This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cámara, B.
Right arrow Articles by Pieper, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cámara, B.
Right arrow Articles by Pieper, D. H.

 Previous Article  |  Next Article 

Journal of Bacteriology, March 2007, p. 1664-1674, Vol. 189, No. 5
0021-9193/07/$08.00+0     doi:10.1128/JB.01192-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Gene Cluster Involved in Degradation of Substituted Salicylates via ortho Cleavage in Pseudomonas sp. Strain MT1 Encodes Enzymes Specifically Adapted for Transformation of 4-Methylcatechol and 3-Methylmuconate{triangledown}

Beatriz Cámara, Piotr Bielecki, Filip Kaminski, Vitor Martins dos Santos, Iris Plumeier, Patricia Nikodem,{dagger} and Dietmar H. Pieper*

Division of Microbiology, HZI—Helmholtz Zentrum für Infektionsforschung, Inhoffenstrasse 7, D-38124 Braunschweig, Germany

Received 1 August 2006/ Accepted 5 December 2006


arrow
ABSTRACT
 
Pseudomonas sp. strain MT1 has recently been reported to degrade 4- and 5-chlorosalicylate by a pathway assumed to consist of a patchwork of reactions comprising enzymes of the 3-oxoadipate pathway. Genes encoding the initial steps in the degradation of salicylate and substituted derivatives were now localized and sequenced. One of the gene clusters characterized (sal) showed a novel gene arrangement, with salA, encoding a salicylate 1-hydroxylase, being clustered with salCD genes, encoding muconate cycloisomerase and catechol 1,2-dioxygenase, respectively, and was expressed during growth on salicylate and chlorosalicylate. A second gene cluster (cat), exhibiting the typical catRBCA arrangement of genes of the catechol branch of the 3-oxoadipate pathway in Pseudomonas strains, was expressed during growth on salicylate. Despite their high sequence similarities with isoenzymes encoded by the cat gene cluster, the catechol 1,2-dioxygenase and muconate cycloisomerase encoded by the sal cluster showed unusual kinetic properties. Enzymes were adapted for turnover of 4-chlorocatechol and 3-chloromuconate; however, 4-methylcatechol and 3-methylmuconate were identified as the preferred substrates. Investigation of the substrate spectrum identified 4- and 5-methylsalicylate as growth substrates, which were effectively converted by enzymes of the sal cluster into 4-methylmuconolactone, followed by isomerization to 3-methylmuconolactone. The function of the sal gene cluster is therefore to channel both chlorosubstituted and methylsubstituted salicylates into a catechol ortho cleavage pathway, followed by dismantling of the formed substituted muconolactones through specific pathways.


arrow
INTRODUCTION
 
Aerobic degradation of aromatic compounds usually involves their successive activation and modification such that they are channeled toward a few dihydroxylated intermediates (17, 38). Catechol is the common intermediate during the degradation of a significant number of aromatic compounds such as benzoate, benzene, phenol, or salicylate and can be subject to either intradiol cleavage by a catechol 1,2-dioxygenase (C12O) or extradiol cleavage by a catechol 2,3-dioxygenase (17, 38). Enzymes for catechol degradation via intradiol cleavage are encoded by the catechol branch of the 3-oxoadipate pathway (15). Pseudomonas strains usually contain a catRBCA gene cluster (16, 33, 54) comprising genes encoding catechol 1,2-dioxygenase (CatA), muconate cycloisomerase (MCI; CatB), and muconolactone isomerase (CatC), which are controlled by a LysR type regulator (CatR) in response to the inducer muconate (17). However, various permutations with respect to enzyme distribution, regulation, and gene organization have also been observed (15, 30, 47, 55). The proteobacterial pathway for catechol degradation is not suited for the degradation of chlorosubstituted or methylsubstituted catechols. Methylcatechols, when channeled into the intradiol pathway, are transformed into methylsubstituted muconolactones as dead-end products (8, 25). Enzymes involved in 4-methylmuconolactone degradation have thus far been characterized only from Rhodococcus rhodochrous N75 and Cupriavidus necator JMP134 and comprise a 4-methylmuconolactone 4-methylisomerase, forming 3-methylmuconolactone, as a key enzyme (7, 13, 43). Bacteria capable of degrading chloroaromatics via chlorocatechols usually contain enzymes of the chlorocatechol pathway (48, 49), involving ortho cleavage by a chlorocatechol 1,2-dioxygenase with high activity against chlorocatechols (11), a chloromuconate cycloisomerase with high activity against chloromuconates (53), a dienelactone hydrolase active against both cis- and trans-dienelactone (4-carboxymethylenebut-2-en-4-olide) (53), and a maleylacetate reductase (23). In phylogenetic analyses, chlorocatechol and catechol 1,2-dioxygenases constitute different subfamilies of the family of intradiol dioxygenases. Chlorocatechol 1,2-dioxygenases are of broad substrate specificity, whereas catechol 1,2-dioxygenases exhibit relatively low activity with 4-chlorocatechol and negligible activity with 3-chlorocatechol (38). More importantly, muconate and chloromuconate cycloisomerases differ not only in substrate specificity but also in the reaction performed. Chloromuconate cycloisomerases catalyze a dehalogenation of 3-chloromuconate to form cis-dienelactone (53), and muconate cycloisomerases catalyze the formation of protoanemonin (1) with 4-chloromuconolactone as a reaction intermediate (1, 32). 2-Chloromuconate is dehalogenated only by chloromuconate cycloisomerases (59), while muconate cycloisomerases form 2-chloro- and 5-chloromuconolactone (60).

Pseudomonas sp. strain MT1 has been reported to degrade 4- and 5-chlorosalicylate by a different metabolic route (32). The substrates are transformed by a salicylate 1-hydroxylase into 4-chlorocatechol, which is subject to ring cleavage by catechol 1,2-dioxygenase to yield 3-chloromuconate. It is suggested that trans-dienelactone hydrolase acts on 4-chloromuconolactone as an intermediate in the muconate cycloisomerase-catalyzed transformation of 3-chloromuconate, thus preventing protoanemonin formation in favor of maleylacetate (32). Maleylacetate is reduced to 3-oxoadipate by maleylacetate reductase. Chlorocatechol degradation in strain MT1 was thus assumed to occur by a pathway consisting of a patchwork of reactions known from the 3-oxoadipate pathway (catechol 1,2-dioxygenase, muconate cycloisomerase), the chlorocatechol pathway (maleylacetate reductase), and a trans-dienelactone hydrolase. However, the kinetic parameters of the characterized muconate cycloisomerase (that is, its preference for 3-chloromuconate over muconate as a substrate) set it apart from previously characterized muconate cycloisomerases (32, 53, 58). Moreover, salicylate degradation via catechol is usually performed via meta cleavage, and an operon structure comprising genes encoding a LysR type regulator (NahR), a salicylate 1-hydroxylase (NahG), a catechol 2,3-dioxygenase (NahH), and subsequent enzymes of the meta cleavage pathway is usually conserved (2, 9, 63). However, no extradiol dioxygenase activity was observed in either salicylate-grown or chlorosalicylate-grown cells of MT1 (32), suggesting that the gene encoding salicylate 1-hydroxylase is not clustered with the meta cleavage pathway.

In the current report we analyzed the genetic organization and expression of two catabolic gene clusters of MT1. Detailed characterization of the kinetic parameters of the enzymes encoded revealed that one of the clusters was specifically adapted for channeling substituted salicylates into the catechol ortho cleavage pathway.


arrow
MATERIALS AND METHODS
 
Bacterial strains. Pseudomonas sp. strain MT1 was grown and cell extracts prepared as previously described (32).

Enzyme assays. Salicylate hydroxylase (SalOH), C12O, catechol 2,3-dioxygenase, and MCI were measured spectrophotometrically as described previously (3, 11, 53, 61). 4-Methylmuconolactone 4-methylisomerase activity was determined by high-performance liquid chromatography (HPLC) following its transformation into 3-methylmuconolactone (43). The activities of muconate cycloisomerases MCIcatB and MCIsalC with 2-chloromuconate (100 µM) and 3-chloromuconate were determined by HPLC. As much as 1 U/ml of purified enzymes was used for determining 2-chloromuconate transformation, whereas 3-chloromuconate transformation was determined using 5 to 30 mU/ml (MCIcatB) or 0.2 to 1 mU/ml (MCIsalC) (units were measured with 0.1 mM muconate as a substrate).

Specific activities (units per gram of protein) are expressed as micromoles of substrate converted or product formed per minute per gram of protein at 25°C. Protein concentrations were determined by the Bradford procedure using the Bio-Rad protein assay with bovine serum albumin as a protein standard (4).

Analysis of kinetic data. Vmax, kcat, and apparent Km values of C12O's with catechols were determined using 1 to 100 µM substrate in air-saturated buffer, and kinetic data were calculated from the initial velocities using the Michaelis-Menten equation by nonlinear regression (KaleidaGraph; Synergy Software). Since very low Km values were indicated by this method, kinetic data were finally determined from progress curves obtained from reactions with initial substrate concentrations of 10 µM, as previously described for determination of low Km values of catechol 2,3-dioxygenases (20). The data sets obtained were fit to the Michaelis-Menten equation by nonlinear regression (KaleidaGraph; Synergy Software).

