Previous Article | Next Article ![]()
Journal of Bacteriology, March 2007, p. 1664-1674, Vol. 189, No. 5
0021-9193/07/$08.00+0 doi:10.1128/JB.01192-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

and
Dietmar H. Pieper*
Division of Microbiology, HZIHelmholtz Zentrum für Infektionsforschung, Inhoffenstrasse 7, D-38124 Braunschweig, Germany
Received 1 August 2006/ Accepted 5 December 2006
|
|
|---|
|
|
|---|
Pseudomonas sp. strain MT1 has been reported to degrade 4- and 5-chlorosalicylate by a different metabolic route (32). The substrates are transformed by a salicylate 1-hydroxylase into 4-chlorocatechol, which is subject to ring cleavage by catechol 1,2-dioxygenase to yield 3-chloromuconate. It is suggested that trans-dienelactone hydrolase acts on 4-chloromuconolactone as an intermediate in the muconate cycloisomerase-catalyzed transformation of 3-chloromuconate, thus preventing protoanemonin formation in favor of maleylacetate (32). Maleylacetate is reduced to 3-oxoadipate by maleylacetate reductase. Chlorocatechol degradation in strain MT1 was thus assumed to occur by a pathway consisting of a patchwork of reactions known from the 3-oxoadipate pathway (catechol 1,2-dioxygenase, muconate cycloisomerase), the chlorocatechol pathway (maleylacetate reductase), and a trans-dienelactone hydrolase. However, the kinetic parameters of the characterized muconate cycloisomerase (that is, its preference for 3-chloromuconate over muconate as a substrate) set it apart from previously characterized muconate cycloisomerases (32, 53, 58). Moreover, salicylate degradation via catechol is usually performed via meta cleavage, and an operon structure comprising genes encoding a LysR type regulator (NahR), a salicylate 1-hydroxylase (NahG), a catechol 2,3-dioxygenase (NahH), and subsequent enzymes of the meta cleavage pathway is usually conserved (2, 9, 63). However, no extradiol dioxygenase activity was observed in either salicylate-grown or chlorosalicylate-grown cells of MT1 (32), suggesting that the gene encoding salicylate 1-hydroxylase is not clustered with the meta cleavage pathway.
In the current report we analyzed the genetic organization and expression of two catabolic gene clusters of MT1. Detailed characterization of the kinetic parameters of the enzymes encoded revealed that one of the clusters was specifically adapted for channeling substituted salicylates into the catechol ortho cleavage pathway.
|
|
|---|
Enzyme assays. Salicylate hydroxylase (SalOH), C12O, catechol 2,3-dioxygenase, and MCI were measured spectrophotometrically as described previously (3, 11, 53, 61). 4-Methylmuconolactone 4-methylisomerase activity was determined by high-performance liquid chromatography (HPLC) following its transformation into 3-methylmuconolactone (43). The activities of muconate cycloisomerases MCIcatB and MCIsalC with 2-chloromuconate (100 µM) and 3-chloromuconate were determined by HPLC. As much as 1 U/ml of purified enzymes was used for determining 2-chloromuconate transformation, whereas 3-chloromuconate transformation was determined using 5 to 30 mU/ml (MCIcatB) or 0.2 to 1 mU/ml (MCIsalC) (units were measured with 0.1 mM muconate as a substrate).
Specific activities (units per gram of protein) are expressed as micromoles of substrate converted or product formed per minute per gram of protein at 25°C. Protein concentrations were determined by the Bradford procedure using the Bio-Rad protein assay with bovine serum albumin as a protein standard (4).
Analysis of kinetic data. Vmax, kcat, and apparent Km values of C12O's with catechols were determined using 1 to 100 µM substrate in air-saturated buffer, and kinetic data were calculated from the initial velocities using the Michaelis-Menten equation by nonlinear regression (KaleidaGraph; Synergy Software). Since very low Km values were indicated by this method, kinetic data were finally determined from progress curves obtained from reactions with initial substrate concentrations of 10 µM, as previously described for determination of low Km values of catechol 2,3-dioxygenases (20). The data sets obtained were fit to the Michaelis-Menten equation by nonlinear regression (KaleidaGraph; Synergy Software).
Vmax, kcat, and apparent Km values of SalOH with NADH were determined using 2 to 100 µM NADH and 200 µM salicylate in air-saturated buffer, and those with differently substituted salicylates were determined using 200 µM NADH and 1 to 100 µM substrate. Rate constants of SalOH with 5-chlorosalicylate were also determined from progress curves obtained from reactions with initial substrate concentrations of 10 µM. The kinetic parameters of MCIcatB and MCIsalC with muconate, 2-methylmuconate, and 3-methylmuconate were determined using 5 to 100 µM substrate. Transformation of 3-chloromuconate was determined by HPLC analysis at substrate concentrations of 50 µM to 500 µM. Samples were taken during the reaction time, and protoanemonin formation was directly analyzed by HPLC analysis. At least two independent experiments were performed for each value. Km and Vmax values were calculated by nonlinear regression to the Michaelis-Menten equation by using KaleidaGraph (Synergy Software). Turnover numbers (kcat values) were calculated assuming subunit molecular masses of 34,209 (C12OcatA), 34,233 (C12OsalD), 41,076 (MCIcatB), 40,248 (MCIsalC), and 50,712 (SalOH) Da, respectively.
