overexpression of the gene has confirmed that the corresponding protein product is PTC. The plasmid-encoded His6-tagged protein, overexpressed in E. coli BL21(DE3) cells (see Materials and Methods), was produced in large amounts in soluble form upon IPTG induction and was purified essentially to homogeneity (Fig. 1B), in an approximate yield of 25 mg per liter of initial culture, by a simple procedure based on the use of Ni affinity chromatography. The electrophoretic mobility of the purified protein in SDS-PAGE (Fig. 1B) corresponded to an estimated mass of 40 kDa, in agreement with the expected mass, deduced from the sequence, of 40,091 Da. Fourteen cycles of N-terminal sequencing yielded the sequence MKRDYVTTETYTKE, which includes the N-terminal Met and which corresponds to the amino acid sequence expected from the gene sequence. As previously reported for genuine E. faecalis putrescine transcarbamylase, the protein appears to be a highly stable trimer, as judged from its behavior relative to that of other proteins of known mass when subjected to chromatography in a column of Superdex 200HR (Fig. 2).


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 2. Investigation of the oligomeric state of E. faecalis PTC and AgDI, using gel filtration. A semilogarithmic plot of molecular mass versus elution volume (expressed as Kd [see Materials and Methods]) from the Superdex 200HR column is shown. The circles correspond to the following protein standards: cytochrome c (12.3 kDa), lactalbumin (14.2 kDa), carbonic anhydrase (29.0 kDa), ovalbumin (42.7 kDa), bovine serum albumin (66.4 kDa), the dimer of bovine serum albumin (132.9 kDa), Pyrococcus furiosus carbamate kinase (68.8 kDa), intact (97.1 kDa) and truncated (31.9 kDa) aspartokinase III of E. coli, alcohol dehydrogenase (146.8 kDa), aldolase (156.8 kDa), Thermotoga maritima N-acetyl-L-glutamate kinase (182.0 kDa), amylase (223.8 kDa), catalase (230.3 kDa), ferritin (440 kDa), and thyroglobulin (669 kDa). The triangle and square denote, respectively, the positions of elution of the peaks of E. faecalis PTC and AgDI, assuming that PTC is a trimer (sequence-deduced mass, 120,273 Da) and AgDI is a tetramer (deduced mass, 165,412 Da).

 
Enzyme activity assays in the presence of 10 mM of both putrescine and carbamoyl phosphate proved the recombinant protein to be a highly active putrescine transcarbamylase (Fig. 1, lower part) exhibiting specific activity comparable to although somewhat higher than that of the nonrecombinant enzyme purified from E. faecalis (597 U mg–1, versus 460 U mg–1 for nonrecombinant PTC [56]) and yielding Km values for carbamoyl phosphate (58 ± 6 µM) and putrescine (2.3 ± 0.3 mM) that also agree with prior determinations of the kinetic constants for E. faecalis PTC (56). Furthermore, also in accordance with prior results for PTC (56), the enzyme exhibits some weak activity when 10 mM putrescine is replaced by either 10 mM ornithine or cadaverine (6 and 9%, respectively, of the activity observed with putrescine).

PAPU is a very potent and highly selective inhibitor of PTC. Studies with aspartate and ornithine transcarbamylases demonstrated that phosphonoacetyl-L-aspartate (7) and phosphonoacetyl-L-ornithine (35) are, respectively, highly potent inert bisubstrate inhibitors of these enzymes. Since these inhibitors have been successfully used in crystallization trials with these two enzymes (21, 47) that led to the determination of their three-dimensional structures by X-ray diffraction, we reasoned that PAPU might be also a very potent and highly specific inhibitor of PTC and, if so, that it might help enzyme crystallization (see below). Although PAPU was synthesized previously (41), to our knowledge it has never been used with PTC. Figure 3A shows that PAPU, at micromolar concentrations, is a very potent inhibitor of PTC, causing complete inhibition. In contrast, this compound, at the same concentrations, does not inhibit E. faecalis OTC, highlighting the selectivity of this inhibitor for PTC. The inhibition is noncompetitive versus putrescine (Fig. 3B) and competitive versus carbamoyl phosphate (Fig. 3C), as expected if substrate binding in the PTC reaction is ordered, with carbamoyl phosphate binding first. From the slope of the plot of the apparent Km for carbamoyl phosphate versus the concentration of PAPU (Fig. 3C), a Ki value of 10 nM can be estimated for PAPU. This low Ki value highlights the high affinity of the enzyme for this bisubstrate inhibitor, thus offering good opportunities for the preparation of PAPU-containing crystalline complexes of PTC that might shed structural light on substrate binding by, and specificity of, the enzyme.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 3. Effects of PAPU on E. faecalis PTC activity. (A) Inhibition and lack of inhibition of E. faecalis PTC and OTC, respectively, by PAPU. Activities are given as fractions of the activity in the absence of PAPU. (B and C) Influence of PAPU on the kinetic parameters of PTC for putrescine (Put) and on the Km for carbamoyl phosphate (Carb-Pi), respectively.

