Previous Article | Next Article ![]()
Journal of Bacteriology, February 2007, p. 1254-1265, Vol. 189, No. 4
0021-9193/07/$08.00+0 doi:10.1128/JB.01216-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Luis Mariano Polo,
Sandra Tavárez,
Benito Alarcón,
Rebeca Hilario, and
Vicente Rubio*
Instituto de Biomedicina de Valencia (IBV-CSIC), C/Jaime Roig 11, 46010 Valencia, Spain
Received 3 August 2006/ Accepted 29 November 2006
|
|
|---|
|
|
|---|
Possibly no microbial species has been more important for the biochemical characterization of the ADI and AgDI pathways than E. faecalis. It was with this microorganism that both pathways were originally demonstrated (20, 24, 45, 50), the corresponding enzymatic steps were characterized and shown to be coordinately induced by arginine or agmatine (48, 49), the enzymes (except AgDI) were purified (31, 32, 42, 56), and CK (the ADI pathway isozyme) was crystallized and its structure determined at atomic resolution (29, 30). Despite the abundance of biochemical information, there was little genetic information on these routes in E. faecalis until we sequenced the genes and determined the gene structure, organization, and some regulatory features for the components of the ADI pathway (3). However, in the case of the AgDI pathway, for very long time there was no other genetic information than the observation that three mutant strains of E. faecalis that were unable to use agmatine were devoid of either AgDI activity, PTC activity, or both (48). The loss of the two enzymes in one mutant and the triggering by agmatine of coordinated increases in the levels of AgDI and PTC appeared to be consistent with the physical association of the genes for these two enzymes within the same operon, as is the case for the genes for the ADI pathway (3, 48, 49). Only recently, after the identification in Pseudomonas aeruginosa of the gene aguA (38), encoding the AgDI that is involved in putrescine and polyamine biosynthesis in plants and microorganisms that decarboxylate arginine (2) (not the case for E. faecalis), a putative aguA gene was identified in the cariogenic organism Streptococcus mutans (17) and, by sequence similarity, in E. faecalis (gene ef0734 of E. faecalis V583 genome [TIGR database; http://www.tigr.org]). In both species this gene is preceded by the genes for a putative antiporter and for a transcarbamylase (in E. faecalis V583, genes ef0733 and ef0732, respectively) and is followed by a putative gene for carbamate kinase (ef0735) (Fig. 1A). Thus, this gene cluster would contain the genes for all the catalysts required for operation of the AgDI pathway, and indeed, a polar disruption of the first gene in this cluster of S. mutans strongly decreased the AgDI activity measured in permeabilized cells, as expected for the AgDI operon (17). Further, the amino acid sequence predicted to be encoded by ef0732 coincides with the N-terminal sequence reported long ago for E. faecalis PTC (39, 54).
![]() View larger version (78K): [in a new window] |
FIG. 1. Agmatine
catabolism gene cluster and purification and crystallization of PTC and
AgDI. (A) Gene organization of the two strands of the
sequenced region, showing the number of amino acid (aa) residues
expected for each gene product and the length (in base pairs) of the
intergenic regions. Genes are given the identifiers of the TIGR
database, together with the agc designations given to them
here. The positions of the three predicted stem-loops are indicated by
the open circles, and a putative cre box preceding
agcB is indicated with a gray rectangle. The gene in the
opposite strand corresponds to a luxR regulator. (B and C)
SDS-PAGE and Coomassie blue staining analyses of the various steps of
the purifications of PTC and AgDI. The crude extracts are the
postsonication supernatants. Panel B also includes a blank extract of
E. coli BL21 cells transformed with the parental pET-22
plasmid carrying no gene insert, to highlight the differences from the
extracts of cells transformed with the plasmids carrying the gene for
PTC or for AgDI. Molecular mass marker proteins were from Sigma (Dalton
Mark VII-L). Results of enzyme activity assays for PTC and AgDI are
shown below the purification steps at which the activities were
assayed. The activities obtained when putrescine was replaced by 10 mM
ornithine (for OTC) or when agmatine was replaced by 5 mM arginine (for
ADI) are also shown. Values of <0.1 or <0.2
are below the detection limits for assays giving no activity.
(D) Crystals of both enzymes that were obtained and used for
diffraction studies. Bars, 0.1
mm.
|
|
|
|---|
Cloning and expression in E. coli of ef0732 and ef0734.
ef0732 and
ef0734 were PCR amplified from genomic DNA from E. faecalis
SD10 by utilizing a high-fidelity thermostable DNA polymerase (Deep
Vent; New England Biolabs) and the primer pairs
5'689512AGGAGGAACACCATATGAAAAGAGATTAC689540and
5'690565AATCAGTGGAAGCTTGGCCGTTAAATGC690538(for ef0732) and
5'691969GAACGAAAGCATATGGCTAAACGAATTG691996and
5'693106ATCACTATTTTTGAATTCTGTTTCCCTCC693078(for ef0734), where the first primer in each pair corresponds to the
coding strand and the second to the complementary strand, the
superscript numbers are the coordinates in the TIGR database for the
E. faecalis genome, underlining indicates mutated bases, and
boldface identifies nucleotides belonging to the open reading frame to
be amplified. These primers were designed to introduce an NdeI site at
the initiator ATG codon and HindIII and EcoRI sites 6 or 11 nucleotides
downstream of the stop codon of ef0732 or ef0734, respectively. The PCR
products, digested with NdeI-HindIII or NdeI-EcoRI, were inserted
directionally in the corresponding sites of plasmid pET-22b behind the
promoter recognized by T7 DNA polymerase. The resulting plasmids,
isolated from transformed E. coli DH5
cells grown in
Luria-Bertani (LB) medium containing 0.1 mg ml1 of
ampicillin, were mutated at the translation termination codon by using
the QuikChange site-directed mutagenesis kit (from Stratagene) and the
oligonucleotide pair
5'CAAAGCATTTCAGCGGCCAAGCTTG3' and
5'CTTGGCCGCTGAAATGCTTTGAGTG3' for
ef0732, to replace the translation termination codon by serine and to
introduce an extra G after this mutated codon, and the pair
5'GAACCAAAGCGCGTAGGAGGGAAACAGAATTCG3'and
5'CTGTTTCCCTCCTACGCGCTTTGGTTCTTGTTG3'for ef0734, to introduce a G before the translation termination codon.