Vmax, kcat, and apparent Km values of SalOH with NADH were determined using 2 to 100 µM NADH and 200 µM salicylate in air-saturated buffer, and those with differently substituted salicylates were determined using 200 µM NADH and 1 to 100 µM substrate. Rate constants of SalOH with 5-chlorosalicylate were also determined from progress curves obtained from reactions with initial substrate concentrations of 10 µM. The kinetic parameters of MCIcatB and MCIsalC with muconate, 2-methylmuconate, and 3-methylmuconate were determined using 5 to 100 µM substrate. Transformation of 3-chloromuconate was determined by HPLC analysis at substrate concentrations of 50 µM to 500 µM. Samples were taken during the reaction time, and protoanemonin formation was directly analyzed by HPLC analysis. At least two independent experiments were performed for each value. Km and Vmax values were calculated by nonlinear regression to the Michaelis-Menten equation by using KaleidaGraph (Synergy Software). Turnover numbers (kcat values) were calculated assuming subunit molecular masses of 34,209 (C12OcatA), 34,233 (C12OsalD), 41,076 (MCIcatB), 40,248 (MCIsalC), and 50,712 (SalOH) Da, respectively.

Enzyme separation and purification. SalOH, catechol 1,2-dioxygenases (C12OcatA and C12OsalD), and muconate cycloisomerases (MCIcatB and MCIsalC) were purified from cell extracts of salicylate-, 4-methylsalicylate-, or 5-chlorosalicylate-grown cells using a fast protein liquid chromatography system (Amersham Biosciences). All protein elutions were performed in Tris-HCl (50 mM, pH 7.5, 2 mM MnCl2).

For analyzing the presence and abundance of C12OcatA, C12OsalD, MCIcatB, and MCIsalC under different growth conditions, cell extracts (10 to 25 mg of protein) were mixed with 4 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4 and were applied to a SOURCE 15PHE PE 4.6/100 (hydrophobic interaction) column (Amersham Pharmacia Biotech). Proteins were eluted by a linear gradient of (NH4)2SO4 (1 M to 0 M) over 25 ml with a flow of 0.25 ml/min. Fraction volumes were 0.5 ml. Hydrophobic interaction chromatography (HIC) separated C12OcatA (0.16 ± 0.04 M) and C12OsalD (0.45 ± 0.04 M) and partially separated MCIcatB (0.12 ± 0.06 M), and MCIsalC (0.06 ± 0.06 M). Since HIC was not suitable for SalOH detection, the presence and abundance of SalOH were analyzed by separation through anion-exchange chromatography using a MonoQ HR 5/5 column (Amersham Pharmacia Biotech). Cell extracts were directly applied and proteins eluted by a linear gradient of 0 to 0.5 M NaCl over 25 ml with a flow of 0.2 ml/min. SalOH eluted at 0.17 ± 0.02 M NaCl. C12OcatA and C12OsalD coeluted at 0.28 ± 0.02 M NaCl, and MCIcatB and MCIsalC coeluted at 0.24 ± 0.02 M NaCl.

For purification of C12OcatA and C12OsalD, 40 mg of protein from salicylate-grown cells was applied to a MonoQ HR 5/5 column and the proteins eluted as described above. Fractions containing C12O activity were combined, concentrated by Centricon YM-50 (Millipore) to a final volume of 1 ml, and supplemented with 2 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4. Subsequent HIC, as described above, resulted in separation of C12OcatA and C12OsalD.

For purification of SalOH and MCIcatB, two 40-mg aliquots of protein from salicylate-grown cells were applied to a MonoQ HR 5/5 column and the proteins eluted as described above. Fractions containing muconate cycloisomerizing or salicylate hydroxylase activities were pooled separately and concentrated to final volumes of 1 and 0.2 ml, respectively. The muconate cycloisomerase-containing protein solution was supplemented with 2 M (NH4)2SO4 to give a final concentration of 1 M (NH4)2SO4 and was separated by HIC, as described above. Fractions eluting at 0.12 ± 0.04 M and exhibiting high activity against muconate but low activity against 3-methylmuconate (MCIcatB) were pooled, whereas fractions eluting at 0.06 ± 0.06 M and exhibiting relatively high activity against 3-methylmuconate (MCIsalC) were discarded. The pooled fractions were further concentrated by ultracentrifugation and separated by HIC using a linear gradient of (NH4)2SO4 (0.5 M to 0 M) over 17 ml with a flow rate of 0.25 ml/min. Fractions with high activity against muconate but low activity against 3-methylmuconate eluted at 0.14 ± 0.06 M (NH4)2SO4 and were pooled. Fractions eluting at <0.14 ± 0.06 M (NH4)2SO4 were discarded, since they may contain minor amounts of contaminating MCIsalC.

SalOH was further purified by gel filtration using a Superose 12 HR10/10 column (Amersham Pharmacia Biotech) with 20 ml Tris-HCl (50 mM, 100 mM NaCl, pH 7.5) as an eluent with a flow rate of 0.3 ml/min. Two fractions (0.5 ml each) exhibiting high activity with salicylate were pooled.

MCIsalC was purified from 5-chlorosalicylate-grown cells as previously described (32).

Electrophoretic methods. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed on a Bio-Rad Miniprotein II apparatus as previously described (26), with acrylamide concentrations of 5 and 10% (wt/vol) used for the concentrating and separating gels, respectively. The proteins were stained with Coomassie brilliant blue (Serva). A PageRuler protein ladder (Fermentas) was used as a marker.

Quantification of proteins in partially purified fractions. For quantification of C12O proteins, MCIcatB, and SalOH in partially purified fractions, 0.3 to 15 µg of protein was separated by SDS-PAGE. Gels were stained with Ruthenium II tris (bathophenantroline disulfonate) as previously described (20) and scanned using a Fujifilm LAS-1000 charge-coupled device camera. The fluorescence intensity was integrated, and the relative intensities of the bands corresponding to C12OcatA, C12OsalD, MCIcatB, and SalOH were determined using the AIDA 2.1 software package (Raytest Isotopenmessgeräte GmbH).

Amino acid sequencing. N-terminal amino acid sequences were determined as previously described (19).

DNA isolation and preparation of genome libraries. Genomic DNA of Pseudomonas sp. strain MT1 was isolated with the G NOME DNA kit (BIO 101 Systems). A fosmid library was prepared in pCC1FOS according to the manufacturer's recommendations (Epicentre). Genomic DNA was randomly sheared by pipetting to give approximately 40-kb fragments for ligation into pCC1FOS. Ligated DNA was packaged with MaxPlax Lambda packaging extracts, transduced into Escherichia coli strain EPI300-T1, and spread onto LB agar plates containing 12.5 µg/ml chloramphenicol. A total of 282 individual clones were analyzed.

For preparation of the phage library, DNA was partially digested with Sau3AI and size fractionated by ultracentrifugation in a sucrose gradient (51). After overnight precipitation with polyethylene glycol 6000, the recovered fraction of 4- to 12-kbp DNA fragments was ligated into the BamHI/calf intestine alkaline phosphatase-treated ZAP Express vector (Stratagene). Gigapack III gold packaging extract (Stratagene) was used for packaging the ligated DNA into functional phage particles.

Identification of the cat gene cluster of strain MT1. Part of the catA gene encoding C12OcatA was amplified by two rounds of PCR (annealing temperature, 50°C) using primers C12OA-F2 (TGCCGAAGTYCARAAYTTTC) and C12OA-R2 (TTGATCTGSGTGGTCAG), which were designed based on the N-terminal protein sequence and on an alignment of the C12O DNA sequences from Pseudomonas strains, respectively. The fragment generated (approximately 700 bp) was cloned into pGEM-T Easy (Promega), transformed into E. coli XL10-Gold (Stratagene), and sequenced. The fosmid library was screened by PCR (annealing temperature, 59°C) using primers specific for catA (incoA F, CTATCGCATCCTGCGTGACT; incoA R, CCGGGTCGAAGTACGAGTAG). A positive fosmid clone was purified with the FosmidMAX DNA purification kit (Epicentre), and the complete catA sequence was obtained by direct sequencing from the fosmid. Sequence information upstream of the catA gene was obtained by PCR using MT1 genomic DNA, primer coA R1 (GCGAGGTCTTCGATGATGTT) (annealing at positions 127 to 146 of catA), and the degenerate primer Areg R2 (TCDATCATNCKWAGRCAATG) (presumed to anneal to catR in a putative catRBCA operon). The fragment (approximately 2.6 kb) obtained after two rounds of PCR using an annealing temperature of 52.5°C was ligated into the pGEM-T Easy vector (Promega), subsequently cloned into E. coli XL10-Gold cells (Stratagene), and verified by sequencing to comprise part of catR, the complete catBC genes, and part of catA.