 
The use of PAPU has allowed generation of PTC crystals suitable for X-ray analysis. To try to clarify the differences between PTC and OTC that account for the different specificities of these enzymes, we have initiated studies to determine the structure of PTC by X-ray diffraction of protein crystals. Initial crystallization trials in the absence of substrates or inhibitors, or in the presence of putrescine, yielded crystals under some conditions, and some of these crystals were of sufficient size for diffraction studies, but they diffracted X-rays poorly (more poorly than at 4-Å resolution) even when synchrotron sources were used. The addition of PAPU to the crystallization drop dramatically improved the results of the crystallization trials, strongly suggesting that these new crystals contain bound PAPU. The crystals, having a prismatic shape and a maximal dimension of ~0.3 mm (Fig. 1D, top panel), grew in about 1 week in the presence of 0.43 mM PAPU, with (NH4)2SO4 and polyethylene glycol 3.35K (from Hampton) used as crystallizing agents. The crystals diffract X-rays (ESRF synchrotron ID 23-2 source) at 3-Å resolution, allowing determination of the space group of the crystal (Table 1), which is hexagonal P6322, with a unit cell that would allow accommodating two or three enzyme subunits in the asymmetric unit, depending on whether 55% or 33% of the volume of the crystal is occupied by the solvent. We are presently in the process of searching for the phases by molecular replacement, using the structure of OTC from Pyrococcus furiosus (PDB file 1A1S) as the search model.

Properties of the product of the agcA gene, agmatine deiminase. Using the most upstream ATG of the open reading frame (see "Agmatine catabolism gene cluster of E. faecalis V583," above), the coding region for the third gene of the cluster, agcA, spans nucleotides 691981 to 693078 of the E. faecalis genome. The predicted protein product has a nearly identical length (365 versus 368 amino acids) and exhibits 54% sequence identity with respect to the AgDI encoded by the aguA gene of P. aeruginosa (38). In contrast, there is no significant identity (11.6% identity, with 11 gaps) with the 408-residue sequence for the ADI of E. faecalis (3). Nevertheless, the Clustal W alignment of the AgDI and ADI sequences (not shown) aligns a cysteine residue that is near the C termini of both sequences (Cys357 of AgDI) and which is conserved in both ADIs and AgDIs and plays an analogous key catalytic role in both enzymes (see our structural data on AgDI below).

The agcA gene, cloned from the most upstream ATG codon in the expression plasmid pET-22b(+), triggered upon IPTG induction massive expression of the expected protein (Fig. 1C), in soluble form, as shown by the appearance of a large band in SDS-PAGE with a mass (46 kDa) corresponding (within experimental error) to the expected mass of the recombinant protein (43,778 Da, including an extra 2,589 Da due to the 24-residue C-terminal His6-containing extension VGGKQNSSSVDKLAAALEH6). The extracts of the cells expressing the protein, but not those transformed with the empty parental pET-22 plasmid, exhibited important AgDI activity (Fig. 1, bottom) whereas ADI activity in the same extracts was nil. The recombinant enzyme, purified by a combination of two Ni affinity chromatography steps and a gel filtration step, was obtained in high yield (~40 mg per liter of initial culture) in a highly homogeneous form (Fig. 1C) and was proven by gel filtration (and also by the crystal structure [see below]) to be tetrameric (Fig. 2). This is a substantial difference with respect to the AgDIs that are involved in polyamine synthesis, which appear to be dimeric (23, 37, 59). Nevertheless, E. faecalis AgDI resembles the well-characterized polyamine-synthesizing AgDIs of corn and Arabidopsis thaliana (23, 59) in the relatively low Km value for agmatine (35 ± 3 µM, versus 12 and 110 µM for corn and A. thaliana AgDIs, respectively) and in the similar magnitude of the activity at agmatine saturation (22.3 ± 0.4 U mg–1, versus respective activities of 32 and 26 U mg–1 for corn and A. thaliana). These results differ importantly from those for the only bacterial AgDI studied biochemically, the AgDI of the arginine decarboxylase (ADC) pathway of P. aeruginosa (37), for which a much larger Km value (0.6 mM) and an ~4-fold-lower specific activity, relative to the E. faecalis enzyme, were reported. However, these differences may not be real, given the methodological difficulties with colorimetric activity assays at low substrate concentrations and given the instability of AgDI upon large dilution in the assay solution (which was prevented in our case by adding 1 mg ml–1 bovine serum albumin). Similarly to all previous reports with AgDIs from other sources (23, 37, 60), the E. faecalis enzyme appears to be highly specific for agmatine, not using L-arginine (Fig. 1, lower panel), L-argininamide, or arcaine (1,4-diguanidinobutane). Arcaine was reported to be a competitive inhibitor (relative to agmatine) of the corn (59) and cucumber (46) enzymes, with Ki values of ~3 and 7 µM, and we have found this compound also to be a competitive inhibitor of E. faecalis AgDI, with a Ki value of 28 ± 5 µM.