These mutations abolish termination at the normal stop codon and place
in frame the plasmid sequence for incorporating at the cloned protein C
terminus a linker and a His6 sequence. In this way, the
ef0732 and ef0734 gene products include, respectively, the 16- and
24-amino acid C-terminal extensions SAAKLAAALEH6 and
VGGKQNSSSVDKLAAALEH6. The mutant plasmids, isolated from
transformed DH5
cells and confirmed by sequencing to carry the
correct constructions, were used to transform E. coli
BL21(DE3) cells. After growth of the cells at 37°C (ef0732) or
30°C (ef0734) in liquid LB medium supplemented with 0.1 mg
ml1 of ampicillin until a turbidity at 600 nm of
0.6 to 0.7 was attained, 0.1 mM isopropyl
ß-D-thiogalactopyranoside (IPTG) was added, and the
culture was continued for 3 to 4.5 additional hours before the cells
were harvested by centrifugation. All subsequent purification steps
were carried out at 0 to
4°C.
Purification of the product of the cloned ef0732 gene.
The cells were suspended in 1/100 of
the original culture volume of 20 mM K-phosphate, pH 7.4, containing 10
mM putrescine and 20 mM imidazole; they were then broken by sonication
(four pulses of 30 s each; MSE Soniprep 150 fitted with the
standard probe), and the sonicate was centrifuged at 15,800 x
g for 10 min. The supernatant was loaded onto a 5-ml His-trap
Ni affinity column (Amersham Biosciences) mounted on an ÁKTA fast
protein liquid chromatography (FPLC) system (Amersham Biosciences),
equilibrated, and run at 1 ml min1 with 50 mM
K-phosphate, pH 7.0, containing 20 mM imidazole. The column was washed
with the same buffer until the optical absorption of the effluent
returned to baseline, and then a 100-ml linear gradient of 20 to 500 mM
imidazole in 50 mM K-phosphate, pH 7, was applied and 3-ml fractions
were collected. Fractions containing the essentially pure protein
(monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
[SDS-PAGE] and Coomassie blue staining) were pooled and concentrated to
20 mg ml1 by centrifugal ultrafiltration
(Amicon Ultra 30K device from Millipore), 20% (vol/vol) glycerol was
added, and the protein was stored at
20°C.
Purification of the product of the cloned ef0734 gene.
The purification of the product of
the cloned ef0734 gene was as for the product of the ef0732 gene except
for (i) the utilization as cell suspension buffer of 50 mM K-phosphate,
pH 7, containing 1 mM dithiothreitol (DTT) and 0.5 mM
phenylmethylsulfonyl fluoride; (ii) the inclusion of 1 mM DTT in all
the solutions; (iii) the use with the His-trap step of a 25-ml
gradient; and (iv) the incorporation of two additional purification
steps as follows. The fractions (2 ml each) of the first His-trap
column step containing the purer protein (by SDS-PAGE monitoring) were
pooled, concentrated, and placed in 50 mM K-phosphate (pH
7.0)-1 mM DTT-0.5 M NaCl by repeated centrifugal
ultrafiltration and then were subjected to repurification through the
5-ml His-trap column as in the first step, except for the inclusion in
all the solutions of 0.5 M NaCl. The fractions containing the purer
protein were concentrated again, freed from imidazole by centrifugal
ultrafiltration, and subjected to size exclusion chromatography
(
10 mg per injection to the column) on a Superdex 200HR 10/30
column (Amersham Biosciences) mounted on an ÁKTA FPLC system
equilibrated and run at 0.25 ml min1, using a
solution of 50 mM K-phosphate (pH 7.0), 1 mM DTT, and 0.5 M NaCl. The
fractions containing the essentially pure protein were pooled,
concentrated to
20 mg ml1, and placed in
50 mM Tris-HCl (pH 7.4)-0.5 M NaCl-1 mM DTT by
centrifugal ultrafiltration and were then supplemented with 10%
(vol/vol) glycerol and stored at
20°C.
Enzyme activity assays. AgDI and PTC activities were assayed at 37°C by the production of carbamoyl putrescine, determined colorimetrically at 465 nm in an assay for ureido groups (40) based on the Archibald procedure (1). The color yield of carbamoyl putrescine in this color reaction (24,320 M1 cm1) was estimated after complete conversion of agmatine to carbamoyl putrescine by using a large excess of AgDI and was found to be 25% higher than the color yield of citrulline. The AgDI assay mixture (33) contained 50 mM EDTA brought to pH 7.8 with NaOH, 1 mg ml1 bovine serum albumin (at the high dilutions used, the enzyme was unstable unless 1 mg ml1 bovine serum albumin was added), and 5 mM agmatine (unless varied) or the compounds tested to replace agmatine (L-arginine, L-argininamide, or arcaine). The PTC assay mixture contained 50 mM Tris-HCl (pH 7), 0.1 mg ml1 bovine serum albumin, and 10 mM of both carbamoyl phosphate and putrescine (unless otherwise indicated). When varying the concentration of one substrate, the other was fixed at 10 mM. In both assays the amount of the enzyme was adjusted to ensure that there was no consumption of >20% of any substrate, even at the low substrate concentrations used in the investigation of Km values. The reactions were terminated after 5 to 15 min with 7% cold trichloroacetic acid, and the amount of carbamoyl putrescine was determined. Results at variable substrate concentrations were fitted to hyperbolae by using the program GraphPad Prism (GraphPad Software, San Diego, CA). One enzyme unit corresponds to the production of 1 µmol carbamoyl putrescine min1.