Identification of the sal gene cluster. Part of the salC gene, encoding MCIsalC, was amplified by PCR (annealing temperature, 45°C) using primers MCI_F1 (CTIGAYGCCIARGGCAARCG) and MCI_R (CRTCCCAITAYTGRTTIACGTC), which were designed based on conserved muconate cycloisomerase protein sequences (LDAQGKR and DVNQYWD, respectively). The 279-bp fragment generated was subsequently cloned into the TOPO vector (Invitrogen), identified by sequencing as probably encoding part of a muconate cycloisomerase, and used as a template to generate a dioxigenin-labeled probe by applying the PCR DIG labeling mix (Roche).

The phage library was plated onto NZY agar (up to 15 plaques/cm2). After overnight growth at 37°C, plaques were lifted onto a nylon membrane (Hybond N+; Amersham Biosciences), which was then denatured (with 1.5 M NaCl-0.5 M NaOH for 2 min), neutralized (with 1.5 M NaCl-0.5 M Tris [pH 8.0] for 5 min), and rinsed (with 2x SSC [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate]-0.2 M Tris [pH 7.5] for 30 s). Blotted DNA was cross-linked to the membrane with UV light. The DNA probe was hybridized to the membrane overnight at 68°C in hybridization buffer (5x SSC, 2% [wt/vol] blocking reagent, 0.1% [wt/vol] N-sodium lauryl sarcosine, and 0.02% [wt/vol] SDS) with further stringent washing steps and a detection procedure as recommended for dioxigenin labeling by the manufacturer (Roche). Hybridization was repeated for selected phages to ensure error-free plaque assignment and single-clone representation.

Phages were converted into phagemids in the host cells after coinfection with ExAssist helper phage (Stratagene). Excised phagemids were cloned into XLOLR cells in LB medium with kanamycin (50 µg/ml). Phagemid DNA was isolated with a NucleoSpin plasmid minikit (Macherey-Nagel). Inserts from three selected clones (3,953 bp, 6,394 bp, and 9,327 bp) were sequenced with custom primers.

DNA sequencing and sequence analysis. PCR products were purified with the QIAquick PCR purification kit and were sequenced using the ABI PRISM BigDye Terminator (version 1.1) ready reaction cycle sequencing kit (Applied Biosystems) and an ABI PRISM 3100 genetic analyzer (Applied Biosystems). Raw sequence data from both strands were assembled with Sequencher software, version 4.0.5 (Gene Codes Corporation). DNA and protein similarity searches were performed using the BLASTN and BLASTP programs from the NCBI website. Alignments were generated with the CLUSTALX 1.8 windows interface of the CLUSTALW program using default values (56). Phylogenetic trees were constructed using the neighbor-joining algorithm of the CLUSTAL program. Distances were generated using the Kimura matrix, and tree stability was supported through bootstrap analysis (100 replicates). Trees were visualized with TREEVIEW 1.6.6 (34).

Gene expression studies. Pseudomonas sp. strain MT1 cells were harvested during exponential growth with acetate (8 mM; growth rate, 0.24 h–1), salicylate (2 mM), or 5-chlorosalicylate (2 mM). Samples (7 ml; optical density at 600 nm, 0.15) were immediately transferred to a tube containing 7 ml of RNAprotect (QIAGEN), vortexed, and centrifuged at 2,500 x g for 20 min. RNA was isolated by using a QIAGEN RNeasy minikit. RNA was quantified photometrically at 260 nm, and its integrity was evaluated by electrophoresis in 1.2% agarose. Reverse transcription and quantitative real-time PCR were performed using a QuantiTect SYBR green reverse transcription-PCR (RT-PCR) kit (QIAGEN) for one-step RT-PCR in a Rotor-Gene 2000 real-time PCR machine (Corbett Research). Transcripts of salA, salC, catA, and catB were quantified with the following primer pairs: SalA-F (CGCGCCAAGGGCATCAATACTC), SalA-R (GCTGGAGCGGTCGGAAAGGAAC), SalC-F (CACACCATTTCGCAGCAGACC), SalC-R (ACTGGCGTCCATACCGATCAAG), CatA-F (TCAAAATTTCCCACACTGCTGA), CatA-R (TGACCGCTTTCCAGAACTCTTC), CatB-F (CCTGAAGATTGCCAAGAGTGGT), and CatB-R (AGTTTGTTCAGGGTGACGAAGG). To correct for differences in the amount of starting material, the ribosomal rpsL gene was chosen as a housekeeping reference gene. The PCR primers used for quantifying rpsL transcripts were rpsL-F (GCAAGCGAATGGTCGACAAGA) and rpsL-R (CGCTGTGCTCTTGCAGGTTGTGA) (12). Real-time PCRs were carried out in 20-µl reaction mixtures containing 50 ng of RNA. The thermal cycling conditions were as follows: 30 min at 50°C for reverse transcription; 15 min at 95°C for initial activation of HotStarTaq DNA polymerase, followed by 40 cycles of 15 s at 94°C, 30 s at 62°C, and 30 s at 72°C. Data collection was performed during each extension phase. Melt curve analysis and gel electrophoresis showed high specificity of primers and negligible formation of primer-dimers during amplification (data not shown). The relative expression ratios are presented as changes in the ratio of gene expression between the target gene and the reference gene (rpsL) compared to noninducing conditions (for acetate-grown cells, this ratio was set at 1). The expression ratios were calculated using REST-RG beta software (37), with crossing points and amplification efficiencies for each sample obtained from Rotor-Gene 2000 software, version 4.6 (Corbett Research), and were tested for significance by a pairwise fixed reallocation randomization test implemented in REST-RG.

Analytical methods. HPLC was performed with a Lichrospher SC 100 RP8 reversed-phase column (125 by 4.6 mm; Bischoff). Methanol-H2O containing 0.1% (vol/vol) H3PO4 was used as the eluant at a flow rate of 1 ml/min. The column effluent was monitored simultaneously at 210, 260, and 280 nm by a diode array detector (Shimadzu). Typical retention volumes using 18% (vol/vol) methanol were as follows: 2-chloro-cis,cis-muconate, 10.5 ml; 3-chloro-cis,cis-muconate, 9.6 ml; cis-dienelactone, 5.2 ml; protoanemonin, 4.9 ml; 4-methylmuconolactone, 1.4 ml; 3-methylmuconolactone, 1.2 ml.

Chemicals. 3-Chloro- and 4-chlorocatechol were obtained from Helix Biotech. 2-Methyl-, 3-methyl-, and 3-chloro-cis,cis-muconate were freshly prepared from 3-methyl-, 4-methyl-, and 4-chlorocatechol, respectively, in Tris-HCl (50 mM, pH 7.5, 2 mM MnCl2) using chlorocatechol 1,2-dioxygenase TetC of Pseudomonas chlororaphis RW71 (44) or partially purified C12OsalD free of muconate cycloisomerizing activity. cis-Dienelactone was kindly provided by Walter Reineke (Bergische Universität—Gesamthochschule Wuppertal, Wuppertal, Germany) and Stefan Kaschabeck (TU Bergakademie Freiberg, Freiberg, Germany). Protoanemonin, 4-methylmuconolactone, 3-methylmuconolactone, (+)-muconolactone, cis,cis-muconate, and 2-chloro-cis,cis-muconate were prepared as described previously (1, 39, 42, 46).

Nucleotide sequence accession number. The nucleotide sequences reported in this study have been deposited in the DDBJ/EMBL/GenBank databases under accession numbers DQ870624 (cat gene cluster) and AY944685 (sal gene cluster).


arrow
RESULTS
 
Genetic analysis of the sal gene cluster. A muconate cycloisomerase, which was characterized by its substrate preference of 3-chloromuconate over muconate, has previously been identified in Pseudomonas sp. strain MT1 (32). Since this enzyme was assumed to be important for both salicylate and chlorosalicylate degradation by this strain, analysis of the encoding gene region was performed. Inspection of the 9,886-bp sequenced region (Fig. 1) identified eight complete open reading frames (ORFs) and one partial ORF. ORF5, designated salC, encoded an enzyme with a deduced N-terminal sequence identical to that of the previously characterized muconate cycloisomerase (32). Phylogenetic analysis of the deduced protein (further termed MCIsalC) revealed high sequence homology with proteobacterial muconate cycloisomerases, specifically those of Pseudomonas strains (Fig. 2A). The deduced product of the downstream salD gene showed high sequence homology sequence with proteobacterial catechol 1,2-dioxygenases (Fig. 2B). However, a gene encoding a muconolactone isomerase (usually clustered in Pseudomonas strains with genes encoding muconate cycloisomerases and catechol 1,2-dioxygenases (16, 17) could not be localized in the sequenced region. In contrast, salC was preceded by ORFs with high homology to genes encoding salicylate 1-hydroxylases (salA) and permeases of the major facilitator subfamily (salB). The salA gene product showed the highest similarity to nahG gene products, single-component flavoprotein monooxygenases responsible for transforming salicylate produced from naphthalene into catechol (Fig. 2C), and the salB gene product showed the highest similarity to benK (benzoate transporters) transporters of the major facilitator superfamily (64% identity of the deduced amino acid sequence to the benK gene product of Pseudomonas sp. strain ND6 [28]). Transcribed divergently toward salA, an ORF putatively encoding a regulatory protein of the LysR family was identified and termed salR2 (Fig. 1). Phylogenetic analysis revealed that the putative gene product clustered with nahR gene products (Fig. 2D), which are usually responsive to salicylate (14). Transcribed convergently toward salR2, a second gene (salR1), putatively encoding a LysR type regulator, was observed and showed homology to NahR regulators. Transcribed convergently toward salD, a putative gene (orf7) encoding a 2-hydroxymuconic semialdehyde hydrolase (60% amino acid identity to TdnF of Pseudomonas putida UCC22 [D85415]) was preceded by an incomplete ORF (orf8) of a putative transporter of the resistance-nodulation-cell division family (56% amino acid identity to the putative transporter PP3302 of P. putida KT2440 [NC_002947]).


