This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mates, A. K.
Right arrow Articles by Foster, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mates, A. K.
Right arrow Articles by Foster, J. W.
Right arrowPubmed/NCBI databases
*Domain*Gene
*GEO Profiles

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2007, p. 2759-2768, Vol. 189, No. 7
0021-9193/07/$08.00+0     doi:10.1128/JB.01490-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Products of the Escherichia coli Acid Fitness Island Attenuate Metabolite Stress at Extremely Low pH and Mediate a Cell Density-Dependent Acid Resistance{triangledown}

Aaron K. Mates, Atef K. Sayed, and John W. Foster*

Department of Microbiology and Immunology, University of South Alabama College of Medicine, Mobile, Alabama 36688

Received 21 September 2006/ Accepted 16 January 2007


arrow
ABSTRACT
 
Escherichia coli has an ability, rare among the Enterobacteriaceae, to survive extreme acid stress under various host (e.g., human stomach) and nonhost (e.g., apple cider) conditions. Previous microarray studies have exposed a cluster of 12 genes at 79 centisomes collectively called an acid fitness island (AFI). Four AFI genes, gadA, gadX, gadW, and gadE, were already known to be involved in an acid resistance system that consumes an intracellular proton through the decarboxylation of glutamic acid. However, roles for the other eight AFI gene products were either unknown or subject to conflicting findings. Two new aspects of acid resistance are described that require participation of five of the remaining eight AFI genes. YhiF (a putative regulatory protein), lipoprotein Slp, and the periplasmic chaperone HdeA protected E. coli from organic acid metabolites produced during fermentation once the external pH was reduced to pH 2.5. HdeA appears to handle protein damage caused when protonated organic acids diffuse into the cell and dissociate, thereby decreasing internal pH. In contrast, YhiF- and Slp-dependent systems appear to counter the effects of the organic acids themselves, specifically succinate, lactate, and formate, but not acetate. A second phenomenon was defined by two other AFI genes, yhiD and hdeD, encoding putative membrane proteins. These proteins participate in an acid resistance mechanism exhibited only at high cell densities (>108 CFU per ml). Density-dependent acid resistance does not require any demonstrable secreted factor and may involve cell contact-dependent activation. These findings further define the complex physiology of E. coli acid resistance.


arrow
INTRODUCTION
 
Enteric microorganisms experience extreme inorganic acid stress (pH 2 or less) as they traverse the stomach en route to the intestine, where conditions are less acidic (pH 5.5 to 8). However, in the intestine the organisms encounter another type of acid stress involving organic acids produced by anaerobic microbial fermentations (e.g., propionic, butyric, and acetic acids). To counter these stresses, pathogenic and commensal strains of Escherichia coli possess remarkable systems of acid resistance (AR) rivaling those of Helicobacter pylori, a species that has evolved to live in the stomach. E. coli, for instance, will survive for hours in a pH 2 environment, whereas organisms such as Vibrio cholerae and Salmonella enterica typically lose viability within minutes.

Mechanistic and regulatory aspects of E. coli acid resistance have been intensively studied over the past decade (14). Research has revealed two general forms of acid resistance. One form is amino acid dependent, while the other is amino acid independent (11, 13, 14, 17, 18, 20, 25, 28, 40, 46). The mechanism of amino acid-independent acid resistance, also known as the glucose-repressed or oxidative acid resistance system, remains enigmatic. However, the amino acid-dependent systems are known to require specific amino acid decarboxylases (GadA/B, AdiA, and CadA) and cognate antiporters (GadC, AdiC, and CadC) that import amino acid substrates (glutamic acid, arginine, or lysine, respectively) in exchange for exporting their respective decarboxylation products ({gamma}-amino butyric acid, agmatine, and cadaverine). The decarboxylation reaction consumes an intracellular proton, which helps maintain a less acidic intracellular pH (39). These systems also require participation by any one of three Cl/H+ antiporters, although their roles are unclear (1, 2, 24).

Despite intensive study, important gaps in our knowledge of acid resistance remain. One of those gaps involves a cluster of 12 protein-encoding genes located at 78.8 min (bp 3652313 to 3665210) on the E. coli K-12 genome, shown in Fig. 1, which has been termed an acid fitness island (AFI) (22). These genes (slpA through gadA) are unique to E. coli and the closely related genus Shigella, which also exhibits profound levels of acid resistance. Microarray studies have shown that most of the AFI genes in E. coli are induced by growth under acidic conditions, and mutations in some members have been associated with an inability to survive pH 2 environments (19, 26, 35, 51). Most notable are gadA, encoding an isozyme of glutamate decarboxylase (45, 47), and gadE, the essential activator of glutamate-dependent acid resistance (22, 30). Two other genes in this region, GadX and GadW, are involved in modulating gadE expression as well as the expression of gadA and gadBC (16, 32, 33, 44, 48-50, 52). However, the contribution of other AFI genes toward acid resistance has remained unclear.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 1. E. coli acid fitness island. This genomic island is situated at centisomes 78.7 to 79.9 (bp 3652706 to 3665603) on the MG1655 chromosome. Black arrows represent regulators, while heavy gray arrows depict other members of the genomic island. The yhiUV genes have also been termed mdtEF, and their products confer resistance to rhodamine 6S and SDS (21, 36).