Analytical gel filtration chromatography. Analytical gel filtration chromatography was done with a Superdex 200HR (10/30) column mounted on an ÁKTA FPLC and equilibrated and eluted at 24°C, at a flow rate of 0.25 ml min1, with a solution of 50 mM Tris-HCl, pH 7.5, containing 0.15 M NaCl. The sample contained 0.1 mg of the protein of interest in 0.25 ml. Protein in the effluent was monitored by the optical absorption at 280 nm. A semilogarithmic plot of the molecular masses of marker proteins (from Amersham Biosciences or Sigma or produced in our laboratory [14, 28, 44]) versus the distribution coefficient (Kd) for each protein was used for estimating the masses of AgDI and PTC. Kd values were calculated from the expression Kd = (Ve V0)/(Vi V0), where V0, Vi, and Ve are the elution volumes of dextran blue, water (estimated by monitoring conductivity), and the protein of interest, respectively.
Growth of protein crystals and data collection by X-ray diffraction. The sparse-matrix sampling vapor-diffusion method (22) was used for crystallization tests carried out in hanging drops in multiwell plates with commercial kits (Crystal Screen I and II from Hampton Research). The drops contained equal volumes (1 to 1.5 µl) of reservoir solution and of a 10-mg ml1 solution of PTC or AgDI, prepared by repeated centrifugal ultrafiltration of the enzyme in 50 mM Tris-HCl, pH 7.45, containing also, in the case of AgDI, 1 mM dithiothreitol and 20 mM NaCl. Crystals of the two enzymes grew in about 1 week at 21°C. The best PTC crystals were obtained in the presence of 430 µM PAPU, using a crystallization solution consisting of 125 mM (NH4)2SO4, 17% polyethylene glycol 3.35K (Hampton Research), and 0.1 M bis-Tris, pH 5.5. The best AgDI crystals were obtained in the presence of 5 mM agmatine, using as reservoir fluid 0.1 M HEPES (pH 7.5), 1.5 M sodium chloride, and 1.6 M ammonium sulfate. The crystals were harvested in the corresponding crystallization solution supplemented with 15% (vol/vol) glycerol as cryoprotectant, flash-cooled in liquid nitrogen, and diffracted at 100 K (Oxford Cryo-Systems) using synchrotron radiation (ESRF, Grenoble, France; beamline ID 23-2 for PTC and BM-16 for AgDI). The PTC and AgDI data sets, collected to 3 and 1.65-Å resolutions, respectively, were processed and scaled with MOSFLM and SCALA (CCP4 suite [6]). Table 1 gives the results of the data collection as well as the spatial group and size of the cell for each of the proteins.
|
View this table: [in a new window] |
TABLE 1. X-ray
data and structure refinement statistics
|
All of the diffraction data were used throughout the refinement process, except the 5% randomly selected data for calculating Rfree. Refinement converged to a final R value of 16.8% (Rfree = 19.2%). The final model, at 1.65-Å resolution, consisted of the chain spanning residues 2 to 367, 2 to 364, 2 to 368, 2 to 373, 1 to 368, 2 to 368, 2 to 367, and 2 to 366 for subunits A, B, C, D, E, F, G, and H, respectively. The model includes in all of the subunits one molecule of agmatine (as an amidine derivative [see Results]) covalently bound to Cys357. The stereochemistry of the model, checked with PROCHECK (27), is reasonably good. Table 1 summarizes the data on the refinement process and on the final model.
Other methods. Protein was assayed by the method of Bradford (5), using a commercial reagent from Bio-Rad and bovine serum albumin as a standard. SDS-PAGE was carried out as described by Laemmli (26). Sequence alignments were carried out with ClustalW (53), using default values. Superposition of structures was carried out with the program SSM (25). Buried surface areas were calculated using NACCESS (http://wolf.bms.umist.ac.uk/naccess). Figures of protein structures were generated using BOBSCRIPT (13), Raster3D (34), and Pymol (http://pymol.sourceforge.net/).
Materials. Purified recombinant E. faecalis ornithine transcarbamylase (3, 31) (specific activity, 4,021 U mg1) was a gift of J. Sellés, from this laboratory. PAPU was prepared and purified as previously reported (41) and had the expected contents of phosphate (determined after hot-acid digestion [4]) and free amino groups (assayed with ninhydrin [51] or by reverse-phase high-pressure liquid chromatography after ortho-phtaldialdehyde derivatization [43]; phosphoethanolamine was used as the standard). It yielded a mass (4700 Proteomic matrix-assisted laser desorption ionization-time-of-flight analyzer from Applied Biosystems; CIPF, Valencia, Spain) of 212.05 Da (expected mass of the monopositive ion, 211.2 Da). Agmatine, putrescine, cadaverine, ornithine, carbamoyl phosphate, and arcaine were from Sigma.
Atomic coordinate and structure factor accession number. The coordinates and structure factors have been deposited in the Protein Data Bank (http://www.rcsb.org/) with the accession code 2J2T.
|
|
|---|
The identification in the TIGR database of the first codon of the open reading gene for agcA is in error: there are two more upstream in-frame ATG codons, at 12 and 28 triplets from the proposed initiator ATG, of which the most upstream one is the genuine one because (i) it is the only one that is preceded, 12 bases upstream, by a good Shine-Dalgarno ribosomal binding sequence (AGAAGG [the base differing from the canonical sequence is underlined]); (ii) the protein expressed from this ATG is a highly active AgDI (see below); (iii) there is correspondence between these 28 N-terminal residues and the N-terminal sequence of the AgDI from P. aeruginosa (38); and (iv) in the crystal structure of E. faecalis AgDI presented here, all these residues except Met1 are well ordered and integrated into the enzyme crystal structure, as expected for a genuine portion of the natural enzyme. Therefore, this ATG is eight bases into the preceding agcD gene, and thus agcD and agcA overlap.
The product of the cloned agcB gene is genuine putrescine transcarbamylase.