Enzyme separation and purification. SalOH, catechol 1,2-dioxygenases (C12OcatA and C12OsalD), and muconate cycloisomerases (MCIcatB and MCIsalC) were purified from cell extracts of salicylate-, 4-methylsalicylate-, or 5-chlorosalicylate-grown cells using a fast protein liquid chromatography system (Amersham Biosciences). All protein elutions were performed in Tris-HCl (50 mM, pH 7.5, 2 mM MnCl2).
For analyzing the presence and abundance of C12OcatA, C12OsalD, MCIcatB, and MCIsalC under different growth conditions, cell extracts (10 to 25 mg of protein) were mixed with 4 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4 and were applied to a SOURCE 15PHE PE 4.6/100 (hydrophobic interaction) column (Amersham Pharmacia Biotech). Proteins were eluted by a linear gradient of (NH4)2SO4 (1 M to 0 M) over 25 ml with a flow of 0.25 ml/min. Fraction volumes were 0.5 ml. Hydrophobic interaction chromatography (HIC) separated C12OcatA (0.16 ± 0.04 M) and C12OsalD (0.45 ± 0.04 M) and partially separated MCIcatB (0.12 ± 0.06 M), and MCIsalC (0.06 ± 0.06 M). Since HIC was not suitable for SalOH detection, the presence and abundance of SalOH were analyzed by separation through anion-exchange chromatography using a MonoQ HR 5/5 column (Amersham Pharmacia Biotech). Cell extracts were directly applied and proteins eluted by a linear gradient of 0 to 0.5 M NaCl over 25 ml with a flow of 0.2 ml/min. SalOH eluted at 0.17 ± 0.02 M NaCl. C12OcatA and C12OsalD coeluted at 0.28 ± 0.02 M NaCl, and MCIcatB and MCIsalC coeluted at 0.24 ± 0.02 M NaCl.
For purification of C12OcatA and C12OsalD, 40 mg of protein from salicylate-grown cells was applied to a MonoQ HR 5/5 column and the proteins eluted as described above. Fractions containing C12O activity were combined, concentrated by Centricon YM-50 (Millipore) to a final volume of 1 ml, and supplemented with 2 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4. Subsequent HIC, as described above, resulted in separation of C12OcatA and C12OsalD.
For purification of SalOH and MCIcatB, two 40-mg aliquots of protein from salicylate-grown cells were applied to a MonoQ HR 5/5 column and the proteins eluted as described above. Fractions containing muconate cycloisomerizing or salicylate hydroxylase activities were pooled separately and concentrated to final volumes of 1 and 0.2 ml, respectively. The muconate cycloisomerase-containing protein solution was supplemented with 2 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4 and was separated by HIC, as described above. Fractions eluting at 0.12 ± 0.04 M and exhibiting high activity against muconate but low activity against 3-methylmuconate (MCIcatB) were pooled, whereas fractions eluting at 0.06 ± 0.06 M and exhibiting relatively high activity against 3-methylmuconate (MCIsalC) were discarded. The pooled fractions were further concentrated by ultracentrifugation and separated by HIC using a linear gradient of (NH4)2SO4 (0.5 M to 0 M) over 17 ml with a flow rate of 0.25 ml/min. Fractions with high activity against muconate but low activity against 3-methylmuconate eluted at 0.14 ± 0.06 M (NH4)2SO4 and were pooled. Fractions eluting at <0.14 ± 0.06 M (NH4)2SO4 were discarded, since they may contain minor amounts of contaminating MCIsalC.
SalOH was further purified by gel filtration using a Superose 12 HR10/10 column (Amersham Pharmacia Biotech) with 20 ml Tris-HCl (50 mM, 100 mM NaCl, pH 7.5) as an eluent with a flow rate of 0.3 ml/min. Two fractions (0.5 ml each) exhibiting high activity with salicylate were pooled.
MCIsalC was purified from 5-chlorosalicylate-grown cells as previously described (32).
Electrophoretic methods. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed on a Bio-Rad Miniprotein II apparatus as previously described (26), with acrylamide concentrations of 5 and 10% (wt/vol) used for the concentrating and separating gels, respectively. The proteins were stained with Coomassie brilliant blue (Serva). A PageRuler protein ladder (Fermentas) was used as a marker.
Quantification of proteins in partially purified fractions. For quantification of C12O proteins, MCIcatB, and SalOH in partially purified fractions, 0.3 to 15 µg of protein was separated by SDS-PAGE. Gels were stained with Ruthenium II tris (bathophenantroline disulfonate) as previously described (20) and scanned using a Fujifilm LAS-1000 charge-coupled device camera. The fluorescence intensity was integrated, and the relative intensities of the bands corresponding to C12OcatA, C12OsalD, MCIcatB, and SalOH were determined using the AIDA 2.1 software package (Raytest Isotopenmessgeräte GmbH).