There are at least three, seemingly contradictory, reports about possible roles for other AFI genes in acid resistance. The confusion stems from the fact that different laboratories have used very different methods to induce or measure acid resistance. One study overexpressed two regulators (EvgA and YdeO) to artificially activate pH 2.5 acid resistance in log-phase, LB-grown cells (35). These log-phase cells, in the absence of overexpression, are normally acid sensitive. The overexpression strategy was used to define, by microarray analyses, a potential acid resistance regulatory network. In the process, they found that a subset of the fitness island genes (yhiF, hdeA, hdeD, and gadE) were required for YdeO overexpression-dependent acid resistance. However, the acid-resistant, positive control cultures (i.e., log-phase cells overexpressing these regulators) only showed a modest level of acid resistance (1.5% survival after 1 h in pH 2.5 LB) compared to naturally induced acid resistance, in which stationary-phase cells survive at 50 to 100% after 2 h at pH 2.5. Mutants defective in hdeB, yhiD, yhiU, and -V within the fitness island had little to no effect on acid resistance. A contradictory report that used acid-grown, log-phase cells tested in a minimal medium at pH 2.75 did not find an acid resistance phenotype associated with any gene in the area other than with gadE (yhiE), gadX, and gadW (51).

A completely different strategy was used in a third study. E. coli wild-type and hdeA mutant cell cultures were grown to stationary phase in LB, at which point the pH of the liquid cultures, containing metabolic products of growth, was directly acidified to pH 2.5 (15). After 1 hour, cells were diluted into fresh LB broth (pH 7), and outgrowth was measured by optical density. Wild-type cells survived this pH 2.5 stress and rapidly grew after dilution. The hdeA mutant failed to grow, indicating it did not survive the stress. However, we show in the current report that an hdeA mutation has little effect on acid resistance when tested in fresh pH 2.5 minimal medium. These conflicting findings suggested that different AFI genes have conditional influences on acid resistance.

We now report that six AFI genes contribute to two newly described features of acid resistance. First, HdeA (encoding a periplasmic chaperone), YhiF (encoding a putative LuxR family regulator), and the lipoprotein Slp, along with the GadE regulator, are required to protect E. coli from its own metabolic products when placed either in pH 2.5-adjusted, spent LB or spent minimal glucose culture filtrates. Second, a new acid resistance phenotype evident only in high-cell-density cultures was discovered that requires two other AFI genes, YhiD (encoding a putative MgtC-family transporter) and a predicted inner membrane protein, HdeD. GadE, which activates these genes, was also required for high cell density-dependent acid resistance. The results underscore the versatility with which E. coli can protect itself from extreme acid stress.


arrow
MATERIALS AND METHODS
 
Strains, plasmids, and growth media. The bacterial strains used in this study were derivatives of MG1655 (Table 1). Most strains were constructed earlier; however, the {Delta}yhiF::Km mutant (EF1546) was constructed during this study using the Red recombinase method (12) and oligonucleotides 521 (5'-AAACTGATTATAAAGTTAATGTCCGCACCAGGAGTCGGTTGTGTAGGCTGGAGCTGCTTC) and 522 (5'-CTGTGTGGCAGCGTAGCCAGACTCACCGTAAGCCTGAAATCATATGAATATCCTCCTTAG). Wild-type yhiF+ was cloned into pQE80L in a stepwise manner. A PCR fragment containing the YhiF open reading frame was made using oligos 799 (5'-CATCACGGATCCTTTCTTATAATTACC) and 800 (5'-CTAATTAAGCTTTCACACCAGATAATCAATATGC) and cloned into the pCR4-TOPO vector between the BamH1 and HindII sites. The BamHI-HindIII fragment was then subcloned into pQE80L to make pFW584.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Strains used

The media used included complex LB medium buffered with 100 mM morpholinepropanesulfonic acid (MOPS) to pH 8.0 (LB pH 8) or 100 mM morpholineethanesulfonic acid to pH 5.5 (LB pH 5.5) and unbuffered LB containing 0.4% glucose. Minimal E medium (53) contained 0.4% glucose (EG). Cultures were grown at 37°C with aeration. Log-phase cells were prepared via a 1:1,000 dilution of 18-h cultures into fresh medium followed by growth to an optical density at 600 nm of 0.3 to 0.4 (approximately 2 x 108 CFU/ml). Stationary-phase cells were collected after 18 h of incubation (approximately 2 x 109 to 4 x 109 CFU per ml). Antibiotics were used at the following concentrations: ampicillin (Ap), 60 µg/ml; kanamycin (Km), 50 µg/ml; tetracycline (Tc), 30 µg/ml; chloramphenicol (Cm), 40 µg/ml.

Acid resistance assays using low-density cultures. Cells were grown for 18 h in LB pH 8 or LB pH 5.5 and diluted 1:1,000 into various acid challenge media. The initial cell density during acid challenge was between 2 x 106 and 4 x 106 CFU per ml. AR system 1 was tested by making dilutions from LB pH 5 and LB pH 8 overnight cultures into EG pH 2.5 challenge medium (no amino acid supplementation). Wild-type cells grown in LB pH 5 are acid resistant, while cells grown in LB pH 8 are acid sensitive. AR system 2, the glutamate-dependent system, is evident in any wild-type culture grown to stationary phase. For this study, stationary-phase cells grown in LB pH 8 were diluted 1:1,000 into pH 2.5 EG medium without (negative control) or with 1.5 mM sodium glutamate. The pH 2.5 cultures were incubated at 37°C without shaking, and samples were collected at intervals to determine viable counts. Aliquots were serially diluted, and duplicates were plated onto LB medium. Colonies were counted after 18 to 24 h. Percent survival was calculated as follows: [(CFU/ml at time X)/(CFU/ml at time zero)] x 100. The results presented are averages of triplicate experiments and include the standard error of the mean. Since time zero values are, by definition, all 100%, error bars were not applied to that time point.