AgDI and ADI share the same basic fold. AgDI monocrystals of up to 1 mm in length (Fig. 1D, bottom panel) diffracted X-rays to 1.65 Å, allowing the determination of the crystal structure of the enzyme at atomic resolution. The asymmetric unit of the AgDI crystals (Table 1) contains eight subunits organized as two tetramers having identical structure. When superimposed, the root mean square deviation (RMSD) for monomers is 0.17 Å (for 364 C{alpha} atoms). Each of the monomers has a globular fold with approximate dimensions of 53 by 45 by 40 Å3. The monomer has a tertiary fold similar to that of the catalytic domain of ADI (Fig. 4A and B), although it lacks the five-helix bundle domain of this enzyme (9). Thus, the AgDI monomer has the fan-like structure with five blades that is a distinctive trait of ADI and which results from a fivefold pseudosymmetric structure in which each repeating element consists of a three-stranded mixed ß sheet and a helix in a ßß{alpha}ß arrangement. Given the absence in AgDI of the five-helix bundle that in ADI distorts the fan-like structure, the AgDI monomer is closer to fivefold pseudosymmetry than the catalytic domain of ADI (Fig. 4A and B). Nevertheless, the first repeat diverges from the canonical structure of the repeat, since it has two helices and the arrangement ß{alpha}ß{alpha}ß, and it is flanked near the fivefold pseudosymmetry axis by the C-terminal strand running antiparallel to the other three strands. The lengths and amino acid sequences, however, vary considerably from one element to another (Fig. 4E) and from those in the catalytic domain of ADI (not shown), and indeed, the superposition of AgDI with the catalytic domain of ADI (from subunit A of the Mycoplasma arginini enzyme [PDB file 1S9R]) yields a relatively large RMSD (2.77 Å for 238 C{alpha} atoms). A distinctive characteristic of the AgDI monomer fold is the existence of large loops emerging on the side of the fan corresponding to the C end of the two parallel strands of the repeats (Fig. 4E and bottom part of Fig. 4F). Particularly large is the loop that emerges from the end of repeat 4, which includes a ß hairpin (ß15 and ß16). This loop folds flat over the other loops and over a protruding long {alpha} helix that emerges from repeat 1 (helix 2, Fig. 4E) in the same direction as the loops. The presence of these loops and of the protruding {alpha} helix 2 renders highly different the two faces of the monomer that correspond to opposite edges of the repeats ß sheets and also serves the purposes of forming the active center and of providing interactions with the other subunits to form the tetramer (see below). Because of the presence of these loops on one side of the subunit, and also since the {alpha} helix of each repeat fills the space between adjacent repeats diverging from the pseudosymmetry axis, the subunit has a ball-like rounded shape (see each subunit in Fig. 4F and G).


Figure 4
View larger version (58K):
[in this window]
[in a new window]

 
FIG.4. Structure of AgDI. (A and B) Ribbon representations of the monomer of E. faecalis AgDI (A) and of the catalytic domain of Mycoplasma arginini ADI (PDB entry 1S9R without residues 75 to 148, which are not a part of the catalytic domain) (B), both containing the covalently bound substrate in space-filling representation. {alpha} helices, ß sheets, and loops are colored red, yellow, and green, respectively. (C) Stereo view of the active site of AgDI, showing the density map of 2FobsFcalc, contoured at the 0.9 {sigma} level, around the covalent adduct. The substrate is colored yellow, and the surrounding protein residues are colored gray. O, N, and S atoms are colored red, blue, and green, respectively. (D) Interatomic distances (in angstroms) between the catalytic protein residues and the substrate around the reactive carbon center. The interactions with a fixed water molecule (W1) believed to be important in the mechanism are also represented. The density map of 2FobsFcalc, contoured at 0.75 {sigma} for the covalent amidino complex, is shown. (E) Correspondence between amino acid sequence and secondary structure. Bars, arrows, and lines above the structure denote, respectively, {alpha} helices, ß strands, and loops (only long loops are depicted), numbered in ascending order from N to C terminus and, when belonging to a repeat, in parentheses and having a subscript that denotes the repeat number. Open triangles under the sequence denote residues having decreased accessibility upon the binding of agmatine. Circles denote decreased accessibility upon dimer (open) and tetramer (shaded) formation. The gray sequence backgrounds highlight residues that are invariant in the AgDIs of E. faecalis, Streptococcus mutans, Pseudomonas aeruginosa, and Arabidopsis thaliana (SwissProt accession numbers Q837U5, Q8DW17, Q9I6J9, and Q8GWW7, respectively). (F) Ribbon diagram of AgDI dimer viewed perpendicularly to the molecular twofold axis. Coloring and substrate representation are as in panel A. (G) Ribbon representation of the AgDI tetramer viewed along one of the three twofold molecular axes. The two subunits of the two dimers (as defined in the text) are shown in different shades of red or blue. The covalently bound substrate is shown in space-filling representation.