The amino acid sequence encoded by the
first gene of the cluster, agcB (open reading frame spanning
nucleotides 689526 to 690545 of the E. faecalis genome), has
the same length (339 amino acids) and exhibits 31% sequence identity
with the OTC encoded by the arcB gene of the ADI operon of
E. faecalis (3).
The identity extends to the carbamoyl phosphate and
ornithine binding signature sequences 52STRTR and
268HCLP (the amino acid numbering corresponds to the
agcB-encoded protein sequence) and to 58 of the 85 residues
that are totally conserved in the anabolic and catabolic OTCs of P.
aeruginosa and in the arcB-encoded E. faecalis
OTC (3). However, as might
be expected if the product of the agcB gene were a
transcarbamylase that carbamylates a substrate different from ornithine
(although not much different, given the conservation of the ornithine
signature), 11 of the 14 residues that are invariant in these three
OTCs but that are not conserved or conservatively replaced in the
agcB product map in the C-terminal half of the enzyme,
corresponding to the putative ornithine domain of OTC. Further, the
invariant SMG sequence of OTCs, which belongs to a mobile loop that
encircles the substituents around the ornithine C
(47), is not conserved in
the putative product of agcB.
Cloning of agcB into the expression plasmid pET-22b(+) and overexpression of the gene has confirmed that the corresponding protein product is PTC. The plasmid-encoded His6-tagged protein, overexpressed in E. coli BL21(DE3) cells (see Materials and Methods), was produced in large amounts in soluble form upon IPTG induction and was purified essentially to homogeneity (Fig. 1B), in an approximate yield of 25 mg per liter of initial culture, by a simple procedure based on the use of Ni affinity chromatography. The electrophoretic mobility of the purified protein in SDS-PAGE (Fig. 1B) corresponded to an estimated mass of 40 kDa, in agreement with the expected mass, deduced from the sequence, of 40,091 Da. Fourteen cycles of N-terminal sequencing yielded the sequence MKRDYVTTETYTKE, which includes the N-terminal Met and which corresponds to the amino acid sequence expected from the gene sequence. As previously reported for genuine E. faecalis putrescine transcarbamylase, the protein appears to be a highly stable trimer, as judged from its behavior relative to that of other proteins of known mass when subjected to chromatography in a column of Superdex 200HR (Fig. 2).
![]() View larger version (11K): [in a new window] |
FIG. 2. Investigation
of the oligomeric state of E. faecalis PTC and AgDI, using gel
filtration. A semilogarithmic plot of molecular mass versus elution
volume (expressed as Kd [see Materials and
Methods]) from the Superdex 200HR column is shown. The circles
correspond to the following protein standards: cytochrome c
(12.3 kDa), lactalbumin (14.2 kDa), carbonic anhydrase (29.0 kDa),
ovalbumin (42.7 kDa), bovine serum albumin (66.4 kDa), the dimer of
bovine serum albumin (132.9 kDa), Pyrococcus furiosus
carbamate kinase (68.8 kDa), intact (97.1 kDa) and truncated (31.9 kDa)
aspartokinase III of E. coli, alcohol dehydrogenase (146.8
kDa), aldolase (156.8 kDa), Thermotoga maritima
N-acetyl-L-glutamate kinase (182.0 kDa), amylase
(223.8 kDa), catalase (230.3 kDa), ferritin (440 kDa), and
thyroglobulin (669 kDa). The triangle and square denote, respectively,
the positions of elution of the peaks of E. faecalis PTC and
AgDI, assuming that PTC is a trimer (sequence-deduced mass, 120,273 Da)
and AgDI is a tetramer (deduced mass, 165,412
Da).
|
PAPU is a very potent and highly selective inhibitor of PTC. Studies with aspartate and ornithine transcarbamylases demonstrated that phosphonoacetyl-L-aspartate (7) and phosphonoacetyl-L-ornithine (35) are, respectively, highly potent inert bisubstrate inhibitors of these enzymes. Since these inhibitors have been successfully used in crystallization trials with these two enzymes (21, 47) that led to the determination of their three-dimensional structures by X-ray diffraction, we reasoned that PAPU might be also a very potent and highly specific inhibitor of PTC and, if so, that it might help enzyme crystallization (see below). Although PAPU was synthesized previously (41), to our knowledge it has never been used with PTC. Figure 3A shows that PAPU, at micromolar concentrations, is a very potent inhibitor of PTC, causing complete inhibition. In contrast, this compound, at the same concentrations, does not inhibit E. faecalis OTC, highlighting the selectivity of this inhibitor for PTC. The inhibition is noncompetitive versus putrescine (Fig. 3B) and competitive versus carbamoyl phosphate (Fig. 3C), as expected if substrate binding in the PTC reaction is ordered, with carbamoyl phosphate binding first. From the slope of the plot of the apparent Km for carbamoyl phosphate versus the concentration of PAPU (Fig. 3C), a Ki value of 10 nM can be estimated for PAPU. This low Ki value highlights the high affinity of the enzyme for this bisubstrate inhibitor, thus offering good opportunities for the preparation of PAPU-containing crystalline complexes of PTC that might shed structural light on substrate binding by, and specificity of, the enzyme.
![]() View larger version (10K): [in a new window] |
FIG. 3. Effects
of PAPU on E. faecalis PTC activity. (A) Inhibition
and lack of inhibition of E. faecalis PTC and OTC,
respectively, by PAPU. Activities are given as fractions of the
activity in the absence of PAPU. (B and C) Influence of PAPU on the
kinetic parameters of PTC for putrescine (Put) and on the
Km for carbamoyl phosphate (Carb-Pi),
respectively.
|
0.3 mm (Fig.