Spent medium acid resistance was tested using spent LB and spent EG medium. Spent medium was prepared by growing MG1655 for 18 h in 100 ml of unbuffered LB in a 125-ml flask, or in 100 ml of EG in a 250-ml flask, at 37°C with shaking (225 rpm). These were low-oxygen conditions in which the final culture pH values were 7.4 and 6.0 for LB and EG, respectively. The pH of filter-sterilized spent medium was then adjusted to pH 2.5 with HCl. Stationary-phase LB pH 8-grown cultures were then diluted 1:1,000 into the pH 2.5 spent medium, and survival was measured as noted earlier.

High-cell-density acid resistance. Cells were grown for 18 h in LB MOPS pH 8 at 37°C with shaking. To test high-density acid resistance, cells from 1 ml of culture were collected by centrifugation at room temperature and washed quickly in 1 ml of pH 5.6 EG to bring the pH closer to the final challenge pH and to remove components of LB. The cells were again collected by centrifugation and finally resuspended in 3 ml of pH 2.1 EG for acid challenge. Initial cell density for acid challenge was between 2 x 108 and 4 x 108 CFU/ml, 100-fold higher than in the standard, low-density tests. The acid-challenged culture was incubated stationary at 37°C, and aliquots were taken at timed intervals to measure viable count. Low-cell-density acid resistance controls were carried out by diluting the pH 5.6 resuspended cells 1:1,000 into pH 2.1 EG (final cell density between 2 x 106 and 4 x 106 CFU per ml). Aliquots were taken at timed intervals, and viable were counts determined as above.

Mixing high-density and low-density cultures. Cultures of wild-type and drug-resistant mutant strains were grown independently in LB MOPS pH 8 and tested for high-density AR. Cells from one drug resistance-tagged strain (taken from the pH 5.6 resuspension) were diluted 1:1,000 into the pH 5.6 resuspension of the other strain. The mixture was collected by centrifugation and resuspended in 3 ml of pH 2.1 EG. Cell viability of each strain was assessed by plating dilutions onto LB agar and LB agar containing appropriate drugs.


arrow
RESULTS
 
Effect of fitness island mutations on system 1 and system 2 acid resistance. Using the defined minimal medium strategy noted above, our laboratory had previously defined three acid resistance systems (14). One system, called AR 1, functions independently of extracellular amino acids. The other two systems, called AR 2 and AR 3, require glutamate and arginine, respectively. To test whether any of the AFI genes have a potential role in amino acid-dependent or -independent acid resistance, mutants defective in each gene were tested for the presence of the amino acid-independent system (AR 1) and for one of the amino acid-dependent systems (AR 2). A mutation in ydeP, which does not reside within the AFI locus, was also tested because it was implicated in acid resistance in an earlier study (34). As shown in Fig. 2A and B, the only gene that affected these systems was gadE. The gadA, -X, and W genes, with proven roles in acid resistance, were tested in earlier studies (16, 33, 44, 50, 52). Failure to see an effect of the other AFI genes (yhiF, yhiD, hdeB, hdeA, hdeD, or yhiUV) conflicted with some of the earlier studies noted above but suggested that the methodology of testing is important in revealing the roles of these gene products.


Figure 2
View larger version (58K):
[in this window]
[in a new window]

 
FIG. 2. Effect of acid fitness island mutations on amino acid-independent and glutamate-dependent acid resistance. A. System 1. Cells were grown for 18 h in LB medium buffered to pH 8 (shaded bars) or pH 5.5 (hatched bars) and used to inoculate pH 2.5 EG to a cell density of approximately 1 x 106 to 4 x 106 CFU per ml. Survival was determined at 2 hours. B. System 2. Cells from LB pH 5.5 cultures were used to inoculate pH 2.5 EG without supplementation (shaded bars) or containing 1.5 mM glutamic acid (hatched bars). Results are given as averages with standard errors of the means. Asterisks indicate viability was below the level of detection.

Acid resistance in spent LB medium requires YhiF, Slp, and HdeA. The apparent discrepancy between the earlier studies using LB at pH 2.5 and our strategy using pH 2.5 minimal medium suggested the AFI gene products might have a purpose beyond handling proton influx. To determine whether any AFI genes had condition-specific roles, the acid resistance phenotypes of wild-type and mutant cells were examined in pH 2.5 fresh LB and pH 2.5 cell-free spent LB prepared from an MG1655 overnight culture. Figure 3A reveals that most of the fitness island mutants, as well as ydeP, had little to no effect on acid resistance when tested in pH 2.5 fresh LB. As expected, the gadE mutant failed to survive, but, in addition, the hdeA mutant was found to be acid sensitive. After 4 hours the wild type exhibited 20% survival, whereas the hdeA mutant survived at less than 0.1%. This result suggests the HdeA periplasmic chaperone protects the cell from some component of LB that becomes toxic at pH 2.5.


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
FIG. 3. Effect of fitness island mutations on acid resistance in spent culture media. Cells grown for 18 h in pH 8 buffered LB medium were used to inoculate pH 2.5 fresh LB (A), pH 2.5 spent LB (B), or pH 2.5 spent EG (C) to a cell density of approximately 2 x 106 to 4 x 106 CFU per ml. Survival was determined at 0 (gray bars), 2 (cross-hatched bars), and 4 h (solid bars). Asterisks indicate survival was below the detection limit. Results are given as averages with standard errors of the means.