Figure 1
View larger version (5K):
[in this window]
[in a new window]

 
FIG. 1. Gene organization of a 9,886-bp and a 3,554-bp region from Pseudomonas sp. strain MT1 containing the sal and cat gene clusters. Arrows indicate gene orientations. salA, salicylate 1-hydroxylase gene; salD and catA, catechol 1,2-dioxygenase genes; salC and catB, muconate cycloisomerase genes; catC, muconolactone isomerase gene; salB, putative transporter gene; salR1, salR2, and catR, putative regulator genes. The catR gene was only partially sequenced. Abbreviations of encoded enzymes are given below the gene clusters.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 2. Dendrograms showing the relatedness of muconate cycloisomerases (A), catechol 1,2-dioxygenases (B), salicylate 1-hydroxylases (C), and LysR family regulators similar to NahR (D). The dendrograms were calculated using Treeview 1.6.6 based on sequence alignments calculated by ClustalX 1.81 using the default options. Sequences of deduced proteins of the sal and cat gene clusters of Pseudomonas sp. strain MT1 are boldfaced. Bars correspond to an estimated evolutionary distance of 0.1 amino acid substitution per site. Asterisks indicate bootstrap values of <50%. The chloromuconate cycloisomerase TfdDI (A) and the chlorocatechol 1,2-dioxygenase TfdCI (B) of C. necator JMP134 and the CatR LysR type regulator (D) of P. putida PRS2000 are included as outgroups. Accession numbers are as follows: for Burkholderia sp. strain NK8 CatB, AB024746; for Burkholderia sp. strain TH2 CatB1, AB035488; for C. necator 335 CatB, AF042281; for P. putida SM25 CatB, AY028997; for P. putida PRS2000 CatB, P08310; for P. putida KT2440 CatB, NC_002947; for P. fluorescens PFO-1 CatB, NC_007492; for Pseudomonas sp. strain CA10 CatB, AB047272; for uncultured bacterium CatB, AB186499; for P. fluorescens Pf-5 CatB, NC_004129; for P. aeruginosa PA01 CatB, NC_002516; for Acinetobacter lwoffii CatB1, O33946; for Frateuria sp. strain ANA18 CatB1, AB009343; for A. lwoffii K24 CatB2, O33949; for Frateuria sp. strain ANA18 CatB2, T48870; for Burkholderia sp. strain TH2 CatB2, AB035325; for Acinetobacter sp. strain ADP1 CatB, Q43931; for C. necator JMP134 TfdDI, P05404; for Frateuria sp. strain ANA18 CatA1, AB009343; for A. lwoffii K24 CatA1, O33948; for Burkholderia sp. strain NK8 CatA, AB024746; for Burkholderia sp. strain TH2 CatA1, AB035483; for P. fluorescens Pf-5 CatA, CP00076; for uncultured bacterium CatA, AB186499; for P. aeruginosa PA01 CatA, NC_002516; for P. putida PRS2000 CatA, U12557; for P. putida KT2440 CatA, NC_002947; for P. fluorescens PfO-1 CatA, CP000094; for Pseudomonas sp. strain CA10 CatA, AB047272; for Acinetobacter sp. strain ADP1 CatA, P07773; for Pseudomonas sp. strain EST1001 PheB, P31019; for Burkholderia sp. strain TH2 CatA2, AB03525; for A. lwoffii K24 CatA2, O33950; for Frateuria sp. strain ANA18 CatA2, AB009373; for C. necator JMP134 TfdCI, P05403; for P. stutzeri AN10 NahR, AF039534; for P. putida KF715 NahR, AY294313; for Pseudomonas pseudoalcaligenes KF707 BphR2, DQ100350; for P. fluorescens NahR, AF491315; for P. putida G7 NahR, P10183; for Pseudomonas sp. strain KB35B NahR, DQ265742; for P. fluorescens Cg5 NahR, AF491310; for P. putida 9816-4 NahR, AF491307; for Burkholderia gladioli NarR, AF491314 for P. putida Cg1 NahR, AF491308 for P. fluorescens PC20 NarR, AY887963 for Acidovorax sp. strain JS42 NtdR, AY223676 for Ralstonia sp. strain U2 NagR, AF046940 for Burkholderia sp. strain DNT DntR, AY223677 for P. putida PRS2000 CatR, U12557 for Pseudomonas sp. strain KB35 NahG, DQ265742 for P. putida G7 NahG, P23262 for P. putida NCIB9816-4 NahG, AF491307 for P. fluorescens NahG, AY048764 for P. stutzeri AN10 NahG, AF039534 for P. putida KF715 NahG, Q53552 for P. pseudoalcaligenes KF707 SalA, DQ100350 for Pseudomonas sp. strain ND6 NahG (ND016), AY208917 for P. putida S-1 Sal, AB010714 for Acinetobacter sp. strain ADP1 SalA, AF150928 for Burkholderia xenovorans LB400 NahW, CP000272 for Sphingomonas xenophaga P2, AB099984 and for P. stutzeri AN10 NahW, AF039534.

Two catechol 1,2-dioxygenases in Pseudomonas sp. strain MT1. Since Pseudomonas strains usually contain a catRBCA cluster (17), which also encodes muconate cycloisomerase (catB) and catechol 1,2-dioxygenase (catA), we analyzed if different catechol-transforming activities were induced during growth on salicylate. Two distinct catechol 1,2-dioxygenase activities, eluting, respectively, at 0.45 ± 0.04 M (NH4)2SO4 and 0.16 ± 0.04 M (NH4)2SO4, were observed when cell extracts of salicylate-grown MT1 cells were subjected to HIC. The respective fractions were analyzed by SDS-PAGE, and prominent bands of 33 ± 2 kDa were subjected to N-terminal sequencing. The N terminus of the protein eluting at 0.45 ± 0.04 M (NH4)2SO4 (TVKISHTAEVQDLIK) was identical to that of the predicted salD gene product and is termed C12OsalD. The N terminus of the protein eluting at 0.16 ± 0.04 M (NH4)2SO4 (MNVKISHTAEVQNFL) (termed C12OcatA) showed high similarity to that of catechol 1,2-dioxygenase of Pseudomonas putida KT2440 (accession number NC_002947). In contrast to that in salicylate-grown cells, C12OcatA activity was absent in 5-chlorosalicylate-grown cells, as was apparent by the absence of activity in fractions eluting at 0.16 ± 0.04 M (NH4)2SO4 after HIC.

To analyze if C12OsalD, like MCIsalC, has properties differing from those of typical proteobacterial enzymes of the 3-oxoadipate pathway, kinetic data were measured for fractions obtained after subsequent anion exchange and HIC of salicylate-grown cell extracts (Table 1). kcat values of 8.7 ± 1.4 s–1 (C12OcatA) and 7.5 ± 0.8 s–1 (C12OsalD) were obtained for catechol; these are in the same order of magnitude as those reported for catechol 1,2-dioxygenases from other proteobacteria (24, 31, 52). Like previously characterized proteobacterial catechol 1,2-dioxygenases, both enzymes showed negligible activity with 3-chlorocatechol (5, 10). However, the enzymes differed in their turnover rates for 4-chlorocatechol and especially for 4-methylcatechol, where C12OsalD exhibited significantly higher rates (Table 1). Both enzymes also differed with respect to their apparent Km values. Like other proteobacterial dioxygenases (10, 24, 52), C12OcatA showed the highest apparent Km with 4-methylcatechol. This contrasts with C12OsalD, which showed relatively low affinity for catechol and 3-methylcatechol (Table 1). The kcat/Km specificity constants indicate that catechol is the preferred substrate for C12OcatA whereas 4-methylcatechol is the preferred substrate for C12OsalD. Thus, C12OsalD shows a substrate specificity profile clearly different from those of previously described C12O's.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Substrate specificities of catechol 1,2-dioxygenases C12OcatA and C12OsalD from Pseudomonas sp. strain MT1a

Identification of a cat gene cluster in Pseudomonas sp. strain MT1. To analyze if C12OcatA is encoded by a typical Pseudomonas catRBCA gene cluster, sequence information (totaling 3,554 bp) was obtained as outlined in Materials and Methods. Analysis of this region revealed three complete ORFs and one partial ORF (Fig. 1). catA encoded a catechol 1,2-dioxygenase with a deduced N-terminal sequence identical to that identified above for C12OcatA. Upstream of catA, two ORFs with high sequence similarity to genes encoding muconolactone isomerase (catC, with 95% identity of the deduced amino acid sequence to the catC gene product of an uncultured bacterium [AB186499] and 86% identity to the catC gene product of Pseudomonas fluorescens Pf-5 [NC_004129]) and genes encoding muconate cycloisomerases (catB) (Fig. 2A) were identified. Upstream of the catBCA gene cluster, the incomplete ORF1 designated catR is transcribed divergently and encodes a LysR type regulator with high similarity to catR regulators of Pseudomonas cat operons (97% amino acid identity to CatR of an uncultured bacterium [AB186499] and 84% identity to CatR of Pseudomonas fluorescens Pf-5 [NC_004129]). This therefore reflects the presence of a typical Pseudomonas catRBCA gene cluster in strain MT1.