Amino acid sequencing. N-terminal amino acid sequences were determined as previously described (19).
DNA isolation and preparation of genome libraries. Genomic DNA of Pseudomonas sp. strain MT1 was isolated with the G NOME DNA kit (BIO 101 Systems). A fosmid library was prepared in pCC1FOS according to the manufacturer's recommendations (Epicentre). Genomic DNA was randomly sheared by pipetting to give approximately 40-kb fragments for ligation into pCC1FOS. Ligated DNA was packaged with MaxPlax Lambda packaging extracts, transduced into Escherichia coli strain EPI300-T1, and spread onto LB agar plates containing 12.5 µg/ml chloramphenicol. A total of 282 individual clones were analyzed.
For preparation of the phage library, DNA was partially digested with Sau3AI and size fractionated by ultracentrifugation in a sucrose gradient (51). After overnight precipitation with polyethylene glycol 6000, the recovered fraction of 4- to 12-kbp DNA fragments was ligated into the BamHI/calf intestine alkaline phosphatase-treated ZAP Express vector (Stratagene). Gigapack III gold packaging extract (Stratagene) was used for packaging the ligated DNA into functional phage particles.
Identification of the cat gene cluster of strain MT1. Part of the catA gene encoding C12OcatA was amplified by two rounds of PCR (annealing temperature, 50°C) using primers C12OA-F2 (TGCCGAAGTYCARAAYTTTC) and C12OA-R2 (TTGATCTGSGTGGTCAG), which were designed based on the N-terminal protein sequence and on an alignment of the C12O DNA sequences from Pseudomonas strains, respectively. The fragment generated (approximately 700 bp) was cloned into pGEM-T Easy (Promega), transformed into E. coli XL10-Gold (Stratagene), and sequenced. The fosmid library was screened by PCR (annealing temperature, 59°C) using primers specific for catA (incoA F, CTATCGCATCCTGCGTGACT; incoA R, CCGGGTCGAAGTACGAGTAG). A positive fosmid clone was purified with the FosmidMAX DNA purification kit (Epicentre), and the complete catA sequence was obtained by direct sequencing from the fosmid. Sequence information upstream of the catA gene was obtained by PCR using MT1 genomic DNA, primer coA R1 (GCGAGGTCTTCGATGATGTT) (annealing at positions 127 to 146 of catA), and the degenerate primer Areg R2 (TCDATCATNCKWAGRCAATG) (presumed to anneal to catR in a putative catRBCA operon). The fragment (approximately 2.6 kb) obtained after two rounds of PCR using an annealing temperature of 52.5°C was ligated into the pGEM-T Easy vector (Promega), subsequently cloned into E. coli XL10-Gold cells (Stratagene), and verified by sequencing to comprise part of catR, the complete catBC genes, and part of catA.
Identification of the sal gene cluster. Part of the salC gene, encoding MCIsalC, was amplified by PCR (annealing temperature, 45°C) using primers MCI_F1 (CTIGAYGCCIARGGCAARCG) and MCI_R (CRTCCCAITAYTGRTTIACGTC), which were designed based on conserved muconate cycloisomerase protein sequences (LDAQGKR and DVNQYWD, respectively). The 279-bp fragment generated was subsequently cloned into the TOPO vector (Invitrogen), identified by sequencing as probably encoding part of a muconate cycloisomerase, and used as a template to generate a dioxigenin-labeled probe by applying the PCR DIG labeling mix (Roche).
The phage library was plated onto NZY agar (up to 15 plaques/cm2). After overnight growth at 37°C, plaques were lifted onto a nylon membrane (Hybond N+; Amersham Biosciences), which was then denatured (with 1.5 M NaCl-0.5 M NaOH for 2 min), neutralized (with 1.5 M NaCl-0.5 M Tris [pH 8.0] for 5 min), and rinsed (with 2x SSC [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate]-0.2 M Tris [pH 7.5] for 30 s). Blotted DNA was cross-linked to the membrane with UV light. The DNA probe was hybridized to the membrane overnight at 68°C in hybridization buffer (5x SSC, 2% [wt/vol] blocking reagent, 0.1% [wt/vol] N-sodium lauryl sarcosine, and 0.02% [wt/vol] SDS) with further stringent washing steps and a detection procedure as recommended for dioxigenin labeling by the manufacturer (Roche). Hybridization was repeated for selected phages to ensure error-free plaque assignment and single-clone representation.
Phages were converted into phagemids in the host cells after coinfection with ExAssist helper phage (Stratagene). Excised phagemids were cloned into XLOLR cells in LB medium with kanamycin (50 µg/ml). Phagemid DNA was isolated with a NucleoSpin plasmid minikit (Macherey-Nagel). Inserts from three selected clones (3,953 bp, 6,394 bp, and 9,327 bp) were sequenced with custom primers.