A role for two other members of the fitness island, YhiF (encoding a putative LuxR family regulator) and the lipoprotein Slp, became apparent when spent LB, prepared from stationary-phase cells, was acidified to pH 2.5 and used to test acid resistance. In this situation, the slp-yhiF and hdeA mutants, along with the gadE mutant, failed to survive pH 2.5 (Fig. 3B). Over a 4-h period, these mutants exhibited a 3- to 4-log decrease in survival relative to the wild type, with viability falling below detection after only 2 h. Since the slp mutant alone exhibited normal acid resistance, the sensitivity of the slp-yhiF mutant was initially thought to be due to the absence of yhiF. However, as shown below, it appears that both gene products participate in this acid resistance phenotype. The other AFI mutants remained resistant over this same time frame. These results suggest that metabolic end products secreted by E. coli during growth in LB add to the stress experienced at pH 2.5 and that Slp, YhiF, and HdeA are involved in handling that added stress.

E. coli secretes acid-protective and toxic compounds during growth in minimal glucose medium. We repeated the above experiments using spent minimal E glucose medium adjusted to pH 2.5. No glutamic acid was supplied during acid challenge. Because MG1655 dies rapidly in pH 2.5 fresh EG medium without glutamate present, we expected these cells would also quickly succumb when challenged at pH 2.5 in spent EG, as long as glutamate was not added. We were surprised, however, to find that MG1655 survived extremely well in the acidified spent challenge medium (Table 2, MG1655 fresh EG versus MG1655 spent EG). The results suggest that E. coli expels one or more compounds during growth that can be used for protection against later acid challenge. The protective effect was observed using spent EG from stationary-phase cultures and conditioned medium prepared from log-phase cultures (data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Survival of E. coli in fresh and spent EG

One obvious protective factor the cell could excrete to aid acid resistance is glutamic acid, which could later be utilized by the GadA, GadB, and GadC system under acid stress conditions. Previous studies have shown that E. coli growing in minimal medium can secrete glutamic acid (8, 9). A gadC mutant which lacks the antiporter required for glutamate-dependent acid resistance was used to test this idea. If secreted glutamate were the protective factor, then the gadC mutant should not survive in pH 2.5 spent EG. The result shown in Table 2 illustrates that this is the case (EF1505). Thus, glutamate secretion by E. coli has a purpose besides providing for metabolic overflow.

On the chance that GadE or a GadE-regulated gene product is also responsible for the secretion of glutamate, spent EG medium prepared from a gadE mutant culture was tested for a protective effect on MG1655. The results presented in Table 2 reveal that spent medium from the gadE mutant was also able to protect MG1655. Thus, secretion of glutamic acid is independent of GadE and GadE-dependent genes.

Based on the LB results above, we suspected other members of the fitness island might play a role in surviving pH 2.5 spent EG, if, as appears to be the case in LB, metabolic end products become toxic under extreme acid conditions. To explore this, we tested a gadE mutant for its ability to survive in MG1655 spent EG adjusted to pH 2.5. Since gadC is required for acid resistance in pH 2.5 spent EG and GadE is required to induce gadC, the gadE mutant also died quickly under this condition (Table 2). To show that loss of viability was not due to general toxicity of metabolic end products regardless of pH, the gadE mutant was also tested in spent SG at pH 6.3. Under this condition, the mutant lived and even grew slightly (Table 2).

Since GadE is also required for the expression of other AFI genes, we examined whether any of the AFI gene products also contributed to acid resistance in spent EG (pH 2.5). The results, using spent EG from MG1655, revealed that slp-yhiF, hdeA, and gadE were all required for survival in this medium, as was the case in pH 2.5 spent LB (Fig. 3C).

One potential explanation for the AFI gene requirement in spent minimal medium is that the excreted end products of glucose metabolism (for instance, weak acids) simply add to the proton stress E. coli must endure while at pH 2.5. Lowering the pH of fresh minimal medium to 2.0 will also increase proton stress. So, if YhiF and HdeA were required to handle the increased intracellular proton stress resulting from end product reentry and dissociation, then mutations in yhiF and hdeA, which have little effect on survival at pH 2.5 in fresh minimal medium containing glutamate, should become acid sensitive at pH 2.0 in the same medium. When tested at pH 2.0 in minimal medium with glutamate, the hdeA mutant actually did become acid sensitive (data not shown). However, the slp-yhiF mutant did not. The role of Slp, YhiF, and YhiF-dependent gene products may be to cope more directly with metabolites (for instance, the accumulated anions of dissociated weak acids) rather than simple proton stress.

YhiF and Slp provide redundant protection against metabolite stress at low pH. Since the slp mutant seemed proficient at handling metabolite stress, we initially concluded that YhiF was the relevant player. Previous research has shown that transcripts of slp and yhiF are distinct (3). However, it remained possible that Slp and YhiF define separate, redundant protection pathways. To determine whether YhiF alone was the relevant gene product, a yhiF single deletion mutant was constructed and tested. Table 2 reveals that neither slp nor yhiF alone affected survival, and only the slp-yhiF double mutant (EF618) experienced difficulty surviving in spent EG. This suggested that either gene product could mitigate the detrimental effects of the toxic metabolites. In addition, we found that a yhiF+-carrying plasmid introduced into the slp-yhiF mutant restored resistance to the double mutant (Table 2). The combined results suggest that Slp and YhiF define independent systems that protect the cell against metabolites that are toxic at pH 2.5.