 
The agmatine binding site explains the high specificity of AgDI for its substrate. A large mass of electron density not corresponding to the polypeptide chain and having an elongated shape was clearly visible (Fig. 4C), filling an internal cavity of the enzyme and being connected to the density of the S atom of Cys357, the cysteine residue that is close to the enzyme C terminus and that is conserved in both agmatine deiminase and arginine deiminase. The electron density at 1.65-Å resolution fits a completely extended molecule of agmatine, with its C{xi} atom (the C atom of the guanidinium group of agmatine) covalently linked with the S atom of Cys357. Agmatine is bound centrally (Fig. 4A), approximately along the fivefold pseudosymmetry axis near its exit from the loop-rich side of the fan, in a closed, elongated, and crowded cavity. The central position results in the involvement in the building of the site of elements connected to all five repeats of the subunit. Thus, the site is formed between the long loop of repeat 2 and the loops that connect repeats 5 to 1, 1 to 2, and 3 to 4. The cavity is closed at its entry by a three-tongued gate formed by the loop of repeat 2 and by the long loops connecting repeats 3 to 4 and 4 to 5 (seen laterally in Fig. 4F). In our structure the closure is ensured by mutual interactions between some residues of these loops, although it is clear that these loops have to retreat at the beginning and at the end of the catalytic cycle, to allow substrate binding and carbamoyl putrescine release. The extended substrate runs parallel to and makes extensive Van der Waals contacts with a straight stretch of three glycines (Gly351-Gly352-Gly353), also making a hydrogen bond between the agmatine amino group and the O atom of Gly351. These glycines are a part of the conserved sequence (G/A)GGNIHCITQQ(E/Q)P, which includes the catalytic cysteine (underlined) and which can be considered a signature of AgDI. The four-carbon portion of the molecule of agmatine is also surrounded by the indolic rings of the invariant Trp93 and Trp119 (Fig. 4C), which are like flat tiles that wall the substrate binding cavity, and by the methyl group of invariant Thr215. The agmatine amino group also makes a bond with the {gamma}-COO of Glu214 (Fig. 4C), a residue that may play a key role in making the enzyme extremely selective against arginine, since it would not favor placing near it another negatively charged group as would be the case for the carboxylate group of arginine. In any case, the region that surrounds carbon 1 of agmatine is packed with predominantly hydrophobic groups, leaving no room for a carboxyl or for any other group of substantial size, and less so if the group is polar and charged as in an {alpha}-carboxylate. On the opposite end of the agmatine molecule, around the guanidinium group, the invariant residues Asp96, His218, and Asp220 surround the bound substrate and play catalytic roles (Fig. 4C and D) (see below).

The covalent adduct provides a snapshot of AgDI catalyzing its reaction. A close examination of the electron density around the C{xi} atom of agmatine (Fig. 4D) shows that this carbon is covalently linked with the S atom of Cys357 (C-S bond distance, 1.79 Å) and with two nitrogens (N{varepsilon} and N{xi}2). The C{xi} in our structure is somewhat displaced from the plane formed by its three covalent ligands (S, N{varepsilon}, and N{xi}2 atoms) towards a water molecule (W1, Fig. 4D) which is located at only 2.5 Å (a very short distance for nonbonded C and O atoms). The water molecule is fixed by hydrogen bonds to one O atom of each of the two side chain carboxylates of Asp220 and Asp96 and to the {delta}1N atom of His218. In turn, the {varepsilon}2N of His218 is linked to the {gamma}-COO of Glu157. A similar adduct was reported with ADI within a complex which replicates essentially all of the details of the present complex, including the presence and the interactions of the fixed water (9). This complex was interpreted to represent the covalent amidino complex proposed long ago to be formed in the mechanism of ADI (9, 16). Therefore, the present complex is highly indicative of a common, very strictly conserved mechanism of deimination by ADI and AgDI. This mechanism (Fig. 5) involves two tetrahedral intermediates but only one amidino adduct. Nevertheless, the amidino adduct must exist first in the presence of the leaving ammonia and later in the presence of the attacking water. Thus, the W1 molecule could also correspond to ammonia, and the present adduct may represent either the amidino compound with the leaving ammonia or the same compound with the attacking water.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 5. Proposed five-step mechanism for the AgDI reaction. Step 1 leads to the formation of the first tetrahedral carbon center intermediate as a consequence of the attack by the activated thiol of Cys357. Asp96 and the nonprotonated primary N of the guanidinium group may induce deprotonation of the thiol group. A proton is extracted by His218, which forms a charge relay system with Glu157. In step 2 the tetrahedral intermediate collapses to the triagonal amidino intermediate, with liberation of ammonia. Asp96, Asp220, and His218 help stabilize the leaving ammonia and the positive charge development in the amidino group. In step 3 ammonia is replaced by water positioned for attack on the carbon center, interacting with the same groups as the ammonia. The intermediate revealed here by X-ray crystallography corresponds to one of the two complexes (either the ammonia or the water complex) with the amidino intermediate. Step 4 is the formation of the second tetrahedral carbon intermediate. His218 helps this step by abstracting one proton from water. The final step is the collapse of the tetrahedral intermediate to carbamoylputrescine and the regenerated thiol group.