DNA sequencing and sequence analysis. PCR products were purified with the QIAquick PCR purification kit and were sequenced using the ABI PRISM BigDye Terminator (version 1.1) ready reaction cycle sequencing kit (Applied Biosystems) and an ABI PRISM 3100 genetic analyzer (Applied Biosystems). Raw sequence data from both strands were assembled with Sequencher software, version 4.0.5 (Gene Codes Corporation). DNA and protein similarity searches were performed using the BLASTN and BLASTP programs from the NCBI website. Alignments were generated with the CLUSTALX 1.8 windows interface of the CLUSTALW program using default values (56). Phylogenetic trees were constructed using the neighbor-joining algorithm of the CLUSTAL program. Distances were generated using the Kimura matrix, and tree stability was supported through bootstrap analysis (100 replicates). Trees were visualized with TREEVIEW 1.6.6 (34).
Gene expression studies. Pseudomonas sp. strain MT1 cells were harvested during exponential growth with acetate (8 mM; growth rate, 0.24 h1), salicylate (2 mM), or 5-chlorosalicylate (2 mM). Samples (7 ml; optical density at 600 nm, 0.15) were immediately transferred to a tube containing 7 ml of RNAprotect (QIAGEN), vortexed, and centrifuged at 2,500 x g for 20 min. RNA was isolated by using a QIAGEN RNeasy minikit. RNA was quantified photometrically at 260 nm, and its integrity was evaluated by electrophoresis in 1.2% agarose. Reverse transcription and quantitative real-time PCR were performed using a QuantiTect SYBR green reverse transcription-PCR (RT-PCR) kit (QIAGEN) for one-step RT-PCR in a Rotor-Gene 2000 real-time PCR machine (Corbett Research). Transcripts of salA, salC, catA, and catB were quantified with the following primer pairs: SalA-F (CGCGCCAAGGGCATCAATACTC), SalA-R (GCTGGAGCGGTCGGAAAGGAAC), SalC-F (CACACCATTTCGCAGCAGACC), SalC-R (ACTGGCGTCCATACCGATCAAG), CatA-F (TCAAAATTTCCCACACTGCTGA), CatA-R (TGACCGCTTTCCAGAACTCTTC), CatB-F (CCTGAAGATTGCCAAGAGTGGT), and CatB-R (AGTTTGTTCAGGGTGACGAAGG). To correct for differences in the amount of starting material, the ribosomal rpsL gene was chosen as a housekeeping reference gene. The PCR primers used for quantifying rpsL transcripts were rpsL-F (GCAAGCGAATGGTCGACAAGA) and rpsL-R (CGCTGTGCTCTTGCAGGTTGTGA) (12). Real-time PCRs were carried out in 20-µl reaction mixtures containing 50 ng of RNA. The thermal cycling conditions were as follows: 30 min at 50°C for reverse transcription; 15 min at 95°C for initial activation of HotStarTaq DNA polymerase, followed by 40 cycles of 15 s at 94°C, 30 s at 62°C, and 30 s at 72°C. Data collection was performed during each extension phase. Melt curve analysis and gel electrophoresis showed high specificity of primers and negligible formation of primer-dimers during amplification (data not shown). The relative expression ratios are presented as changes in the ratio of gene expression between the target gene and the reference gene (rpsL) compared to noninducing conditions (for acetate-grown cells, this ratio was set at 1). The expression ratios were calculated using REST-RG beta software (37), with crossing points and amplification efficiencies for each sample obtained from Rotor-Gene 2000 software, version 4.6 (Corbett Research), and were tested for significance by a pairwise fixed reallocation randomization test implemented in REST-RG.
Analytical methods. HPLC was performed with a Lichrospher SC 100 RP8 reversed-phase column (125 by 4.6 mm; Bischoff). Methanol-H2O containing 0.1% (vol/vol) H3PO4 was used as the eluant at a flow rate of 1 ml/min. The column effluent was monitored simultaneously at 210, 260, and 280 nm by a diode array detector (Shimadzu). Typical retention volumes using 18% (vol/vol) methanol were as follows: 2-chloro-cis,cis-muconate, 10.5 ml; 3-chloro-cis,cis-muconate, 9.6 ml; cis-dienelactone, 5.2 ml; protoanemonin, 4.9 ml; 4-methylmuconolactone, 1.4 ml; 3-methylmuconolactone, 1.2 ml.