YhiF-regulated gene products and Slp protect cells against lactic, succinic, and formic acids. To test the hypothesis that Slp and YhiF protect the cell against toxic metabolites, wild-type and slp-yhiF mutant strains were tested in fresh EG (pH 2.5) containing 1.5 mM glutamic acid that was also spiked with the common fermentation end products acetate, lactate, succinate, or formate. As shown before, the slp-yhiF mutant (EF618) was able to survive pH 2.5 in the presence of glutamate just as well as wild-type cells as long as fermentation end products were not included in the challenge medium (Fig. 4, first two bars). However, the slp-yhiF mutant survived poorly in the presence of 20 mM formate, 40 mM lactate, or 40 mM succinate, whereas wild-type cells maintained good viability (Fig. 4). Effects were also noted at lower concentrations of these organic acids, but culture viability declined more slowly. It is interesting that the YhiF and Slp systems were not required for survival in acetate up to 40 mM. It is possible that a gene outside of the AFI is required to cope with acetate at extremely low pH.


Figure 4
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 4. YhiF-dependent pathways protect against metabolic end products under extreme acid pH. Cells grown to stationary phase in pH 8 buffered LB were used to inoculate pH 2.5 fresh EG containing the additives shown: 1.5 mM glutamate, 20 mM sodium formate, 40 mM sodium lactate, 40 mM sodium succinate, or 40 mM sodium acetate. Cultures were inoculated to 2 x 106 to 4 x 106 CFU per ml and challenged for 4 h. Asterisks indicate survival was below the detection limit.

E. coli exhibits cell density-dependent acid resistance. In addition to their roles in protecting low-cell-density cultures of E. coli against metabolic end products that are toxic at pH 2.5, we wondered whether any of the AFI gene products might have a specific benefit toward high-cell-density cultures undergoing extreme acid stress. E. coli can achieve high cell densities as biofilms or as planktonic cultures in enclosed spaces that exist in host or nonhost environments. However, acid resistance, as shown above, has generally been studied using low-density cell cultures, approximately 106 CFU per ml, in acid challenge medium. Recently, while examining the molecular fate of cellular proteins during acid stress, we subjected high-cell-density cultures (>108 CFU/ml) to pH 2.1 in order to achieve higher concentrations of protein for analysis. This cell density is 100-fold higher than that normally used to measure acid resistance. Survival assays, however, revealed that cultures predicted to be acid sensitive nevertheless survived at a level 2 or more orders of magnitude higher than low-density cells at the same pH.

Figure 5 shows that MG1655 cells grown overnight (18 h) in LB pH 8 rapidly died when washed and diluted to 106 CFU per ml in pH 2.1 EG without amino acid supplementation. Between 10 and 20 min, viable counts decreased below the level of detection (approximately 0.003%). This was expected based on earlier studies. However, when the same cells were resuspended to over 108 CFU per ml in pH 2.1 medium, the viable count only decreased to about 1 to 5% after 20 min and held steady until at least 90 min. The survival margin between high-density and low-density cultures was consistently between 100- and 1,000-fold higher for the high-cell-density suspensions. The survivors did not represent more resistant stable mutants of MG1655, since isolation and retesting of the survivors yielded the same phenotypes at low and high densities (data not shown).


Figure 5
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 5. High cell density-dependent acid resistance. MG1655 (EK592) was grown for 18 h in pH 8 buffered LB. Cells were then washed and resuspended in pH 2.1 EG at low density (2 x 106 to 4 x 106 CFU per ml) or high density (2 x 106 to 4 x 108 CFU per ml). Survival was measured at timed intervals. Asterisks indicate viability was below the level of detection.

High-density cell cultures do not secrete a stable protective factor. Another possible explanation for these data is that dying cells present in the high-cell-density suspension release a factor (e.g., glutamic acid) that protects a subpopulation of the culture. Glutamic acid, if it were released upon suspension in pH 2.1 medium, could be used by the glutamate decarboxylase/GadC antiporter system and protect a subpopulation of the cells. We, therefore, tested whether cells in high-density cultures released any soluble factors that other cells could use to survive.

We prepared cell-free pH 2.1 EG medium conditioned with high-density cells for 5 or 60 min. One ml of wild-type cells grown overnight in pH 8 buffered LB was washed and resuspended in 3 ml of EG pH 2.1 (final density, approximately 2 x 108 CFU per ml). After 5 min and 60 min of challenge, when viable counts were 100% and 5%, respectively, the conditioned media were collected and filter sterilized. Wild-type cells were diluted to 2 x 106 CFU per ml in this pH 2.1 conditioned medium. If any stable protective factor were released into the pH 2.1 challenge medium, that factor should protect the newly added low-density cells. However, neither the 5-min nor the 60-min high-cell density-conditioned medium was able to protect low-density cells (data not shown). Thus, it appears that at high cell density, one subset of cells does not altruistically release a protective factor into the pH 2.1 medium that saves a smaller subset or, if it does, the factor must be unstable.