RT-PCR analysis of MT1 transcripts. To confirm that the sal genes are transcribed during both salicylate and 5-chlorosalicylate degradation, whereas the cat genes are transcribed only during growth on salicylate but not on 5-chlorosalicylate, accumulation of transcripts of salA and salC and of catA and catB was measured during growth on both of these substrates as well as on acetate. Acetate was used as a noninducing negative control, since salicylate 1-hydroxylase activity, as well as catechol 1,2-dioxygenase or muconate cycloisomerizing activity, was in fact absent (<5 U/g of protein) during growth on this substrate. When the relative expression levels between the target and the reference gene (rpsL) were compared to those under noninducing conditions (at a ratio of 1), significantly higher levels of salA and salC transcripts were observed in salicylate-grown (400- to 800-fold) and specifically in 5-chlorosalicylate-grown cells (approximately 2,000-fold) (Fig. 3). In contrast, expression of catA and catB genes was observed at significant levels only for salicylate-grown cells (100- to 200-fold), with only slightly elevated levels observed for cells grown with 5-chlorosalicylate (Fig. 3).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 3. Relative expression levels of catabolic genes in salicylate- and 5-chlorosalicylate-grown cells of Pseudomonas sp. strain MT1 as determined by quantitative RT-PCR. Values represent n-fold change (mean of triplicate samples) in the ratio of gene expression between the target gene and the reference gene (rpsL) compared to noninducing conditions (for acetate-grown cells, this ratio was set at 1).

Purification and characterization of muconate cycloisomerases. Since expression analysis indicated that two distinct muconate cycloisomerases were induced during salicylate growth, we attempted to verify this by protein separation. Furthermore, since C12OsalD was shown above to be specifically adapted for the turnover of 4-methylcatechol, the turnover of the reaction product 3-methylmuconate by MCIsalC was evaluated.

As previously described for 5-chlorosalicylate-grown cells (32), MCIsalC eluted at 0.25 ± 0.04 M NaCl during anion-exchange chromatography and at 0.06 ± 0.04 M (NH4)2SO4 during HIC. The respective fractions not only were highly active with 3-chloromuconate and transformed it into protoanemonin (32) but also exhibited significantly higher activity with 3-methylmuconate than with muconate (activity with 0.1 mM 3-methylmuconate was approximately 20 times that obtained with 0.1 mM muconate). With salicylate extracts, a separation of two distinct activities against muconate were observed: fractions eluting at 0.6 to 0 M (NH4)2SO4 (MCIsalC) were more active with 3-methylmuconate, and those eluting at 0.18 to 0.08 M (NH4)2SO4 were more active with muconate. Further purification of the aforementioned activity and N-terminal sequencing of the prominent 42- ± 2-kDa band detected by SDS-PAGE (MLATAIESIETIIVD) verified that this was due to induction of MCIcatB.

Kinetic data were measured in purified enzyme fractions comprising 80% ± 5% of MCIcatB, or >99% of MCIsalC (Table 2). The observed kinetic constants for MCIcatB were highly similar to those previously described for muconate cycloisomerase of P. putida PRS2000 (58): the kcat/Km specificity constants indicated that muconate was the preferred substrate, and the specificity constants with 2- and 3-methylcatechol were approximately 20 to 40% of those with muconate. The activity of MCIcatB with 3-chloromuconate was significantly higher than that reported for PRS2000 muconate cycloisomerase. However, it should be noted that, due to the similar spectroscopic properties of 3-chloromuconate and the reaction product protoanemonin (1), such discrepancies may reflect the unsuitability of spectrophotometric methods (such as the photometric test employed by Vollmer et al. [58]). HPLC analysis revealed that MCIcatB transformed 3-chloromuconate nearly quantitatively (90% ± 5%) into protoanemonin, whereas formation of cis-dienelactone was negligible.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Substrate specificities of muconate cycloisomerases MCIcatB and MCIsalC from Pseudomonas sp. strain MT1a

By using purified MCIsalC, the previously analyzed kinetic data with muconate and 3-chloromuconate as substrates (32) could be confirmed. However, our new data indicated that 3-methylmuconate was preferred even over 3-chloromuconate as a substrate (Table 2). Thus, both enzymes encoded in the sal gene cluster (C12OsalD and MCIsalC), which catalyze the turnover of catechols and muconates, were highly adapted toward 4-methylcatechol/3-methylmuconate transformation but also significantly enhanced in their turnover for 4-chlorocatechol/3-chloromuconate.

Purification of salicylate hydroxylase. Since two enzymes encoded by the sal gene cluster were shown to be highly adapted for transformation of methylsubstituted substrates, the kinetic properties of salicylate hydroxylase of strain MT1 were also evaluated.

The respective enzyme was purified from salicylate-grown cells by anion-exchange chromatography (eluting at 0.17 ± 0.02 M NaCl) followed by gel filtration. Fractions containing salicylate hydroxylase activity were analyzed by SDS-PAGE, and prominent bands of 48 ± 4 kDa were subjected to N-terminal sequencing. The N terminus of SalOH (NNNSSKQSLRIGXVG, where X is an unknown amino acid) was identical to that of the predicted salA gene product.

Kinetic data were measured in fractions comprising SalOH with a purity of at least 80% of total protein (Table 3). The highest turnover numbers were observed with 4- and 5-methylsalicylate. However, when the kcat/Km specificity constants were compared, 5-substituted salicylates were significantly preferred over salicylate as substrates by the enzyme, whereas 3-substituted salicylates were observed to be the less preferred substrates (Table 3).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Substrate specificities of salicylate 1-hydroxylase from Pseudomonas sp. strain MT1a

Growth on 4-methyl- and 5-methylsalicylate. Since all three catalytic enzymes encoded in the salicylate cluster were highly adapted to the transformation of methylsubstituted substrates, it could be reasoned that the gene cluster has been adapted to channel 4- and 5-methylsalicylate into the ortho cleavage pathway. Strain MT1 was capable of growth on both 4-methyl- and 5-methylsalicylate, with growth rates of 0.49 and 0.45 h–1, respectively. These rates are higher than the growth rates reported with 4-chloro- and 5-chlorosalicylate (0.05 h–1 and 0.16 h–1, respectively) and even with salicylate (0.38 h–1) (32). Analysis of cell extracts (Table 4) indicated that extradiol cleavage activity was in fact absent in MT1 grown on either of these substrates (<1 U/g protein), and in the presence of NADH, both 4- and 5-methylsalicylate were transformed quantitatively by cell extracts into 3-methylmuconolactone, as evidenced by HPLC analysis using authentic standards.


View this table:
[in this window]
[in a new window]

 
TABLE 4. Enzyme activities in cell extracts of Pseudomonas sp. strain MT1

The approximately threefold higher intradiol cleavage activities with 4-methylcatechol (compared to catechol) after growth on either 4- or 5-methylsalicylate and the absence of significant activity against muconate in cell extracts (Table 4) indicated that C12OsalD and MCIsalC, rather than C12OcatA and MCIcatB, were induced. Separation of enzymes from 4-methylsalicylate-grown cells by HIC confirmed the absence of C12OcatA and MCIcatB in the cell extract, whereas high activities of C12OsalD and MCIsalC were present.