Chemicals. 3-Chloro- and 4-chlorocatechol were obtained from Helix Biotech. 2-Methyl-, 3-methyl-, and 3-chloro-cis,cis-muconate were freshly prepared from 3-methyl-, 4-methyl-, and 4-chlorocatechol, respectively, in Tris-HCl (50 mM, pH 7.5, 2 mM MnCl2) using chlorocatechol 1,2-dioxygenase TetC of Pseudomonas chlororaphis RW71 (44) or partially purified C12OsalD free of muconate cycloisomerizing activity. cis-Dienelactone was kindly provided by Walter Reineke (Bergische UniversitätGesamthochschule Wuppertal, Wuppertal, Germany) and Stefan Kaschabeck (TU Bergakademie Freiberg, Freiberg, Germany). Protoanemonin, 4-methylmuconolactone, 3-methylmuconolactone, (+)-muconolactone, cis,cis-muconate, and 2-chloro-cis,cis-muconate were prepared as described previously (1, 39, 42, 46).
Nucleotide sequence accession number. The nucleotide sequences reported in this study have been deposited in the DDBJ/EMBL/GenBank databases under accession numbers DQ870624 (cat gene cluster) and AY944685 (sal gene cluster).
|
|
|---|
|
View larger version (5K): [in a new window] |
FIG. 1. Gene organization of a 9,886-bp and a 3,554-bp region from Pseudomonas sp. strain MT1 containing the sal and cat gene clusters. Arrows indicate gene orientations. salA, salicylate 1-hydroxylase gene; salD and catA, catechol 1,2-dioxygenase genes; salC and catB, muconate cycloisomerase genes; catC, muconolactone isomerase gene; salB, putative transporter gene; salR1, salR2, and catR, putative regulator genes. The catR gene was only partially sequenced. Abbreviations of encoded enzymes are given below the gene clusters.
|
![]() View larger version (23K): [in a new window] |
FIG. 2. Dendrograms showing the relatedness of muconate cycloisomerases (A), catechol 1,2-dioxygenases (B), salicylate 1-hydroxylases (C), and LysR family regulators similar to NahR (D). The dendrograms were calculated using Treeview 1.6.6 based on sequence alignments calculated by ClustalX 1.81 using the default options. Sequences of deduced proteins of the sal and cat gene clusters of Pseudomonas sp. strain MT1 are boldfaced. Bars correspond to an estimated evolutionary distance of 0.1 amino acid substitution per site. Asterisks indicate bootstrap values of <50%. The chloromuconate cycloisomerase TfdDI (A) and the chlorocatechol 1,2-dioxygenase TfdCI (B) of C. necator JMP134 and the CatR LysR type regulator (D) of P. putida PRS2000 are included as outgroups. Accession numbers are as follows: for Burkholderia sp. strain NK8 CatB, AB024746; for Burkholderia sp. strain TH2 CatB1, AB035488; for C. necator 335 CatB, AF042281; for P. putida SM25 CatB, AY028997; for P. putida PRS2000 CatB, P08310; for P. putida KT2440 CatB, NC_002947; for P. fluorescens PFO-1 CatB, NC_007492; for Pseudomonas sp. strain CA10 CatB, AB047272; for uncultured bacterium CatB, AB186499; for P. fluorescens Pf-5 CatB, NC_004129; for P. aeruginosa PA01 CatB, NC_002516; for Acinetobacter lwoffii CatB1, O33946; for Frateuria sp. strain ANA18 CatB1, AB009343; for A. lwoffii K24 CatB2, O33949; for Frateuria sp. strain ANA18 CatB2, T48870; for Burkholderia sp. strain TH2 CatB2, AB035325; for Acinetobacter sp. strain ADP1 CatB, Q43931; for C. necator JMP134 TfdDI, P05404; for Frateuria sp. strain ANA18 CatA1, AB009343; for A. lwoffii K24 CatA1, O33948; for Burkholderia sp. strain NK8 CatA, AB024746; for Burkholderia sp. strain TH2 CatA1, AB035483; for P. fluorescens Pf-5 CatA, CP00076; for uncultured bacterium CatA, AB186499; for P. aeruginosa PA01 CatA, NC_002516; for P. putida PRS2000 CatA, U12557; for P. putida KT2440 CatA, NC_002947; for P. fluorescens PfO-1 CatA, CP000094; for Pseudomonas sp. strain CA10 CatA, AB047272; for Acinetobacter sp. strain ADP1 CatA, P07773; for Pseudomonas sp. strain EST1001 PheB, P31019; for Burkholderia sp. strain TH2 CatA2, AB03525; for A. lwoffii K24 CatA2, O33950; for Frateuria sp. strain ANA18 CatA2, AB009373; for C. necator JMP134 TfdCI, P05403; for P. stutzeri AN10 NahR, AF039534; for P. putida KF715 NahR, AY294313; for Pseudomonas pseudoalcaligenes KF707 BphR2, DQ100350; for P. fluorescens NahR, AF491315; for P. putida G7 NahR, P10183; for Pseudomonas sp. strain KB35B NahR, DQ265742; for P. fluorescens Cg5 NahR, AF491310; for P. putida 9816-4 NahR, AF491307; for Burkholderia gladioli NarR, AF491314 for P. putida Cg1 NahR, AF491308 for P. fluorescens PC20 NarR, AY887963 for Acidovorax sp. strain JS42 NtdR, AY223676 for Ralstonia sp. strain U2 NagR, AF046940 for Burkholderia sp. strain DNT DntR, AY223677 for P. putida PRS2000 CatR, U12557 for Pseudomonas sp. strain KB35 NahG, DQ265742 for P. putida G7 NahG, P23262 for P. putida NCIB9816-4 NahG, AF491307 for P. fluorescens NahG, AY048764 for P. stutzeri AN10 NahG, AF039534 for P. putida KF715 NahG, Q53552 for P. pseudoalcaligenes KF707 SalA, DQ100350 for Pseudomonas sp. strain ND6 NahG (ND016), AY208917 for P. putida S-1 Sal, AB010714 for Acinetobacter sp. strain ADP1 SalA, AF150928 for Burkholderia xenovorans LB400 NahW, CP000272 for Sphingomonas xenophaga P2, AB099984 and for P. stutzeri AN10 NahW, AF039534.