 
Architecture of the AgDI tetramer. In accordance with the conclusions derived from gel filtration data, AgDI is organized as a tetramer. This tetramer has tetrahedral shape, with the four subunits located in the vertices (Fig. 4G), and can be considered to be composed of two identical dimers, each of them (Fig. 4F) built by a 180° rotation of the monomer around an axis that is approximately parallel to the fivefold pseudosymmetry axis. Thus, this dimer has the aspect of two fans in battery. The interactions in this dimer are mediated by the elements of the first and second repeats, with the edge of the more external ß strand of the first repeat interacting with the C-terminal two turns of {alpha} helix 4, the helix belonging to the second repeat. These interactions are generally hydrophobic in the core region and polar towards the periphery, and the surface involved amounts to an average of 991 Å2 per monomer (determined with a probe radius of 1.4 Å) or ~6.9% of the surface of each monomer. The two subunits in the dimer leave a valley between them (Fig. 4F) in the loop-rich face. It is this valley which is used for tetramer formation by having the valley of one dimer interact in a crossed-over way with the valley in the other dimer, so that the twofold axes of the two dimers are coincident and the longest axes of the two dimers run in perpendicular directions (Fig. 4G). One subunit (called A for the purpose of this description) of one dimer interacts with the two subunits of the other dimer (here called C and D). The N termini of helices 2 from A and C interact mutually, and residues 286 to 289 of the long hairpin loop that connects repeats 4 and 5 of A interact with the outer surface of helix 3 and also with the N-terminal turn of helix 2 of C, and vice versa. The interactions between A and D are restricted to mutual hydrophobic contacts between the long loop of repeat 2 of both subunits. The buried surface per monomer is 639 Å2 for the interactions between A and C and only 252 Å2 for those between A and D. Overall, each monomer has in the tetramer a buried surface of 1,927 Å2, accounting for 13.5% of its total accessible surface area and explaining the stability of the enzyme tetramer that has been observed in the present studies.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
By cloning the genes and by studying the expressed proteins, we obtained here the most conclusive proof to date that the E. faecalis agcB and agcA genes encode two key enzymes of agmatine catabolism, PTC and AgDI, confirming and extending previous (17, 18, 39) but more indirect evidence for the identification of these genes. When initially purified from E. faecalis, PTC exhibited some (although low) activity with ornithine (56), and this is confirmed here with the recombinant, His tag-purified enzyme, virtually completely excluding OTC contamination as the cause for this activity. Nevertheless, the relatively low specific activity of PTC compared with the activity of pure OTC (~5-fold higher) (the low PTC activity is not due to the poly-His tail, since wild-type PTC isolated from E. faecalis has even somewhat less activity [56]) made it desirable to confirm that this enzyme is a genuine PTC, which has been done here by demonstrating that this enzyme is powerfully inhibited by very low concentrations (Ki = 10 nM) of the PTC-specific bisubstrate analog inhibitor PAPU, a compound that does not inhibit OTC at similar concentrations.

Since E. faecalis OTC and PTC share 31% sequence identity, either these two enzymes derive from a common ancestor of broad specificity or, perhaps more likely since OTC cannot use putrescine, PTC may derive from OTC and may not have yet perfected discrimination between putrescine and ornithine, with the process of shifting specificity possibly having resulted in somewhat compromised catalytic efficiency. To discriminate between these possibilities and to clarify the determinants of specificity and catalytic efficiency, it would be important to compare the structures of PTC and OTC, a goal that is now at closer reach thanks to the use of PAPU, since we report here the production of X-ray-diffracting PTC crystals generated in the presence of this bisubstrate inhibitor.

We have also characterized, both functionally and structurally, the protein product encoded by agcA as AgDI. The structure of this enzyme closely resembles that of ADI, the enzyme that catalyzes the same reaction except for the use of arginine as a substrate, exhibiting the characteristic five-blade propeller fold presented by the catalytic domain of ADI (9, 15), with the substrate, also similarly to ADI, binding in a deep, central, very tight cavity. We have found here that AgDI, again similarly to ADI (9, 16), makes a covalent substrate amidino adduct involving a catalytic thiol group belonging to a conserved Cys residue that is close to the enzymes' C termini. Thus, ADI and AgDI are homologous enzymes, although the lack of significant sequence identity between them indicates a long period of divergence. The inability of each of these enzymes to use the substrate of the other (3, 37; this paper) further suggests that the separation between ADI and AgDI occurred long ago, with enough time for optimization of substrate specificity.

The AgDI studied here, committed to making ATP fermentatively from agmatine (48), exhibits ~50% sequence identity (not shown) with the more widespread AgDIs, which belong to the ADC pathway and are involved in polyamine production (37, 38) (although this pathway can also serve for agmatine utilization as a carbon and nitrogen source, as in Pseudomonas aeruginosa [19, 52]). The most relevant difference is that ADC pathway AgDIs appear to be dimeric (23, 37, 59), whereas E. faecalis AgDI is tetrameric, although in fact it is a dimer of dimers and thus even in this aspect does not depart much from the characteristics of the ADC pathway AgDIs. Since AgDIs exhibit neither cooperativity for the substrate nor regulatory properties (46), we presently have no indications that the degree of oligomerization of AgDIs is important functionally.