Subsequent transformation of 4-methylcatechol by partially purified C12OsalD and MCIsalC resulted in quantitative formation of 4-methylmuconolactone, as evidenced by HPLC analysis using authentic standards. 4-Methylmuconolactone was further transformed, by cell extracts, into 3-methylmuconolactone with activities of 80 U/g of protein. This pathway via isomerization of 4- into 3-methylmuconolactone is similar to that previously described for 4-methylcatechol transformation by JMP134 (43) and indicates the presence of a 4-methylmuconolactone 4-methylisomerase in MT1.


arrow
DISCUSSION
 
Catabolic gene clusters in Pseudomonas sp. strain MT1. Pseudomonas sp. strain MT1 has recently been shown to degrade 4- and 5-chlorosalicylate by a pathway that was thought to comprise a patchwork of reactions known from the classical 3-oxoadipate pathway, a trans-dienelactone hydrolase and a maleylacetate reductase (32). However, we show here that enzymes of the archetypal catRBCA gene cluster of the 3-oxoadipate pathway are not induced in Pseudomonas sp. strain MT1 during the growth of the strain on substituted salicylates. Rather, a new chimeric cluster comprising genes encoding a flavoprotein salicylate 1-hydroxylase and ortho cleavage pathway genes encoding a catechol 1,2-dioxygenase and a muconate cycloisomerase is responsible for channeling various substituted salicylates into ortho cleavage routes.

The genetic organization of various catechol gene clusters (cat genes) has been described previously (15, 16, 36, 54). The organization of the cat gene cluster of strain MT1 is identical to the organization characteristic for Pseudomonas strains and shows highest similarity to the cluster identified from an environmental metagenome library constructed from petroleum-contaminated groundwater (57). In MT1, the function of C12OcatA and MCIcatB is to create, together with muconolactone isomerase, a functional catechol branch of the 3-oxoadipate pathway. This branch is induced during growth on salicylate, probably by muconate, which is generally assumed to interact with the respective CatR regulator of catRBCA operons (15, 35).

In MT1, two additional catechol pathway genes are located in one gene cluster together with a gene encoding salicylate 1-hydroxylase. Salicylate 1-hydroxylases are usually reported to be encoded in sal operons coding for the conversion of salicylate to tricarboxylic cycle intermediates through the meta cleavage pathway. Exceptionally, as in Pseudomonas stutzeri AN10 (3), a second salicylate 1-hydroxylase gene situated outside of the sal operon has been observed, whereas in Acinetobacter sp. strain ADP1 the gene encoding salicylate 1-hydroxylase is in the same transcription unit, but only with a LysR type regulator (18). The physical linkage of a salicylate 1-hydroxylase gene with genes encoding enzymes of the ortho cleavage pathway has, to the best of our knowledge, not been observed.

Properties of gene products of the sal gene cluster. Only a few proteobacterial catechol 1,2-dioxygenases have been described in detail for their catabolic properties. In all cases reported to date, catechol is the preferred substrate, as indicated by specificity constants of 30- to 100-fold that of 4-chlorocatechol (10, 52) and 6- to 40-fold that of 4-methylcatechol (10, 52, 62). C12OsalD of MT1 is particular in this respect; its specificity constants for catechol and 4-chlorocatechol are similar, and of the substrates tested, 4-methylcatechol is the preferred substrate.

MCIsalC also, compared to previously described proteobacterial enzymes (53, 58), showed remarkable activities against 3-substituted muconates, with 3-chloromuconate and specifically 3-methylmuconate to be preferred over muconate as substrates. A thorough analysis of the P. putida PRS200-derived cycloisomerase has been performed by Vollmer et al. (58). Based on known 3-dimensional structures, variants of the cycloisomerase had been constructed by site-directed mutagenesis; an I54V (numbering according to MCI of P. putida PRS2000) derivative showed a significant increase in turnover of 3-chloromuconate, and 3-methylmuconate was the preferred substrate for this derivative (58). Sequence analysis revealed that MCIsalC, but not MCIcatB, harbored a valine residue at the appropriate position, in contrast to all other natural proteobacterial gene variants reported thus far. It can therefore be reasoned that this variation is at least partially responsible for the extraordinary substrate specificity of MCIsalC. However, compared to the I54V derivative, MCIsalC showed a 30-fold higher kcat and a significantly lower affinity with muconate, an effect not reached by any of the site-directed mutants constructed by Vollmer et al. (58). Further investigations are thus necessary to unravel the underlying reason for MCIsalC substrate specificity.

In contrast to MCIsalC and C12OsalD, SalOH does not differ significantly in kinetic parameters from previously described enzymes. Generally, salicylate 1-hydroxylases have broad substrate specificity and can transform various monosubstituted salicylates (3, 27, 64). Unfortunately, no thorough investigation on kinetic parameters is available, and generally, only Vmax values or kcat values are given. Usually, 4- and 5-methylsalicylate are transformed at a higher rate comparable to that of salicylate, whereas 4- and 5-chlorosalicylates are transformed less effectively.

Role of the sal gene cluster. In strain MT1, the function of the sal cluster is to effectively funnel 4- and 5-substituted salicylates into the ortho cleavage pathway (Fig. 4). For 4- and 5-methylsalicylate, transformation by enzymes of this cluster results in the formation of 4-methylmuconolactone (Fig. 4), a compound previously described as a dead-end product in Pseudomonas strains (8, 25). Transformation of this compound in C. necator JMP134 (39) and R. rhodochrous N75 (6), is catalyzed by a 4-methylmuconolactone methylisomerase transforming 4- into 3-methylmuconolactone (7, 43). This transformation allows a further degradation by muconolactone isomerases, in analogy to the 3-oxoadipate pathway, by abstracting a proton from the C-4 carbon (45). In fact, an operon comprising both a gene encoding 4-methylmuconolactone methylisomerase and a gene encoding methylmuconolactone isomerase has been identified in JMP 134 (13), and homologous genes have been identified in Cupriavidus necator H16 (PHG6385, NC_005241). Clearly, MT1 uses a similar pathway for degradation of 4-methylmuconolactone by initially isomerizing it into 3-methylmuconolactone. However, in contrast to the situation with C. necator, which also harbors catechol meta cleavage pathways (21, 22) and is reported to degrade methylaromatics by both intra- and extradiol cleavage (40, 41), MT1 metabolizes methylsalicylates exclusively via the ortho cleavage pathway (Fig. 4). A prerequisite for funneling methylaromatics into ortho cleavage pathways is the induction of both a catechol 1,2-dioxygenase and a muconate cycloisomerase during growth on methylaromatics. At least for Pseudomonas MT1, the cat gene cluster is not induced during growth on 4- or 5-methylsalicylate (or on 5-chlorosalicylate). Considering that CatR regulators are usually responsive to muconate (29, 35), it can be suggested that CatR of MT1 is not responsive, or at least is only poorly responsive, to 3-methylmuconate. Unfortunately, no information is available on detailed effector specificities of CatR proteins.


Figure 4
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 4. Metabolism of salicylate, 4- and 5-chlorosalicylate, and 4- and 5-methylsalicylate by Pseudomonas sp. strain MT1. Enzyme steps common to the degradation of these substrates are given at the top, and the specific isoenzymes induced during growth on each substrate are given below the corresponding enzyme steps. Hypothetical intermediates are shown in brackets. The formation of protoanemonin from 4-chloromuconolactone is either spontaneous or catalyzed by muconate cycloisomerases.

A similar strain capable of degrading methylbenzoate exclusively via the ortho cleavage pathway was previously obtained only after extensive genetic engineering (50). The goal of that approach had been to obtain a strain capable of simultaneously degrading both methyl- and chloroaromatics via ortho cleavage routes. Clearly, strain MT1 harbors that capability naturally. For the degradation of chlorosalicylates, strain MT1 has been reported to recruit a trans-dienelactone hydrolase capable of hydrolyzing 4-chloromuconolactone, the unstable intermediate of 3-chloromuconate transformation, thereby preventing the formation of protoanemonin (32). Identification and localization of the respective gene, which, together with the sal gene cluster and a gene encoding maleylacetate reductase, form a functional pathway for chlorosalicylate degradation, are currently in progress.


arrow
ACKNOWLEDGMENTS
 
The work was supported by the DFG-European Graduate College 653.