MG1655 at high density will protect a second MG1655 strain present at low cell density. The previous data indicated that a stable protective factor is not released by high-density cultures. An alternative possibility is that cell-cell contact at high density may afford protection of a subpopulation of the culture, a mechanism of potential importance in the context of biofilms. To begin to explore this model, we asked whether a high-density culture of one cell type could protect a second, drug-marked, strain added at low cell density in a mixed culture. Cells were mixed immediately before they were resuspended into pH 2.1 medium. Both wild-type strains (EK592 and EF1240), when tested individually, exhibited high cell density-dependent acid resistance (Fig. 6A and B). Low-density cultures died rapidly (<0.002% survival) at pH 2.1, while high-density cultures only declined to approximately 1%. However, when an MG1655 strain marked with Cmr (EF1240) was mixed at low density with a high-density MG1655 strain (EK592), both cultures survived at approximately 1%. The high-density strain was able to protect the second strain present at low density.


Figure 6
View larger version (56K):
[in this window]
[in a new window]

 
FIG. 6. Cross -rotection of a low cell density strain by a high cell density culture. EK592 (MG1655) and EF1240 (MG1655 Cmr) were grown for 18 in pH 8 buffered LB and tested for high and low cell density acid resistance (EG pH 2.1) as described for Fig. 4. Survival was determined by plating samples at timed intervals on LB in the absence or presence of chloramphenicol. (A) EK592; (B) EF1240; (C) mixture of EK592 (108 CFU per ml) and EF1240 (106 CFU per ml). Samples were plated on LB (to detect both strains) and LB plus Cm (to detect EF1240). Asterisks indicate viability was below the level of detection.

This result, in light of the fact that a secreted factor was not demonstrable, suggests that cell-cell contact in some form may be needed for protection. However, an aggregation mechanism in which peripheral cells might protect cells within the aggregate's center does not appear to be the reason for protection. Cells of pH 2.5 high-density cultures did not visibly aggregate when examined microscopically (not shown).

Mutants defective in gadE do not exhibit high-density acid resistance. We wondered if any of the AFI gene products might be required for this high cell density-dependent acid resistance. The gadE gene was tested first because it appears to control most genes within the island. In contrast to the wild type, a gadE mutant failed to survive pH 2.1 over 90 min even at high density, suggesting that a GadE-regulated gene product was involved in the phenomenon (Fig. 7A and B). At early time points, the gadE mutant did survive somewhat better than at low cell density but was unable to maintain resistance.


Figure 7
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 7. GadE-regulated gene products are required to implement high cell density acid resistance. Shown are the high cell density and low cell density acid resistance of wild type (EK592) (A), gadE mutant (EK1155) (B), and a mixture of high density (108 CFU/ml) wild type and low cell density (106 CFU/ml) gadE mutant (C). Asterisks indicate viability was below the level of detection.

A high-density wild-type culture was then tested for its ability to send an acid survival signal to a small number of comixed gadE mutant cells. The results, shown in Fig. 7C, indicate that high-density wild-type cells (108 CFU per ml) were unable to stimulate acid survival in the low-density gadE mutant cells (106 CFU per ml). Thus, gadE mutants are unable to effectively receive and/or process the acid survival signal from high-cell-density wild-type cells.

HdeD and YhiD are required for high-density acid resistance. Since gadE activates the AFI genes, we tested whether or not other AFI genes were important for high cell density-dependent acid resistance. Mutants defective in individual AFI genes were examined for a potential role in high cell density-dependent acid resistance. Two genes without a previously described phenotype, yhiD and hdeD, proved to be important for this mechanism (Fig. 8). High-density cultures of both mutants, along with gadE, progressively lost viability at pH 2.1 over time and eventually fell below detection. All other AFI mutants maintained viability at approximately 1%. The evidence indicates that at least part of the reason gadE mutants are defective in high-density AR is a failure to activate HdeD and YhiD. YhiD is a putative ATPase transporter within the MgtC family of transporters, and HdeD is a putative inner membrane protein of unknown function.


Figure 8
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 8. Effect of fitness island gene mutations on cell density-dependent AR. Cells grown for 18 h in pH 8 buffered LB were washed and resuspended in pH 2.1 EG at high density (2x 108 to 4 x 108 CFU per ml). Survival was measured at timed intervals. Asterisks indicate viability was below the level of detection.

Live cells are required to send a survival signal. High-density/low-density mixing experiments were also performed with the yhiD and hdeD mutant strains to determine if they were defective in receiving or in sending a survival signal. There were two significant findings arising from these experiments. First, high-density wild-type cells could not save either yhiD or hdeD mutant cultures comixed at low cell density (Fig. 9A and B). These results argue that both gene products must be present to carry out high cell density-dependent acid resistance. YhiD and HdeD are either needed to receive the survival signal from the high-density cells or to implement survival once the signal is received.


Figure 9
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 9. Ability of mutants to send and receive signals for high cell density AR. EK592 (MG1655), EF1240 (MG1655 Cmr), EK555 (hdeD::Km), and EK 592 (yhiD::Cm) were grown for 18 in pH 8 buffered LB. Strains were tested for low cell density acid resistance (EG pH 2.1) and in various high-density/low-density mixtures as described for Fig. 6. Survival was determined by plating samples at timed intervals on LB and LB with chloramphenicol (EK692) or kanamycin (EK555). The figure only reflects results obtained on drug plates and represents the low-density strain in mixes. A. EK555 at 106 CFU/ml without and with EK1240 at 108 CFU per ml. B. EK692 at 106 CFU/ml without and with EK592 at 108 CFU per ml. C. Mixture of EK555 (108 CFU per ml) and EF1240 (106 CFU per ml). Asterisks indicate viability was below the level of detection.