1D, top panel), grew in
about 1 week in the presence of 0.43 mM PAPU, with
(NH4)2SO4 and polyethylene glycol
3.35K (from Hampton) used as crystallizing agents. The crystals
diffract X-rays (ESRF synchrotron ID 23-2 source) at 3-Å
resolution, allowing determination of the space group of the crystal
(Table 1), which is
hexagonal P6322, with a unit cell that would allow
accommodating two or three enzyme subunits in the asymmetric unit,
depending on whether 55% or 33% of the volume of the crystal is
occupied by the solvent. We are presently in the process of searching
for the phases by molecular replacement, using the structure of OTC
from Pyrococcus furiosus (PDB file 1A1S) as the search
model. Properties of the product of the agcA gene, agmatine deiminase. Using the most upstream ATG of the open reading frame (see "Agmatine catabolism gene cluster of E. faecalis V583," above), the coding region for the third gene of the cluster, agcA, spans nucleotides 691981 to 693078 of the E. faecalis genome. The predicted protein product has a nearly identical length (365 versus 368 amino acids) and exhibits 54% sequence identity with respect to the AgDI encoded by the aguA gene of P. aeruginosa (38). In contrast, there is no significant identity (11.6% identity, with 11 gaps) with the 408-residue sequence for the ADI of E. faecalis (3). Nevertheless, the Clustal W alignment of the AgDI and ADI sequences (not shown) aligns a cysteine residue that is near the C termini of both sequences (Cys357 of AgDI) and which is conserved in both ADIs and AgDIs and plays an analogous key catalytic role in both enzymes (see our structural data on AgDI below).
The agcA gene, cloned from
the most upstream ATG codon in the expression plasmid
pET-22b(+), triggered upon IPTG induction massive expression of
the expected protein (Fig.
1C), in soluble form, as
shown by the appearance of a large band in SDS-PAGE with a mass (46
kDa) corresponding (within experimental error) to the expected mass of
the recombinant protein (43,778 Da, including an extra 2,589 Da due to
the 24-residue C-terminal His6-containing extension
VGGKQNSSSVDKLAAALEH6). The extracts of the cells
expressing the protein, but not those transformed with the empty
parental pET-22 plasmid, exhibited important AgDI activity (Fig.
1, bottom) whereas ADI
activity in the same extracts was nil. The recombinant enzyme, purified
by a combination of two Ni affinity chromatography steps and a gel
filtration step, was obtained in high yield (
40 mg per liter
of initial culture) in a highly homogeneous form (Fig.
1C) and was proven by gel
filtration (and also by the crystal structure [see below]) to be
tetrameric (Fig. 2). This
is a substantial difference with respect to the AgDIs that are involved
in polyamine synthesis, which appear to be dimeric
(23,
37,
59). Nevertheless, E.
faecalis AgDI resembles the well-characterized
polyamine-synthesizing AgDIs of corn and Arabidopsis thaliana
(23,
59) in the relatively low
Km value for agmatine (35 ± 3 µM,
versus 12 and 110 µM for corn and A. thaliana AgDIs,
respectively) and in the similar magnitude of the activity at agmatine
saturation (22.3 ± 0.4 U mg1, versus
respective activities of 32 and 26 U mg1 for corn
and A. thaliana). These results differ importantly from those
for the only bacterial AgDI studied biochemically, the AgDI of the
arginine decarboxylase (ADC) pathway of P. aeruginosa
(37), for which a much
larger Km value (0.6 mM) and an
4-fold-lower specific activity, relative to the E.
faecalis enzyme, were reported. However, these differences may not
be real, given the methodological difficulties with colorimetric
activity assays at low substrate concentrations and given the
instability of AgDI upon large dilution in the assay solution (which
was prevented in our case by adding 1 mg ml1 bovine
serum albumin). Similarly to all previous reports with AgDIs from other
sources (23,
37,
60), the E.
faecalis enzyme appears to be highly specific for agmatine, not
using L-arginine (Fig.
1, lower panel),
L-argininamide, or arcaine (1,4-diguanidinobutane). Arcaine
was reported to be a competitive inhibitor (relative to agmatine) of
the corn (59) and
cucumber (46) enzymes,
with Ki values of
3 and 7 µM, and
we have found this compound also to be a competitive inhibitor of
E. faecalis AgDI, with a Ki value of 28
± 5 µM.
AgDI and ADI share the same basic fold.
AgDI
monocrystals of up to 1 mm in length (Fig.
1D, bottom panel)
diffracted X-rays to 1.65 Å, allowing the determination of the
crystal structure of the enzyme at atomic resolution. The asymmetric
unit of the AgDI crystals (Table
1) contains eight subunits
organized as two tetramers having identical structure. When
superimposed, the root mean square deviation (RMSD) for monomers is
0.17 Å (for 364 C
atoms). Each of the monomers has a
globular fold with approximate dimensions of 53 by 45 by 40
Å3. The monomer has a tertiary fold
similar to that of the catalytic domain of ADI (Fig.
4A and
B), although it lacks the five-helix bundle domain of this
enzyme (9). Thus, the AgDI
monomer has the fan-like structure with five blades that is a
distinctive trait of ADI and which results from a fivefold
pseudosymmetric structure in which each repeating element consists of a
three-stranded mixed ß sheet and a helix in a
ßß
ß arrangement. Given the absence in
AgDI of the five-helix bundle that in ADI distorts the fan-like
structure, the AgDI monomer is closer to fivefold pseudosymmetry than
the catalytic domain of ADI (Fig. 4A
and B). Nevertheless, the first repeat diverges from the
canonical structure of the repeat, since it has two helices and the
arrangement ß
ß
ß, and it is
flanked near the fivefold pseudosymmetry axis by the C-terminal strand
running antiparallel to the other three strands. The lengths and amino
acid sequences, however, vary considerably from one element to another
(Fig. 4E) and from those
in the catalytic domain of ADI (not shown), and indeed, the
superposition of AgDI with the catalytic domain of ADI (from subunit A
of the Mycoplasma arginini enzyme [PDB file 1S9R]) yields a
relatively large RMSD (2.77 Å for 238 C
atoms). A
distinctive characteristic of the AgDI monomer fold is the existence of
large loops emerging on the side of the fan corresponding to the C end
of the two parallel strands of the repeats (Fig.
4E and bottom part of Fig.