|
To analyze if C12OsalD, like MCIsalC, has properties differing from those of typical proteobacterial enzymes of the 3-oxoadipate pathway, kinetic data were measured for fractions obtained after subsequent anion exchange and HIC of salicylate-grown cell extracts (Table 1). kcat values of 8.7 ± 1.4 s1 (C12OcatA) and 7.5 ± 0.8 s1 (C12OsalD) were obtained for catechol; these are in the same order of magnitude as those reported for catechol 1,2-dioxygenases from other proteobacteria (24, 31, 52). Like previously characterized proteobacterial catechol 1,2-dioxygenases, both enzymes showed negligible activity with 3-chlorocatechol (5, 10). However, the enzymes differed in their turnover rates for 4-chlorocatechol and especially for 4-methylcatechol, where C12OsalD exhibited significantly higher rates (Table 1). Both enzymes also differed with respect to their apparent Km values. Like other proteobacterial dioxygenases (10, 24, 52), C12OcatA showed the highest apparent Km with 4-methylcatechol. This contrasts with C12OsalD, which showed relatively low affinity for catechol and 3-methylcatechol (Table 1). The kcat/Km specificity constants indicate that catechol is the preferred substrate for C12OcatA whereas 4-methylcatechol is the preferred substrate for C12OsalD. Thus, C12OsalD shows a substrate specificity profile clearly different from those of previously described C12O's.
|
View this table: [in a new window] |
TABLE 1. Substrate specificities of catechol 1,2-dioxygenases C12OcatA and C12OsalD from Pseudomonas sp. strain MT1a
|
RT-PCR analysis of MT1 transcripts. To confirm that the sal genes are transcribed during both salicylate and 5-chlorosalicylate degradation, whereas the cat genes are transcribed only during growth on salicylate but not on 5-chlorosalicylate, accumulation of transcripts of salA and salC and of catA and catB was measured during growth on both of these substrates as well as on acetate. Acetate was used as a noninducing negative control, since salicylate 1-hydroxylase activity, as well as catechol 1,2-dioxygenase or muconate cycloisomerizing activity, was in fact absent (<5 U/g of protein) during growth on this substrate. When the relative expression levels between the target and the reference gene (rpsL) were compared to those under noninducing conditions (at a ratio of 1), significantly higher levels of salA and salC transcripts were observed in salicylate-grown (400- to 800-fold) and specifically in 5-chlorosalicylate-grown cells (approximately 2,000-fold) (Fig. 3). In contrast, expression of catA and catB genes was observed at significant levels only for salicylate-grown cells (100- to 200-fold), with only slightly elevated levels observed for cells grown with 5-chlorosalicylate (Fig. 3).
![]() View larger version (21K): [in a new window] |
FIG. 3. Relative expression levels of catabolic genes in salicylate- and 5-chlorosalicylate-grown cells of Pseudomonas sp. strain MT1 as determined by quantitative RT-PCR. Values represent n-fold change (mean of triplicate samples) in the ratio of gene expression between the target gene and the reference gene (rpsL) compared to noninducing conditions (for acetate-grown cells, this ratio was set at 1).
|
As previously described for 5-chlorosalicylate-grown cells (32), MCIsalC eluted at 0.25 ± 0.04 M NaCl during anion-exchange chromatography and at 0.06 ± 0.04 M (NH4)2SO4 during HIC. The respective fractions not only were highly active with 3-chloromuconate and transformed it into protoanemonin (32) but also exhibited significantly higher activity with 3-methylmuconate than with muconate (activity with 0.1 mM 3-methylmuconate was approximately 20 times that obtained with 0.1 mM muconate). With salicylate extracts, a separation of two distinct activities against muconate were observed: fractions eluting at 0.6 to 0 M (NH4)2SO4 (MCIsalC) were more active with 3-methylmuconate, and those eluting at 0.18 to 0.08 M (NH4)2SO4 were more active with muconate. Further purification of the aforementioned activity and N-terminal sequencing of the prominent 42- ± 2-kDa band detected by SDS-PAGE (MLATAIESIETIIVD) verified that this was due to induction of MCIcatB.