Although not studied experimentally here, there can be little doubt that the product of agcC (Fig. 1A) is a true CK, since it is only one amino acid shorter than and exhibits 49% sequence identity (data not shown) with the CK of the E. faecalis ADI operon (30), an enzyme for which the three-dimensional structure was determined (29). Since the CKs involved in arginine and agmatine catabolism appear similar and there is no evidence of CK regulation by effectors (32), one plausible reason for having two separate CK isozymes in each of these pathways may be to facilitate concerted expression of all the genes of one or the other pathway. The important sequence identity of these two CK isozymes indicates that their separation is not remote. In contrast, the lack of significant sequence identity (14%) between the E. faecalis arcD and agcD gene products (the putative arginine/ornithine and agmatine/putrescine antiporters) indicates ancient divergence, the homology of these genes being supported by the similarity of the polypeptide lengths (483 and 458 residues, respectively) and transmembrane helix predictions (11 to 12 helices) and also by the analogous functions and substrates of the antiporters.

The comparison of the genes of the ADI and AgDI pathways contradicts the naïve view that the two pathways might have arisen by a process of duplication of a complete ancient four-gene cluster. As already indicated, the deiminase and antiporter components of both pathways have evolved separately for much longer than the transcarbamylase and carbamate kinase components, in contrast with the expectation for a common duplication event for all of the elements of the gene cluster, followed by coevolution. Nevertheless, the genes for the transcarbamylase and for CK may have duplicated simultaneously, given their similar degree of conservation in one gene cluster relative to the corresponding genes in the other cluster and also since in both clusters the transcarbamylase gene physically precedes the CK gene. Since agmatine utilization cannot precede agmatine production, the close relationship between the AgDIs of the ADC and AgDI pathways suggests that the latter may have derived from an ADC pathway gene for AgDI. The evolution of AgDI may have been initiated by its divergence from ADI to serve the purpose of polyamine synthesis. Much more recently, AgDI may have become committed into a novel route of agmatine catabolism, made by recombining elements of the ADI pathway with the arginine decarboxylase pathway element AgDI and with an agmatine antiporter of obscure origin.

An important contribution of the present work is the clarification of the structure and, based on the structure, of the reactional and catalytic mechanisms of AgDI. The high affinity of AgDI for agmatine is accounted for by the extension and closeness of the interactions between substrate and enzyme, since agmatine is buried, fitting tightly a binding site where there is no empty space. The high specificity is explained by the negative charge at the entry of the site provided by Glu214, which would not fit the placement of the {alpha}-carboxylate group of arginine, and also by the very crowded environment where even minor volumes around the C1 of agmatine would be excluded. The relatively low kcat for a hydrolase exhibited by AgDI (17 s–1 at 37°C) may be explained by the deepness of the site, with the catalytic groups far into the subunit structure, and also by the existence of a gating mechanism at the entry of the site that has to open, close, and open again in each catalytic cycle, possibly limiting substrate access or product release. Agmatine binding may trigger site closure, since the amino end of the substrate interacts with elements of the loops that contribute to the gating mechanism, particularly with Glu214. Since the formation of the covalent adduct with the thiol group of Cys357 should shorten somewhat the bound molecule, the closing mechanism could be described as "pulling the gate from the inside" by the covalently bound substrate. The importance of substrate binding for gate closure is supported by the observation of the deposited structure of S. mutans AgDI, which contains no bound agmatine and where the largest loop involved in the gating mechanism is retracted and the site is more accessible. Our structure, containing the covalently bound substrate, is closed and would have to be open at the end of the reaction. The simplest triggering mechanism to open the gate could be defined as "pushing the gate from the inside," whereby the increase in the volume resulting from the coexistence of the ureido group in carbamoyl putrescine and the free thiol in Cys357 may result in some displacement of the molecule of the product towards the gate, particularly given the extreme narrowness of the site, which should not allow bending of the bound product.

Puzzlingly, in our crystal structure the enzyme has retained the covalent amidino adduct without progressing further along the reactional path. The corresponding analog for arginine has also been reported for ADI (9). The presence of the trapped intermediate strongly suggests that some component in the crystallization solution has stabilized the amidino intermediate, in fact resulting in enzyme inhibition. Perhaps ammonia, present in our solution at a concentration of 3.2 M, has resulted in the stabilization of the ammonia-containing amidino complex (W1 in our structure could equally be ammonia), blocking further reaction with water (Fig. 5). Whatever the mechanism, the observation of the complex has had the value of clarifying substrate binding and catalysis. The catalytic process involves centrally, as in the case of ADI (9, 15), a charge relay system consisting of Glu157 and His218, which promotes formation of the tetrahedral intermediates by providing or withdrawing a proton, and Cys357 with its SH group being abnormally acidic, perhaps because of the presence of the guanidinium group of the substrate and possibly also by the inducing effect of the nearby (3 Å away) carboxylate of Asp96. We are presently undertaking studies to subject to experimental tests, by site-directed mutagenesis, the roles proposed on the basis of the structure for catalysis of the reaction by these residues.


    ACKNOWLEDGMENTS
 
This work was supported by grant BFU2004-05159 from the Spanish Ministry of Education and Science. L. M. Polo is a fellow of CSIC-Banco de Santander, and J. L. Llácer and S. Tavárez are fellows of the Spanish Ministry of Education and Science. We thank the EU, ESRF, and EMBL Grenoble for financial support for ESRF synchrotron X-ray data collection.