We thank Rita Getzlaff (GBF) for N-terminal protein amino acid sequencing and Agnes Waliczek for support in preparation of gene libraries. We gratefully acknowledge Andrew Oxley, Hannes Nahrstedt, and Howard Junca for inspiring discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Bereich Mikrobiologie, AG Biodegradation, HZI—Helmholtz Zentrum für Infektionsforschung, Inhoffenstrasse 7, D-38124 Braunschweig, Germany. Phone: 49 531 6181 4200. Fax: 49 531 6181 4499. E-mail: dpi{at}helmholtz-hzi.de. Back

{triangledown} Published ahead of print on 15 December 2006. Back

{dagger} Present address: Novo Nordisk A/S, Hallas Allé, DK-4400 Kalundborg, Denmark. Back


arrow
REFERENCES
 
    1
  1. Blasco, R., R.-M. Wittich, M. Mallavarapu, K. N. Timmis, and D. H. Pieper. 1995. From xenobiotic to antibiotic. Formation of protoanemonin from 4-chlorocatechol by enzymes of the 3-oxoadipate pathway. J. Biol. Chem. 270:29229-29235.[Abstract/Free Full Text]
  2. 2
  3. Bosch, R., E. Garcia-Valdes, and E. R. B. Moore. 1999. Genetic characterization and evolutionary implications of a chromosomally encoded naphthalene-degradation upper pathway from Pseudomonas stutzeri AN10. Gene 236:149-157.[CrossRef][Medline]
  4. 3
  5. Bosch, R., E. R. B. Moore, E. Garcia Valdes, and D. H. Pieper. 1999. NahW, a novel, inducible salicylate hydroxylase involved in mineralization of naphthalene by Pseudomonas stutzeri AN10. J. Bacteriol. 181:2315-2322.[Abstract/Free Full Text]
  6. 4
  7. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
  8. 5
  9. Briganti, F., E. Pessione, C. Giunta, and A. Scozzafava. 1997. Purification, biochemical properties and substrate specificity of a catechol 1,2-dioxygenase from a phenol degrading Acinetobacter radioresistens. FEBS Lett. 416:61-64.[CrossRef][Medline]
  10. 6
  11. Bruce, N. C., and R. B. Cain. 1988. ß-Methylmuconolactone, a key intermediate in the dissimilation of methylaromatic compounds by a modified 3-oxoadipate pathway evolved in nocardioform actinomycetes. FEMS Microbiol. Lett. 50:233-239.
  12. 7
  13. Bruce, N. C., R. B. Cain, D. H. Pieper, and K.-H. Engesser. 1989. Purification and characterization of 4-methylmuconolactone methyl-isomerase, a novel enzyme of the modified 3-oxoadipate pathway in nocardioform actinomycetes. Biochem. J. 262:303-312.[Medline]
  14. 8
  15. Catelani, D., A. Fiecchi, and E. Galli. 1971. (+)-{gamma}-Carboxymethyl-{gamma}-methyl-{Delta}{alpha}-butenolide. A 1,2-ring-fission product of 4-methylcatechol by Pseudomonas desmolyticum. Biochem. J. 121:89-92.[Medline]
  16. 9
  17. Dennis, J., and G. Zylstra. 2004. Complete sequence and genetic organization of pDTG1, the 83 kilobase naphthalene degradation plasmid from Pseudomonas putida strain NCIB 9816-4. J. Mol. Biol. 341:753-768.[CrossRef][Medline]
  18. 10
  19. Dorn, E., and H.-J. Knackmuss. 1978. Chemical structure and biodegradability of halogenated aromatic compounds. Substituent effects on 1,2-dioxygenation of catechol. Biochem. J. 174:85-94.[Medline]
  20. 11
  21. Dorn, E., and H.-J. Knackmuss. 1978. Chemical structure and biodegradability of halogenated aromatic compounds. Two catechol 1,2-dioxygenases from a 3-chlorobenzoate-grown pseudomonad. Biochem. J. 174:73-84.[Medline]
  22. 12
  23. Dumas, J., C. van Delden, K. Perron, and T. Koehler. 2006. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol. Lett. 254:217-225.[CrossRef][Medline]
  24. 13
  25. Erb, R., K. Timmis, and D. Pieper. 1998. Characterization of a gene cluster from Ralstonia eutropha JMP134 encoding metabolism of 4-methylmuconolactone. Gene 206:53-62.[CrossRef][Medline]
  26. 14
  27. Galvao, T., and V. de Lorenzo. 2006. Transcriptional regulators à la carte: engineering of new effector specificities in bacterial regulatory proteins. Curr. Opin. Biotechnol. 17:34-42.[CrossRef][Medline]
  28. 15
  29. Harwood, C. S., and R. E. Parales. 1996. The beta-ketoadipate pathway and the biology of self-identity. Annu. Rev. Microbiol. 50:553-590.[CrossRef][Medline]
  30. 16
  31. Jimenez, J. I., B. Minambres, J. L. Garcia, and E. Diaz. 2002. Genomic analysis of the aromatic catabolic pathways from Pseudomonas putida KT2440. Environ. Microbiol. 4:824-841.[CrossRef][Medline]
  32. 17
  33. Jimenez, J. I., B. Minambres, J. L. Garcia, and E. Diaz. 2004. Genomic insights in the metabolism of aromatic compounds in Pseudomonas, p. 425-462. In J. L. Ramos (ed.), The Pseudomonads, vol. 3. Biosynthesis of macromolecules and molecular metabolism. Kluwer Academic/Plenum Publishers, New York, NY.
  34. 18
  35. Jones, R. M., V. Pagmantidis, and P. A. Williams. 2000. sal genes determining the catabolism of salicylate esters are part of a supraoperonic cluster of catabolic genes in Acinetobacter sp. strain ADP1. J. Bacteriol. 182:2018-2025.[Abstract/Free Full Text]
  36. 19
  37. Junca, H., and D. Pieper. 2004. Functional gene diversity analysis in BTEX contaminated soils by means of PCR-SSCP DNA fingerprinting: comparative diversity assessment against bacterial isolates and PCR-DNA clone libraries. Environ. Microbiol. 6:95-110.[CrossRef][Medline]
  38. 20
  39. Junca, H., I. Plumeier, H. Hecht, and D. Pieper. 2004. Difference in kinetic behaviour of catechol 2,3-dioxygenase variants from a polluted environment. Microbiology 150:4181-4187.[Abstract/Free Full Text]
  40. 21
  41. Kabisch, M., and P. Fortnagel. 1990. Nucleotide sequence of metapyrocatechase I (catechol 2,3-oxygenase I) gene mpcI from Alcaligenes eutrophus JMP222. Nucleic Acids Res. 18:3405-3406.[Free Full Text]
  42. 22
  43. Kabisch, M., and P. Fortnagel. 1990. Nucleotide sequence of the metapyrocatechase II (catechol 2,3-oxygenase II) gene mpcII from Alcaligenes eutrophus JMP 222. Nucleic Acids Res. 18:5543.[Free Full Text]
  44. 23
  45. Kaschabek, S. R., and W. Reineke. 1992. Maleylacetate reductase of Pseudomonas sp. strain B13: dechlorination of chloromaleylacetates, metabolites in the degradation of chloroaromatic compounds. Arch. Microbiol. 158:412-417.[Medline]
  46. 24
  47. Kim, S. I., S. H. Leem, J. S. Choi, Y. H. Chung, S. Kim, Y. M. Park, Y. K. Park, Y. N. Lee, and K. S. Ha. 1997. Cloning and characterization of two catA genes in Acinetobacter lwoffii K24. J. Bacteriol. 179:5226-5231.[Abstract/Free Full Text]
  48. 25
  49. Knackmuss, H.-J., M. Hellwig, H. Lackner, and W. Otting. 1976. Cometabolism of 3-methylbenzoate and methylcatechols by a 3-chlorobenzoate utilizing Pseudomonas: accumulation of (+)-2,5-dihydro-4-methyl- and (+)-2,5-dihydro-2-methyl-5-oxo-furan-2-acetic acid. Eur. J. Appl. Microbiol. 2:267-276.[CrossRef]
  50. 26
  51. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  52. 27
  53. Lamanda, A., A. Zahn, D. Roder, and H. Langen. 2004. Improved Ruthenium II tris (bathophenantroline disulfonate) staining and destaining protocol for a better signal-to-background ratio and improved baseline resolution. Proteomics 4:599-608.[CrossRef][Medline]
  54. 28
  55. Li, W., J. D. Shi, X. G. Wang, Y. N. Han, W. Tong, L. Ma, B. Liu, and B. L. Cai. 2004. Complete nucleotide sequence and organization of the naphthalene catabolic plasmid pND6-1 from Pseudomonas sp. strain ND6. Gene 336:231-240.[CrossRef][Medline]
  56. 29
  57. McFall, S. M., S. A. Chugani, and A. M. Chakrabarty. 1998. Transcriptional activation of the catechol and chlorocatechol operons: variations on a theme. Gene 223:257-267.[CrossRef][Medline]
  58. 30
  59. Murakami, S., A. Takashima, J. Takemoto, S. Takenaka, R. Shinke, and K. Aoki. 1999. Cloning and sequence analysis of two catechol-degrading gene clusters from the aniline-assimilating bacterium Frateuria species ANA-18. Gene 226:189-198.[CrossRef][Medline]
  60. 31
  61. Nakai, C., T. Nakazawa, and M. Nozaki. 1988. Purification and properties of catechol 1,2-dioxygenase (pyrocatechase) from Pseudomonas putida mt-2 in comparison with that from Pseudomonas arvilla C-1. Arch. Biochem. Biophys. 267:701-713.[CrossRef][Medline]
  62. 32