Kinetic data were measured in purified enzyme fractions comprising 80% ± 5% of MCIcatB, or >99% of MCIsalC (Table 2). The observed kinetic constants for MCIcatB were highly similar to those previously described for muconate cycloisomerase of P. putida PRS2000 (58): the kcat/Km specificity constants indicated that muconate was the preferred substrate, and the specificity constants with 2- and 3-methylcatechol were approximately 20 to 40% of those with muconate. The activity of MCIcatB with 3-chloromuconate was significantly higher than that reported for PRS2000 muconate cycloisomerase. However, it should be noted that, due to the similar spectroscopic properties of 3-chloromuconate and the reaction product protoanemonin (1), such discrepancies may reflect the unsuitability of spectrophotometric methods (such as the photometric test employed by Vollmer et al. [58]). HPLC analysis revealed that MCIcatB transformed 3-chloromuconate nearly quantitatively (90% ± 5%) into protoanemonin, whereas formation of cis-dienelactone was negligible.
|
View this table: [in a new window] |
TABLE 2. Substrate specificities of muconate cycloisomerases MCIcatB and MCIsalC from Pseudomonas sp. strain MT1a
|
Purification of salicylate hydroxylase. Since two enzymes encoded by the sal gene cluster were shown to be highly adapted for transformation of methylsubstituted substrates, the kinetic properties of salicylate hydroxylase of strain MT1 were also evaluated.
The respective enzyme was purified from salicylate-grown cells by anion-exchange chromatography (eluting at 0.17 ± 0.02 M NaCl) followed by gel filtration. Fractions containing salicylate hydroxylase activity were analyzed by SDS-PAGE, and prominent bands of 48 ± 4 kDa were subjected to N-terminal sequencing. The N terminus of SalOH (NNNSSKQSLRIGXVG, where X is an unknown amino acid) was identical to that of the predicted salA gene product.
Kinetic data were measured in fractions comprising SalOH with a purity of at least 80% of total protein (Table 3). The highest turnover numbers were observed with 4- and 5-methylsalicylate. However, when the kcat/Km specificity constants were compared, 5-substituted salicylates were significantly preferred over salicylate as substrates by the enzyme, whereas 3-substituted salicylates were observed to be the less preferred substrates (Table 3).
|
View this table: [in a new window] |
TABLE 3. Substrate specificities of salicylate 1-hydroxylase from Pseudomonas sp. strain MT1a
|
|
View this table: [in a new window] |
TABLE 4. Enzyme activities in cell extracts of Pseudomonas sp. strain MT1
|
Subsequent transformation of 4-methylcatechol by partially purified C12OsalD and MCIsalC resulted in quantitative formation of 4-methylmuconolactone, as evidenced by HPLC analysis using authentic standards. 4-Methylmuconolactone was further transformed, by cell extracts, into 3-methylmuconolactone with activities of 80 U/g of protein. This pathway via isomerization of 4- into 3-methylmuconolactone is similar to that previously described for 4-methylcatechol transformation by JMP134 (43) and indicates the presence of a 4-methylmuconolactone 4-methylisomerase in MT1.
|
|
|---|
The genetic organization of various catechol gene clusters (cat genes) has been described previously (15, 16, 36, 54). The organization of the cat gene cluster of strain MT1 is identical to the organization characteristic for Pseudomonas strains and shows highest similarity to the cluster identified from an environmental metagenome library constructed from petroleum-contaminated groundwater (57). In MT1, the function of C12OcatA and MCIcatB is to create, together with muconolactone isomerase, a functional catechol branch of the 3-oxoadipate pathway. This branch is induced during growth on salicylate, probably by muconate, which is generally assumed to interact with the respective CatR regulator of catRBCA operons (15, 35).
In MT1, two additional catechol pathway genes are located in one gene cluster together with a gene encoding salicylate 1-hydroxylase. Salicylate 1-hydroxylases are usually reported to be encoded in sal operons coding for the conversion of salicylate to tricarboxylic cycle intermediates through the meta cleavage pathway. Exceptionally, as in Pseudomonas stutzeri AN10 (3), a second salicylate 1-hydroxylase gene situated outside of the sal operon has been observed, whereas in Acinetobacter sp. strain ADP1 the gene encoding salicylate 1-hydroxylase is in the same transcription unit, but only with a LysR type regulator (18). The physical linkage of a salicylate 1-hydroxylase gene with genes encoding enzymes of the ortho cleavage pathway has, to the best of our knowledge, not been observed.
Properties of gene products of the sal gene cluster. Only a few proteobacterial catechol 1,2-dioxygenases have been described in detail for their catabolic properties. In all cases reported to date, catechol is the preferred substrate, as indicated by specificity constants of 30- to 100-fold that of 4-chlorocatechol (10, 52) and 6- to 40-fold that of 4-methylcatechol (10, 52, 62). C12OsalD of MT1 is particular in this respect; its specificity constants for catechol and 4-chlorocatechol are similar, and of the substrates tested, 4-methylcatechol is the preferred substrate.