The second significant finding from these mixing experiments was that the hdeD mutant, when present at high cell density, could at least temporarily send a survival signal to low-density wild-type cells as long as the mutants retained some viability (Fig. 9C). The low-density wild-type culture survived at a significantly higher level when mixed with the hdeD mutant than when tested alone. However, the wild-type cells still died by 90 min, soon after the majority of the higher-density hdeD cells lost viability (Fig. 9C, last bar set). Control mixtures of the same wild-type strain mixed with another wild-type strain at high density (Fig. 6C) survived at 1 to 5% over the 90-min period (data not shown). When similarly tested, the gadE mutant was also able to transiently stimulate survival of wild-type MG1655 (data not shown).

The data suggest that neither HdeD nor GadE is involved in sending the protective signal, only in receiving or implementing it. The results also indicate that the simple presence of a high number of dead cells cannot protect lower-density cells. There must be some communication between live cells.


arrow
DISCUSSION
 
The results presented have revealed two new aspects of acid resistance physiology. The first is that there is a specific mechanism used by E. coli to survive in the presence of excreted metabolites that become toxic to cells under extreme acid stress. Slp, YhiF, and HdeA, three AFI gene products, are required to protect the cell against the pH-dependent toxic effects of these metabolites. HdeA, a periplasmic chaperone, appears to protect against the increased proton stress resulting from the presence of organic acids (15, 23, 26). YhiF, a transcriptional regulator, and Slp, an outer membrane lipoprotein, have more specific roles in reducing metabolite stress. Of the known glucose fermentation end products tested, survival in the presence of lactate, succinate, and formate required a Slp- or YhiF-dependent system (54).

HdeA is a chaperone with the unusual property of being able to bind to denatured proteins under acidic conditions (below pH 3) but not at neutral pH (23). It does this by transforming from an ordered conformation at neutral pH into a globally disordered conformation below pH 3. The disordered form allows HdeA to bind to denatured periplasmic proteins and prevent their aggregation. As illustrated here, HdeA appears to play a more important role in acid survival when tested in complex environments (LB) or in the presence of organic acids. HdeA appears to be dispensable in minimal medium at pH 2.5. Why this is is not clear. One possibility is that the chaperone effect of HdeA may protect other proteins required to cope with compounds that become more toxic as the environment acidifies. In the absence of such compounds, HdeA becomes less important. Alternatively, a recent report suggests that HdeB, another periplasmic chaperone, can substitute for HdeA (26). Mutations in both may be needed to see an effect.

YhiF encodes a putative LuxR family regulator; thus, the protection it affords is likely due to a YhiF-activated gene product. The YhiF regulon, however, has not been defined. One study has implicated YhiF as a negative regulator of the gene encoding the C4 transporter DctA and has suggested YhiF be called DctR (7). The DctA family is a subgroup of the dicarboxylate/amino acid:cation symporter or DAACS family. DctA in E. coli catalyzes H+ symport with C4-dicarboxylates (succinate, fumarate, and malate), dicarboxylic amino acids (aspartate and glutamate), or the monocarboxylic acid orotate as a pyrimidine source (5, 29). Enteric bacteria, in fact, can form up to 0.2 mol of succinate per mol of glucose in a mixed acid fermentation (6).

Since two protons enter the cell with each C4-dicarboxylate, it would seem that having the DctA transporter present at pH 2 would be ill advised. YhiF (DctR) repression of dctA might eliminate a pathway for proton import and may at least partially explain the selective role of YhiF (DctR) toward acid resistance in spent medium. In this model, one would predict that increased production of DctA in a yhiF mutant would increase organic acid and proton influx, thereby increasing cell death. However, introducing a dctA mutation into a slp-yhiF mutant did not suppress the acid-sensitive phenotype, which suggests that one or more YhiF-dependent gene products other than DctA are involved in acid resistance.

An alternative scenario is that DctA, under extreme acid pH conditions, may actually have a protective effect by exporting toxic organic acids. Formate, lactate, and succinate all have a carboxyl groups with pKa values less than pH 4.5 (formic acid, pKa 3.75; lactic acid, pKa 3.86; succinic acid, pKa1 4.19 and pKa2 5.57). Thus, all three organic acids will be fully protonated and uncharged at pH 2.5. Uncharged organic acids pass through intact membranes without assistance from a transporter and, once inside the cell, will release protons from side groups whose pKa values are below the pH of the cytoplasm. The internal pH of E. coli surviving at pH 2.5 is approximately 4.5; thus, any of these organic acids would be expected to release protons that could drive internal pH even more acidic (39). DctA could help expel these accumulated organic acids. However, when tested, a dctA mutant exhibited nearly wild-type levels of resistance to succinate, lactate, and formate at pH 2.5 (data not shown). The same result was obtained when dctA::spc was introduced into a slp mutant. These two lines of evidence argue against a role for DctA in this acid resistance system. The YhiF-dependent gene(s) mediating resistance to organic acids remains undiscovered.

Slp encodes an outer membrane lipoprotein whose role in E. coli physiology has remained enigmatic (3, 38). Its role may be to limit penetration of certain organic acids across the outer membrane or as part of a signal transduction mechanism that activates an organic acid protection system. Recent studies have also suggested some lipoproteins serve as signal transducers (10, 37). It remains to be seen whether Slp may serve a similar role.

It is curious that neither the Slp- nor YhiF-dependent pathway was required for protection against acetate (pKa 4.76). It seems likely, then, that a separate system is used to protect against the toxic effects of this organic acid.