4F). Particularly large is
the loop that emerges from the end of repeat 4, which includes a
ß hairpin (ß15 and ß16). This loop folds flat
over the other loops and over a protruding long
helix that
emerges from repeat 1 (helix 2, Fig.
4E) in the same direction
as the loops. The presence of these loops and of the protruding
helix 2 renders highly different the two faces of the monomer
that correspond to opposite edges of the repeats ß sheets and
also serves the purposes of forming the active center and of providing
interactions with the other subunits to form the tetramer (see below).
Because of the presence of these loops on one side of the subunit, and
also since the
helix of each repeat fills the space between
adjacent repeats diverging from the pseudosymmetry axis, the subunit
has a ball-like rounded shape (see each subunit in Fig.
4F and
G).
![]() View larger version (58K): [in a new window] |
FIG.4. Structure
of AgDI. (A and B) Ribbon representations of the monomer of E.
faecalis AgDI (A) and of the catalytic domain of
Mycoplasma arginini ADI (PDB entry 1S9R without residues 75 to
148, which are not a part of the catalytic domain) (B), both containing
the covalently bound substrate in space-filling representation.
helices, ß sheets, and loops are colored red, yellow,
and green, respectively. (C) Stereo view of the active site
of AgDI, showing the density map of 2Fobs
Fcalc, contoured at the 0.9 level, around
the covalent adduct. The substrate is colored yellow, and the
surrounding protein residues are colored gray. O, N, and S atoms are
colored red, blue, and green, respectively. (D) Interatomic
distances (in angstroms) between the catalytic protein residues and the
substrate around the reactive carbon center. The interactions with a
fixed water molecule (W1) believed to be important in the mechanism are
also represented. The density map of 2Fobs
Fcalc, contoured at 0.75 for
the covalent amidino complex, is shown. (E) Correspondence
between amino acid sequence and secondary structure. Bars, arrows, and
lines above the structure denote, respectively, helices,
ß strands, and loops (only long loops are depicted), numbered
in ascending order from N to C terminus and, when belonging to a
repeat, in parentheses and having a subscript that denotes the repeat
number. Open triangles under the sequence denote residues having
decreased accessibility upon the binding of agmatine. Circles denote
decreased accessibility upon dimer (open) and tetramer (shaded)
formation. The gray sequence backgrounds highlight residues that are
invariant in the AgDIs of E. faecalis, Streptococcus
mutans, Pseudomonas aeruginosa, and Arabidopsis
thaliana (SwissProt accession numbers
Q837U5, Q8DW17, Q9I6J9, and Q8GWW7,
respectively). (F) Ribbon diagram of AgDI dimer viewed
perpendicularly to the molecular twofold axis. Coloring and substrate
representation are as in panel A. (G) Ribbon representation
of the AgDI tetramer viewed along one of the three twofold molecular
axes. The two subunits of the two dimers (as defined in the
text) are shown in different shades of red or blue. The covalently
bound substrate is shown in space-filling
representation.
|
atom (the C atom of the guanidinium
group of agmatine) covalently linked with the S atom of
Cys357. Agmatine is bound centrally (Fig.
4A), approximately along
the fivefold pseudosymmetry axis near its exit from the loop-rich side
of the fan, in a closed, elongated, and crowded cavity. The central
position results in the involvement in the building of the site of
elements connected to all five repeats of the subunit. Thus, the site
is formed between the long loop of repeat 2 and the loops that connect
repeats 5 to 1, 1 to 2, and 3 to 4. The cavity is closed at its entry
by a three-tongued gate formed by the loop of repeat 2 and by the long
loops connecting repeats 3 to 4 and 4 to 5 (seen laterally in Fig.
4F). In our structure the
closure is ensured by mutual interactions between some residues of
these loops, although it is clear that these loops have to retreat at
the beginning and at the end of the catalytic cycle, to allow substrate
binding and carbamoyl putrescine release. The extended substrate runs
parallel to and makes extensive Van der Waals contacts with a straight
stretch of three glycines (Gly351-Gly352-Gly353), also making a
hydrogen bond between the agmatine amino group and the O atom of
Gly351. These glycines are a part of the conserved sequence
(G/A)GGNIHCITQQ(E/Q)P, which includes
the catalytic cysteine (underlined) and which can be considered a
signature of AgDI. The four-carbon portion of the molecule of agmatine
is also surrounded by the indolic rings of the invariant Trp93 and
Trp119 (Fig. 4C), which
are like flat tiles that wall the substrate binding cavity, and by the
methyl group of invariant Thr215. The agmatine amino group also makes a
bond with the
-COO of Glu214 (Fig.
4C), a residue that may
play a key role in making the enzyme extremely selective against
arginine, since it would not favor placing near it another negatively
charged group as would be the case for the carboxylate group of
arginine. In any case, the region that surrounds carbon 1 of agmatine
is packed with predominantly hydrophobic groups, leaving no room for a
carboxyl or for any other group of substantial size, and less so if the
group is polar and charged as in an
-carboxylate. On the
opposite end of the agmatine molecule, around the guanidinium group,
the invariant residues Asp96, His218, and Asp220 surround the bound
substrate and play catalytic roles (Fig.
4C and D) (see
below).
The covalent adduct provides a snapshot of AgDI catalyzing its reaction.
A close examination of the electron
density around the C
atom of agmatine (Fig.
4D) shows that this carbon
is covalently linked with the S atom of Cys357 (C-S bond distance, 1.79
Å) and with two nitrogens (N
and N
2). The
C
in our structure is somewhat displaced from the plane formed
by its three covalent ligands (S, N
, and N
2 atoms)
towards a water molecule (W1, Fig.
4D) which is located at
only 2.5 Å (a very short distance for nonbonded C and O atoms).
The water molecule is fixed by hydrogen bonds to one O atom of each of
the two side chain carboxylates of Asp220 and Asp96 and to the
1N atom of His218. In turn, the
2N of His218 is
linked to the
-COO of Glu157. A similar
adduct was reported with ADI within a complex which replicates
essentially all of the details of the present complex, including the
presence and the interactions of the fixed water
(9). This complex was
interpreted to represent the covalent amidino complex proposed long ago
to be formed in the mechanism of ADI
(9,
16). Therefore, the
present complex is highly indicative of a common, very strictly
conserved mechanism of deimination by ADI and AgDI. This mechanism
(Fig. 5)
involves two tetrahedral intermediates but only one amidino adduct.