  63. Nikodem, P., V. Hecht, M. Schlömann, and D. H. Pieper. 2003. New bacterial pathway for 4- and 5-chlorosalicylate degradation via 4-chlorocatechol and maleylacetate in Pseudomonas sp. strain MT1. J. Bacteriol. 185:6790-6800.[Abstract/Free Full Text]
  64. 33
  65. Nojiri, H., K. Maeda, H. Sekiguchi, M. Urata, M. Shintani, T. Yoshida, H. Habe, and T. Omori. 2002. Organization and transcriptional characterization of catechol degradation genes involved in carbazole degradation by Pseudomonas resinovorans strain CA10. Biosci. Biotechnol. Biochem. 66:897-901.[CrossRef][Medline]
  66. 34
  67. Page, R. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12:357-358.[Free Full Text]
  68. 35
  69. Parsek, M. R., D. L. Shinabarger, R. K. Rothmel, and A. M. Chakrabarty. 1992. Roles of CatR and cis, cis-muconate in activation of the catBC operon, which is involved in benzoate degradation in Pseudomonas putida. J. Bacteriol. 174:7798-7806.[Abstract/Free Full Text]
  70. 36
  71. Paulsen, I. T., C. M. Press, J. Ravel, D. Y. Kobayashi, G. S. Myers, D. V. Mavrodi, R. T. DeBoy, R. Seshadri, Q. Ren, R. Madupu, R. J. Dodson, A. S. Durkin, L. M. Brinkac, S. C. Daugherty, S. A. Sullivan, M. J. Rosovitz, M. L. Gwinn, L. Zhou, D. J. Schneider, S. W. Cartinhour, W. C. Nelson, J. Weidman, K. Watkins, K. Tran, H. Khouri, E. A. Pierson, L. S. Pierson III, L. S. Thomashow, and J. E. Loper. 2005. Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat. Biotechnol. 23:873-878.[CrossRef][Medline]
  72. 37
  73. Pfaffl, M. W., G. W. Horgan, and L. Dempfle. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30:e36.[Abstract/Free Full Text]
  74. 38
  75. Pieper, D., and W. Reineke. 2004. Degradation of chloroaromatics by Pseudomona(d)s, p. 509-574. In J. L. Ramos (ed.), The Pseudomonads, vol. 3. Biosynthesis of macromolecules and molecular metabolism. Kluwer Academic/Plenum Publishers, New York, NY.
  76. 39
  77. Pieper, D. H., K.-H. Engesser, R. H. Don, K. N. Timmis, and H.-J. Knackmuss. 1985. Modified ortho-cleavage pathway in Alcaligenes eutrophus JMP134 for the degradation of 4-methylcatechol. FEMS Microbiol. Lett. 29:63-67.
  78. 40
  79. Pieper, D. H., K.-H. Engesser, and H.-J. Knackmuss. 1989. Regulation of catabolic pathways of phenoxyacetic acids and phenols in Alcaligenes eutrophus JMP 134. Arch. Microbiol. 151:365-371.[CrossRef]
  80. 41
  81. Pieper, D. H., W. Reineke, K.-H. Engesser, and H.-J. Knackmuss. 1988. Metabolism of 2,4-dichlorophenoxyacetic acid, 4-chloro-2-methylphenoxyacetic acid and 2-methylphenoxyacetic acid by Alcaligenes eutrophus JMP 134. Arch. Microbiol. 150:95-102.[CrossRef]
  82. 42
  83. Pieper, D. H., K. Stadler-Fritzsche, K.-H. Engesser, and H.-J. Knackmuss. 1993. Metabolism of 2-chloro-4-methylphenoxyacetate by Alcaligenes eutrophus JMP 134. Arch. Microbiol. 160:169-178.[Medline]
  84. 43
  85. Pieper, D. H., K. Stadler-Fritzsche, H.-J. Knackmuss, K. H. Engesser, N. C. Bruce, and R. B. Cain. 1990. Purification and characterization of 4-methylmuconolactone methylisomerase, a novel enzyme of the modified 3-oxoadipate pathway in the Gram-negative bacterium Alcaligenes eutrophus JMP 134. Biochem. J. 271:529-534.[Medline]
  86. 44
  87. Potrawfke, T., J. Armengaud, and R. M. Wittich. 2001. Chlorocatechols at positions 4 and 5 are substrates of the broad-spectrum chlorocatechol 1,2-dioxygenase of Pseudomonas chlororaphis RW71. J. Bacteriol. 183:997-1011.[Abstract/Free Full Text]
  88. 45
  89. Prucha, M., A. Peterseim, and D. H. Pieper. 1997. Evidence for an isomeric muconolactone isomerase involved in the metabolism of 4-methylmuconolactone by Alcaligenes eutrophus JMP134. Arch. Microbiol. 168:33-38.[CrossRef][Medline]
  90. 46
  91. Prucha, M., V. Wray, and D. H. Pieper. 1996. Metabolism of 5-chlorosubstituted muconolactones. Eur. J. Biochem. 237:357-366.[Medline]
  92. 47
  93. Reams, A. B., and E. L. Neidle. 2003. Genome plasticity in Acinetobacter: new degradative capabilities acquired by the spontaneous amplification of large chromosomal segments. Mol. Microbiol. 47:1291-1304.[CrossRef][Medline]
  94. 48
  95. Reineke, W. 1998. Development of hybrid strains for the mineralization of chloroaromatics by patchwork assembly. Annu. Rev. Microbiol. 52:287-331.[CrossRef][Medline]
  96. 49
  97. Reineke, W., and H.-J. Knackmuss. 1988. Microbial degradation of haloaromatics. Annu. Rev. Microbiol. 42:263-287.[CrossRef][Medline]
  98. 50
  99. Rojo, F., D. H. Pieper, K. H. Engesser, H. J. Knackmuss, and K. N. Timmis. 1987. Assemblage of ortho cleavage route for simultaneous degradation of chloro- and methylaromatics. Science 238:1395-1398.[Abstract/Free Full Text]
  100. 51
  101. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  102. 52
  103. Sauret-Ignazi, G., J. Gagnon, C. Beguin, M. Barrelle, Y. Markowicz, J. Pelmont, and A. Toussaint. 1996. Characterisation of a chromosomally encoded catechol 1,2-dioxygenase (EC 1.13.11.1) from Alcaligenes eutrophus CH34. Arch. Microbiol. 166:42-50.[CrossRef][Medline]
  104. 53
  105. Schmidt, E., and H.-J. Knackmuss. 1980. Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem. J. 192:339-347.[Medline]
  106. 54
  107. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. L. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. S. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. W. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959-964.[CrossRef][Medline]
  108. 55
  109. Suzuki, K., A. Ichimura, N. Ogawa, A. Hasebe, and K. Miyashita. 2002. Differential expression of two catechol 1,2-dioxygenases in Burkholderia sp. strain TH2. J. Bacteriol. 184:5714-5722.[Abstract/Free Full Text]
  110. 56
  111. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.[Abstract/Free Full Text]
  112. 57
  113. Uchiyama, T., T. Abe, T. Ikemura, and K. Watanabe. 2005. Substrate-induced gene-expression screening of environmental metagenome libraries for isolation of catabolic genes. Nat. Biotechnol. 23:88-93.[CrossRef][Medline]
  114. 58
  115. Vollmer, M. D., H. Hoier, H. J. Hecht, U. Schell, J. Groning, A. Goldman, and M. Schlömann. 1998. Substrate specificity of and product formation by muconate cycloisomerases: an analysis of wild-type enzymes and engineered variants. Appl. Environ. Microbiol. 64:3290-3299.[Abstract/Free Full Text]
  116. 59
  117. Vollmer, M. D., and M. Schlömann. 1995. Conversion of 2-chloro-cis, cis-muconate and its metabolites 2-chloro- and 5-chloromuconolactone by chloromuconate cycloisomerase of pJP4 and pAC27. J. Bacteriol. 177:2938-2941.[Abstract/Free Full Text]
  118. 60
  119. Vollmer, M. K., P. Fischer, H.-J. Knackmuss, and M. Schlömann. 1994. Inability of muconate cycloisomerases to cause dehalogenation during conversion of 2-chloro-cis, cis-muconate. J. Bacteriol. 176:4366-4375.[Abstract/Free Full Text]
  120. 61
  121. Wallis, M., and S. Chapman. 1990. Isolation and partial characterization of an extradiol non-haem iron dioxygenase which preferentially cleaves 3-methylcatechol. Biochem. J. 266:605-609.[Medline]
  122. 62
  123. Wang, C. L., S. Takenaka, S. Murakami, and K. Aoki. 2001. Production of catechol from benzoate by the wild strain Ralstonia species Ba-0323 and characterization of its catechol 1,2-dioxygenase. Biosci. Biotechnol. Biochem. 65:1957-1964.[CrossRef][Medline]
  124. 63
  125. Yen, K.-M., and C. M. Serdar. 1988. Genetics of naphthalene catabolism in Pseudomonas. Crit. Rev. Microbiol. 15:247-268.[Medline]
  126. 64
  127. Zhao, H., D. Chen, Y. Li, and B. Cai. 2005. Overexpression, purification and characterization of a new salicylate hydroxylase from naphthalene-degrading Pseudomonas sp. strain ND6. Microbiol. Res. 160:307-313.[CrossRef][Medline]


Journal of Bacteriology, March 2007, p. 1664-1674, Vol. 189, No. 5
0021-9193/07/$08.00+0     doi:10.1128/JB.01192-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cámara, B.
Right arrow Articles by Pieper, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cámara, B.
Right arrow Articles by Pieper, D. H.