We thank the ESRF personnel for expert help; A. Marina and M. López for diffracting AgDI; J. J. Calvete (IBV-CSIC, Valencia, Spain) for N-terminal sequencing; D. Gigot (Université Livre de Bruxelles, Belgium) for advice; A. Cantin and M. A. Miranda (ITQ-CSIC, Valencia, Spain) for help with the synthesis of PAPU; C. Aguado (CIPF, Valencia, Spain) for matrix-assisted laser desorption ionization-time-of-flight mass spectrometry; and J. Sellés, P. Tortosa, and L. Osuna (IBV-CSIC, Valencia, Spain) for technical help.


    FOOTNOTES
 
* Corresponding author. Mailing address: Instituto de Biomedicina de Valencia (IBV-CSIC), C/Jaime Roig 11, 46010 Valencia, Spain. Phone: 34 96 339 17 72. Fax: 34 96 369 08 00. E-mail: rubio{at}ibv.csic.es. Back

{triangledown} Published ahead of print on 6 October 2006. Back

{dagger} J.L.L., L.M.P., and S.T. contributed equally to this work. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Archibald, R. 1944. Determination of citrulline and allantoin and demonstration of citrulline in blood plasma. J. Biol. Chem. 156:121-141.[Free Full Text]
  2. Bagni, N., and A. Tassoni. 2001. Biosynthesis, oxidation and conjugation of aliphatic polyamines in higher plants. Amino Acids 20:301-317.[CrossRef][Medline]
  3. Barcelona-Andres, B. A. Marina, and V. Rubio. 2002. Gene structure, organization, expression, and potential regulatory mechanisms of arginine catabolism in Enterococcus faecalis.J. Bacteriol. 184:6289-6300.[Abstract/Free Full Text]
  4. Bartlett, G. R. 1959. Phosphorus assay in column chromatography. J. Biol. Chem. 234:466-468.[Free Full Text]
  5. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
  6. Collaborative Computational Project Number 4. 1994. The CCP4 suite: programs for protein crystallography. Acta Crystallogr. D 50:760-763.[CrossRef][Medline]
  7. Collins, K. D., and G. R. Stark. 1971. Aspartate transcarbamylase. Interaction with the transition state analogue N-(phosphonacetyl)-L-aspartate. J. Biol. Chem. 246:6599-6605.[Abstract/Free Full Text]
  8. Cunin, R., N. Glansdorff, A. Pierard, and V. Stalon. 1986. Biosynthesis and metabolism of arginine in bacteria. Microbiol. Rev. 50:314-352.[Free Full Text]
  9. Das, K., G. H. Butler, V. Kwiatkowski, A. D. Clark, Jr., P. Yadav, and E. Arnold. 2004. Crystal structures of arginine deiminase with covalent reaction intermediates; implications for catalytic mechanism. Structure 12:657-667.[Medline]
  10. Deibel, R. H. 1964. Utilization of arginine as an energy source for the growth of Streptococcus faecalis.J. Bacteriol. 87:988-992.[Abstract/Free Full Text]
  11. Driessen, A. J., E. J. Smid, and W. N. Konings.1988 . Transport of diamines by Enterococcus faecalis is mediated by an agmatine-putrescine antiporter.J. Bacteriol. 170:4522-4527.[Abstract/Free Full Text]
  12. Emsley, P., and K. Cowtan. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr. D 60:2126-2132.[CrossRef][Medline]
  13. Esnouf, R. M. 1999. Further additions to MolScript version 1.4, including reading and contouring of electron-density maps.Acta Crystallogr. D 55:938-940.[CrossRef][Medline]
  14. Fernandez-Murga, M. L., F. Gil-Ortiz, J. L. Llacer, and V. Rubio. 2004. Arginine biosynthesis in Thermotoga maritima: characterization of the arginine-sensitive N-acetyl-L-glutamate kinase. J. Bacteriol. 186:6142-6149.[Abstract/Free Full Text]
  15. Galkin, A., L. Kulakova, E. Sarikaya, K. Lim, A. Howard, and O. Herzberg.2004 . Structural insight into arginine degradation by arginine deiminase, an antibacterial and parasite drug target.J. Biol. Chem. 279:14001-14008.[Abstract/Free Full Text]
  16. Galkin, A., X. Lu, D. Dunaway-Mariano, and O. Herzberg. 2005. Crystal structures representing the Michaelis complex and the thiouronium reaction intermediate of Pseudomonas aeruginosa arginine deiminase. J. Biol. Chem. 280:34080-34087.[Abstract/Free Full Text]
  17. Griswold, A. R., Y. Y. Chen, and R. A. Burne.2004 . Analysis of an agmatine deiminase gene cluster in Streptococcus mutans UA159. J. Bacteriol. 186:1902-1904.[Abstract/Free Full Text]
  18. Griswold, A. R., M. Jameson-Lee, and R. A. Burne.2006 . Regulation and physiologic significance of the agmatine deiminase system of Streptococcus mutans UA159.J. Bacteriol. 188:834-841.[Abstract/Free Full Text]