MCIsalC also, compared to previously described proteobacterial enzymes (53, 58), showed remarkable activities against 3-substituted muconates, with 3-chloromuconate and specifically 3-methylmuconate to be preferred over muconate as substrates. A thorough analysis of the P. putida PRS200-derived cycloisomerase has been performed by Vollmer et al. (58). Based on known 3-dimensional structures, variants of the cycloisomerase had been constructed by site-directed mutagenesis; an I54V (numbering according to MCI of P. putida PRS2000) derivative showed a significant increase in turnover of 3-chloromuconate, and 3-methylmuconate was the preferred substrate for this derivative (58). Sequence analysis revealed that MCIsalC, but not MCIcatB, harbored a valine residue at the appropriate position, in contrast to all other natural proteobacterial gene variants reported thus far. It can therefore be reasoned that this variation is at least partially responsible for the extraordinary substrate specificity of MCIsalC. However, compared to the I54V derivative, MCIsalC showed a 30-fold higher kcat and a significantly lower affinity with muconate, an effect not reached by any of the site-directed mutants constructed by Vollmer et al. (58). Further investigations are thus necessary to unravel the underlying reason for MCIsalC substrate specificity.
In contrast to MCIsalC and C12OsalD, SalOH does not differ significantly in kinetic parameters from previously described enzymes. Generally, salicylate 1-hydroxylases have broad substrate specificity and can transform various monosubstituted salicylates (3, 27, 64). Unfortunately, no thorough investigation on kinetic parameters is available, and generally, only Vmax values or kcat values are given. Usually, 4- and 5-methylsalicylate are transformed at a higher rate comparable to that of salicylate, whereas 4- and 5-chlorosalicylates are transformed less effectively.
Role of the sal gene cluster. In strain MT1, the function of the sal cluster is to effectively funnel 4- and 5-substituted salicylates into the ortho cleavage pathway (Fig. 4). For 4- and 5-methylsalicylate, transformation by enzymes of this cluster results in the formation of 4-methylmuconolactone (Fig. 4), a compound previously described as a dead-end product in Pseudomonas strains (8, 25). Transformation of this compound in C. necator JMP134 (39) and R. rhodochrous N75 (6), is catalyzed by a 4-methylmuconolactone methylisomerase transforming 4- into 3-methylmuconolactone (7, 43). This transformation allows a further degradation by muconolactone isomerases, in analogy to the 3-oxoadipate pathway, by abstracting a proton from the C-4 carbon (45). In fact, an operon comprising both a gene encoding 4-methylmuconolactone methylisomerase and a gene encoding methylmuconolactone isomerase has been identified in JMP 134 (13), and homologous genes have been identified in Cupriavidus necator H16 (PHG6385, NC_005241). Clearly, MT1 uses a similar pathway for degradation of 4-methylmuconolactone by initially isomerizing it into 3-methylmuconolactone. However, in contrast to the situation with C. necator, which also harbors catechol meta cleavage pathways (21, 22) and is reported to degrade methylaromatics by both intra- and extradiol cleavage (40, 41), MT1 metabolizes methylsalicylates exclusively via the ortho cleavage pathway (Fig. 4). A prerequisite for funneling methylaromatics into ortho cleavage pathways is the induction of both a catechol 1,2-dioxygenase and a muconate cycloisomerase during growth on methylaromatics. At least for Pseudomonas MT1, the cat gene cluster is not induced during growth on 4- or 5-methylsalicylate (or on 5-chlorosalicylate). Considering that CatR regulators are usually responsive to muconate (29, 35), it can be suggested that CatR of MT1 is not responsive, or at least is only poorly responsive, to 3-methylmuconate. Unfortunately, no information is available on detailed effector specificities of CatR proteins.
![]() View larger version (19K): [in a new window] |
FIG. 4. Metabolism of salicylate, 4- and 5-chlorosalicylate, and 4- and 5-methylsalicylate by Pseudomonas sp. strain MT1. Enzyme steps common to the degradation of these substrates are given at the top, and the specific isoenzymes induced during growth on each substrate are given below the corresponding enzyme steps. Hypothetical intermediates are shown in brackets. The formation of protoanemonin from 4-chloromuconolactone is either spontaneous or catalyzed by muconate cycloisomerases.
|
We thank Rita Getzlaff (GBF) for N-terminal protein amino acid sequencing and Agnes Waliczek for support in preparation of gene libraries. We gratefully acknowledge Andrew Oxley, Hannes Nahrstedt, and Howard Junca for inspiring discussions.
Published ahead of print on 15 December 2006. ![]()
Present address: Novo Nordisk A/S, Hallas Allé, DK-4400 Kalundborg, Denmark. ![]()
|
|
|---|
-Carboxymethyl-
-methyl-
-butenolide. A 1,2-ring-fission product of 4-methylcatechol by Pseudomonas desmolyticum. Biochem. J. 121:89-92.[Medline]This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»