Nevertheless, the amidino adduct must exist first in the presence of
the leaving ammonia and later in the presence of the attacking water.
Thus, the W1 molecule could also correspond to ammonia, and the present
adduct may represent either the amidino compound with the leaving
ammonia or the same compound with the attacking
water.
|
View larger version (10K): [in a new window] |
FIG. 5. Proposed
five-step mechanism for the AgDI reaction. Step 1 leads to the
formation of the first tetrahedral carbon center intermediate as a
consequence of the attack by the activated thiol of Cys357. Asp96 and
the nonprotonated primary N of the guanidinium group may induce
deprotonation of the thiol group. A proton is extracted by His218,
which forms a charge relay system with Glu157. In step 2 the
tetrahedral intermediate collapses to the triagonal amidino
intermediate, with liberation of ammonia. Asp96, Asp220, and His218
help stabilize the leaving ammonia and the positive charge development
in the amidino group. In step 3 ammonia is replaced by water positioned
for attack on the carbon center, interacting with the same groups as
the ammonia. The intermediate revealed here by X-ray crystallography
corresponds to one of the two complexes (either the ammonia or the
water complex) with the amidino intermediate. Step 4 is the formation
of the second tetrahedral carbon intermediate. His218 helps this step
by abstracting one proton from water. The final step is the collapse of
the tetrahedral intermediate to carbamoylputrescine and the regenerated
thiol
group.
|
helix 4, the helix belonging to the second repeat.
These interactions are generally hydrophobic in the core region and
polar towards the periphery, and the surface involved amounts to an
average of 991 Å2 per monomer (determined with a
probe radius of 1.4 Å) or
6.9% of the surface of each
monomer. The two subunits in the dimer leave a valley between them
(Fig. 4F) in the loop-rich
face. It is this valley which is used for tetramer formation by having
the valley of one dimer interact in a crossed-over way with the valley
in the other dimer, so that the twofold axes of the two dimers are
coincident and the longest axes of the two dimers run in perpendicular
directions (Fig. 4G). One
subunit (called A for the purpose of this description) of one dimer
interacts with the two subunits of the other dimer (here called C and
D). The N termini of helices 2 from A and C interact mutually, and
residues 286 to 289 of the long hairpin loop that connects repeats 4
and 5 of A interact with the outer surface of helix 3 and also with the
N-terminal turn of helix 2 of C, and vice versa. The interactions
between A and D are restricted to mutual hydrophobic contacts between
the long loop of repeat 2 of both subunits. The buried surface per
monomer is 639 Å2 for the interactions between A and
C and only 252 Å2 for those between A and D.
Overall, each monomer has in the tetramer a buried surface of 1,927
Å2, accounting for 13.5% of its total accessible
surface area and explaining the stability of the enzyme tetramer that
has been observed in the present
studies. |
|
|---|
5-fold higher) (the
low PTC activity is not due to the poly-His tail, since wild-type PTC
isolated from E. faecalis has even somewhat less activity
[56]) made it desirable
to confirm that this enzyme is a genuine PTC, which has been done here
by demonstrating that this enzyme is powerfully inhibited by very low
concentrations (Ki = 10 nM) of the
PTC-specific bisubstrate analog inhibitor PAPU, a compound that does
not inhibit OTC at similar concentrations. Since E. faecalis OTC and PTC share 31% sequence identity, either these two enzymes derive from a common ancestor of broad specificity or, perhaps more likely since OTC cannot use putrescine, PTC may derive from OTC and may not have yet perfected discrimination between putrescine and ornithine, with the process of shifting specificity possibly having resulted in somewhat compromised catalytic efficiency. To discriminate between these possibilities and to clarify the determinants of specificity and catalytic efficiency, it would be important to compare the structures of PTC and OTC, a goal that is now at closer reach thanks to the use of PAPU, since we report here the production of X-ray-diffracting PTC crystals generated in the presence of this bisubstrate inhibitor.
We have also characterized, both functionally and structurally, the protein product encoded by agcA as AgDI. The structure of this enzyme closely resembles that of ADI, the enzyme that catalyzes the same reaction except for the use of arginine as a substrate, exhibiting the characteristic five-blade propeller fold presented by the catalytic domain of ADI (9, 15), with the substrate, also similarly to ADI, binding in a deep, central, very tight cavity. We have found here that AgDI, again similarly to ADI (9, 16), makes a covalent substrate amidino adduct involving a catalytic thiol group belonging to a conserved Cys residue that is close to the enzymes' C termini. Thus, ADI and AgDI are homologous enzymes, although the lack of significant sequence identity between them indicates a long period of divergence. The inability of each of these enzymes to use the substrate of the other (3, 37; this paper) further suggests that the separation between ADI and AgDI occurred long ago, with enough time for optimization of substrate specificity.
The
AgDI studied here, committed to making ATP fermentatively from agmatine
(48), exhibits
50% sequence identity (not shown) with the more widespread
AgDIs, which belong to the ADC pathway and are involved in polyamine
production (37,
38) (although this
pathway can also serve for agmatine utilization as a carbon and
nitrogen source, as in Pseudomonas aeruginosa
[19,
52]). The most relevant
difference is that ADC pathway AgDIs appear to be dimeric
(23,
37,
59), whereas E.
faecalis AgDI is tetrameric, although in fact it is a dimer of
dimers and thus even in this aspect does not depart much from the
characteristics of the ADC pathway AgDIs. Since AgDIs exhibit neither
cooperativity for the substrate nor regulatory properties
(46), we presently have
no indications that the degree of oligomerization of AgDIs is important
functionally.