  19. Haas, D., H. Matsumoto, P. Moretti, V. Stalon, and A. Mercenier.1984 . Arginine degradation in Pseudomonas aeruginosa mutants blocked in two arginine catabolic pathways.Mol. Gen. Genet. 193:437-444.[CrossRef][Medline]
  20. Hills, G. M. 1940. Ammonia production by pathogenic bacteria. Biochem. J. 34:1057-1069.[Medline]
  21. Huang, J., and W. N. Lipscomb. 2004. Aspartate transcarbamylase (ATCase) of Escherichia coli: a new crystalline R-state bound to PALA, or to product analogues citrate and phosphate. Biochemistry 43:6415-6421.[CrossRef][Medline]
  22. Jancarik, J., and S. H. Kim. 1991. Sparse matrix sampling: a screening method for crystallization of proteins.J. Appl. Crystallogr. 24:409-411.[CrossRef]
  23. Janowitz, T., H. Kneifel, and M. Piotrowski. 2003. Identification and characterization of plant agmatine iminohydrolase, the last missing link in polyamine biosynthesis of plants. FEBS Lett. 544:258-261.[CrossRef][Medline]
  24. Jones, M. E., and F. Lipmann. 1960. Chemical and enzymatic synthesis of carbamyl phosphate. Proc. Natl. Acad. Sci. USA 46:1194-1205.[Free Full Text]
  25. Krissinel, E., and K. Henrick. 2004. Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr. D 60:2256-2268.[CrossRef][Medline]
  26. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature 227:680-685.[CrossRef][Medline]
  27. Laskowski, R. A., M. W. MacArthur, D. S. Moss, and J. M. Thornton. 1993. PROCHECK: a program to check the stereochemical quality of protein structures.J. Appl. Crystallogr. 26:283-291.[CrossRef]
  28. Marco-Marin, C., S. Ramon-Maiques, S. Tavarez, and V. Rubio. 2003. Site-directed mutagenesis of Escherichia coli acetylglutamate kinase and aspartokinase III probes the catalytic and substrate-binding mechanisms of these amino acid kinase family enzymes and allows three-dimensional modelling of aspartokinase. J. Mol. Biol. 334:459-476.[CrossRef][Medline]
  29. Marina, A., P. M. Alzari, J. Bravo, M. Uriarte, B. Barcelona, I. Fita, and V. Rubio. 1999. Carbamate kinase: new structural machinery for making carbamoyl phosphate, the common precursor of pyrimidines and arginine. Protein Sci. 8:934-940.[Abstract]
  30. Marina, A., M. Uriarte, B. Barcelona, V. Fresquet, J. Cervera, and V. Rubio. 1998. Carbamate kinase from Enterococcus faecalis and Enterococcus faecium. Cloning of the genes, studies on the enzyme expressed in Escherichia coli, and sequence similarity with N-acetyl-L-glutamate kinase. Eur. J. Biochem. 253:280-291.
  31. Marshall, M., and P. P. Cohen. 1972. Ornithine transcarbamylase from Streptococcus faecalis and bovine liver. I. Isolation and subunit structure. J. Biol. Chem. 247:1641-1653.[Abstract/Free Full Text]
  32. Marshall, M., and P. P. Cohen. 1966. A kinetic study of the mechanism of crystalline carbamate kinase. J. Biol. Chem. 241:4197-4208.[Abstract/Free Full Text]
  33. Mercenier, A., J. P. Simon, D. Haas, and V. Stalon.1980 . Catabolism of L-arginine by Pseudomonas aeruginosa. J. Gen. Microbiol. 116:381-389.[Medline]
  34. Merritt, E. A., and M. E. Murphy. 1994. Raster3D version 2.0. A program for photorealistic molecular graphics.Acta Crystallogr. D 50:869-873.[CrossRef][Medline]
  35. Mori, M., K. Aoyagi, M. Tatibana, T. Ishikawa, and H. Ishii.1977 . N{delta}-(phosphonacetyl)-L-ornithine, a potent transition state analogue inhibitor of ornithine carbamoyltransferase.Biochem. Biophys. Res. Commun. 76:900-904.[CrossRef][Medline]
  36. Murshudov, G. N., A. A. Vagin, and E. J. Dodson.1997 . Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D 53:240-255.[CrossRef][Medline]
  37. Nakada, Y., and Y. Itoh. 2003. Identification of the putrescine biosynthetic genes in Pseudomonas aeruginosa and characterization of agmatine deiminase and N-carbamoylputrescine amidohydrolase of the arginine decarboxylase pathway. Microbiology 149:707-714.[Abstract/Free Full Text]
  38. Nakada, Y., Y. Jiang, T. Nishijyo, Y. Itoh, and C. D. Lu.2001 . Molecular characterization and regulation of the aguBA operon, responsible for agmatine utilization in Pseudomonas aeruginosa PAO1. J. Bacteriol. 183:6517-6524.[Abstract/Free Full Text]
  39. Naumoff, D. G., Y. Xu, N. Glansdorff, and B. Labedan.2004 . Retrieving sequences of enzymes experimentally characterized but erroneously annotated: the case of the putrescine carbamoyltransferase. BMC Genomics 5:52.[CrossRef][Medline]
  40. Nuzum, T. C., and P. J. Snodgrass. 1976. Multiple assays of the five urea cycle enzymes in liver homogenates, p.32