Although not studied experimentally here, there can be little doubt that the product of agcC (Fig. 1A) is a true CK, since it is only one amino acid shorter than and exhibits 49% sequence identity (data not shown) with the CK of the E. faecalis ADI operon (30), an enzyme for which the three-dimensional structure was determined (29). Since the CKs involved in arginine and agmatine catabolism appear similar and there is no evidence of CK regulation by effectors (32), one plausible reason for having two separate CK isozymes in each of these pathways may be to facilitate concerted expression of all the genes of one or the other pathway. The important sequence identity of these two CK isozymes indicates that their separation is not remote. In contrast, the lack of significant sequence identity (14%) between the E. faecalis arcD and agcD gene products (the putative arginine/ornithine and agmatine/putrescine antiporters) indicates ancient divergence, the homology of these genes being supported by the similarity of the polypeptide lengths (483 and 458 residues, respectively) and transmembrane helix predictions (11 to 12 helices) and also by the analogous functions and substrates of the antiporters.
The comparison of the genes of the ADI and AgDI pathways contradicts the naïve view that the two pathways might have arisen by a process of duplication of a complete ancient four-gene cluster. As already indicated, the deiminase and antiporter components of both pathways have evolved separately for much longer than the transcarbamylase and carbamate kinase components, in contrast with the expectation for a common duplication event for all of the elements of the gene cluster, followed by coevolution. Nevertheless, the genes for the transcarbamylase and for CK may have duplicated simultaneously, given their similar degree of conservation in one gene cluster relative to the corresponding genes in the other cluster and also since in both clusters the transcarbamylase gene physically precedes the CK gene. Since agmatine utilization cannot precede agmatine production, the close relationship between the AgDIs of the ADC and AgDI pathways suggests that the latter may have derived from an ADC pathway gene for AgDI. The evolution of AgDI may have been initiated by its divergence from ADI to serve the purpose of polyamine synthesis. Much more recently, AgDI may have become committed into a novel route of agmatine catabolism, made by recombining elements of the ADI pathway with the arginine decarboxylase pathway element AgDI and with an agmatine antiporter of obscure origin.
An important contribution of the
present work is the clarification of the structure and, based on the
structure, of the reactional and catalytic mechanisms of AgDI. The high
affinity of AgDI for agmatine is accounted for by the extension and
closeness of the interactions between substrate and enzyme, since
agmatine is buried, fitting tightly a binding site where there is no
empty space. The high specificity is explained by the negative charge
at the entry of the site provided by Glu214, which would not fit the
placement of the
-carboxylate group of arginine, and also by
the very crowded environment where even minor volumes around the C1 of
agmatine would be excluded. The relatively low kcat
for a hydrolase exhibited by AgDI (17 s1 at
37°C) may be explained by the deepness of the site, with the
catalytic groups far into the subunit structure, and also by the
existence of a gating mechanism at the entry of the site that has to
open, close, and open again in each catalytic cycle, possibly limiting
substrate access or product release. Agmatine binding may trigger site
closure, since the amino end of the substrate interacts with elements
of the loops that contribute to the gating mechanism, particularly with
Glu214. Since the formation of the covalent adduct with the thiol group
of Cys357 should shorten somewhat the bound molecule, the closing
mechanism could be described as "pulling the gate from the
inside" by the covalently bound substrate. The importance of
substrate binding for gate closure is supported by the observation of
the deposited structure of S. mutans AgDI, which contains no
bound agmatine and where the largest loop involved in the gating
mechanism is retracted and the site is more accessible. Our structure,
containing the covalently bound substrate, is closed and would have to
be open at the end of the reaction. The simplest triggering mechanism
to open the gate could be defined as "pushing the gate from the
inside," whereby the increase in the volume resulting from the
coexistence of the ureido group in carbamoyl putrescine and the free
thiol in Cys357 may result in some displacement of the molecule of the
product towards the gate, particularly given the extreme narrowness of
the site, which should not allow bending of the bound
product.
Puzzlingly, in our crystal structure the enzyme has retained the covalent amidino adduct without progressing further along the reactional path. The corresponding analog for arginine has also been reported for ADI (9). The presence of the trapped intermediate strongly suggests that some component in the crystallization solution has stabilized the amidino intermediate, in fact resulting in enzyme inhibition. Perhaps ammonia, present in our solution at a concentration of 3.2 M, has resulted in the stabilization of the ammonia-containing amidino complex (W1 in our structure could equally be ammonia), blocking further reaction with water (Fig. 5). Whatever the mechanism, the observation of the complex has had the value of clarifying substrate binding and catalysis. The catalytic process involves centrally, as in the case of ADI (9, 15), a charge relay system consisting of Glu157 and His218, which promotes formation of the tetrahedral intermediates by providing or withdrawing a proton, and Cys357 with its SH group being abnormally acidic, perhaps because of the presence of the guanidinium group of the substrate and possibly also by the inducing effect of the nearby (3 Å away) carboxylate of Asp96. We are presently undertaking studies to subject to experimental tests, by site-directed mutagenesis, the roles proposed on the basis of the structure for catalysis of the reaction by these residues.
We thank the ESRF personnel for expert help; A. Marina and M. López for diffracting AgDI; J. J. Calvete (IBV-CSIC, Valencia, Spain) for N-terminal sequencing; D. Gigot (Université Livre de Bruxelles, Belgium) for advice; A. Cantin and M. A. Miranda (ITQ-CSIC, Valencia, Spain) for help with the synthesis of PAPU; C. Aguado (CIPF, Valencia, Spain) for matrix-assisted laser desorption ionization-time-of-flight mass spectrometry; and J. Sellés, P. Tortosa, and L. Osuna (IBV-CSIC, Valencia, Spain) for technical help.
Published ahead of print on 6 October 2006. ![]()
J.L.L., L.M.P., and S.T. contributed equally to this work. ![]()
|
|
|---|
-(phosphonacetyl)-L-ornithine, a potent
transition state analogue inhibitor of ornithine carbamoyltransferase.Biochem. Biophys. Res. Commun.
76:900-904.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»