A second significant finding from this study is that E. coli expels glutamic acid during growth and subsequently uses it through the glutamate decarboxylase system to ameliorate proton influx. This means E. coli doesn't necessarily depend on the exogenous addition of glutamate to survive acid stress: it can place it there itself. So, to survive extreme acid stress in its own spent medium, E. coli must seed its medium with glutamate and have YhiF (or Slp) and HdeA, as well as the GadA/BC decarboxylase system, functioning. Loss of any one of these factors means the cell will not survive.

A third finding from this study is that E. coli also possesses an acid resistance mechanism that is activated at high cell density and involves at least two members of the acid fitness island, YhiD and HdeD, both of which are predicted membrane proteins. High cell density-dependent acid resistance cannot be explained as a stochastic event in which a subpopulation of the culture randomly acquires a more acid-resistant physiology than its neighbors. If this were so, there should be no difference in percent survival between high- and low-density cultures. Nor can this acid resistance be due to a mutational event leading to a more resistant phenotype. Survivors from one round of high-density acid stress did not acquire increased acid resistance when retested at low cell density nor, for that matter, at high cell density.

We noticed that low-density cells temporarily survive for about 10 min before rapidly losing viability. The reason for survival at early time points may be due to the intracellular pool of glutamate in low-density cultures. Presumably, this glutamate along with protons would be consumed by glutamate decarboxylase over the first 10 min of a pH 2.1 exposure. However, once the glutamate is consumed, the cells rapidly die.

There are examples of high-cell-density phenomena affecting the acid survival of microbes. An earlier study with Streptococcus mutans demonstrated that cell density influenced the tolerance of log-phase cells to pH 3.5 acid challenge (27). The study found that placing log-phase cells at high cell density during pH 5.5 adaptation increased tolerance to pH 3.5 by 1 to 2 orders of magnitude. The increase was attributed to a secreted protein factor produced by high-density-adapted cells. This factor was able to induce acid tolerance in log-phase cells. This is distinct from the high-density acid resistance of E. coli, which occurs during challenge at pH 2.1, not during an adaptation phase. Also, high-density acid resistance of E. coli does not appear to involve a secreted factor. For similar reasons, the phenomenon we describe is different from that reported earlier for E. coli acid habituation, which also involved an uncharacterized secreted product (41-43).

There is a recent example describing a cell-cell contact phenomenon for E. coli. Certain uropathogenic strains of E. coli inhibit the growth of heterologous strains following cell contact. This process, called contact-dependent inhibition, illustrates that cell contact between different strains of E. coli can have potent biological effects (4). Contact-dependent inhibition requires a large surface protein (CdiA) and a two-partner secretion family member (CdiB). CdiB is an outer membrane protein that transports CdiA to the bacterial cell surface. Cell contact, presumably via these proteins, inhibits growth of the target strain through an unknown mechanism.

It is unclear whether the high cell density-dependent acid resistance described here truly represents a similar cell contact response system. It is possible that an unstable soluble factor passes between cells without a need for stable cell-cell contact, or that incidental cell-cell contact may be sufficient. Importantly, the finding of mutants defective in this process argues against an artifactual explanation for the phenotype and supports the idea that high-cell-density acid resistance represents a previously unrecognized low-pH survival mechanism.

In addition to focused studies on acid resistance mechanisms, as presented here, several genome-based microarray studies have shown that exposing E. coli to moderate levels of acid (e.g., pH 5) has an incredibly broad impact on metabolism beyond just the acid resistance genes unique to E. coli. For example, a recent study by Hayes et al. has shown that exposure to acid pH can potentially shift fermentation away from glucose and toward sugars such as sorbitol, gluconate, and glucuronate, which yield less-acidic products (19). This would minimize acidification of the growth medium and prevent acid damage. Other genes found to be induced by acid in that study encode functions ranging from membrane biogenesis, periplasmic proteins, proton transporters, and multidrug resistance pumps. In sum, the mechanisms used by E. coli to adapt to, and survive, extreme low pH are varied, complex, and integrated. This broad acid response system helps the cell avoid self-imposed acid stresses that occur as a result of fermentation and enables the cell to survive an extreme low pH should that prove inevitable.


arrow
ACKNOWLEDGMENTS
 
We thank Jon Audia, Herbert Winkler, and Hope Richard for helpful discussions of this work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of South Alabama College of Medicine, Mobile, AL 36688. Phone: (251) 460-6323. Fax: (251) 460-7931. E-mail: fosterj{at}sungcg.usouthal.edu. Back

{triangledown} Published ahead of print on 26 January 2007. Back


arrow
REFERENCES
 
    1
  1. Accardi, A., L. Kolmakova-Partensky, C. Williams, and C. Miller. 2004. Ionic currents mediated by a prokaryotic homologue of CLC Cl channels. J. Gen. Physiol. 123:109-119.[Abstract/Free Full Text]
  2. 2
  3. Accardi, A., and C. Miller. 2004. Secondary active transport mediated by a prokaryotic homologue of ClC Cl channels. Nature 427:803-807.[CrossRef][Medline]
  4. 3
  5. Alexander, D. M., and A. C. St. John. 1994. Characterization of the carbon starvation-inducible and stationary phase-inducible gene slp encoding an outer membrane lipoprotein in Escherichia coli. Mol. Microbiol. 11:1059-1071.[CrossRef][Medline]
  6. 4
  7. Aoki, S. K., R. Pamma, A. D. Hernday, J. E. Bickham, B. A. Braaten, and D. A. Low. 2005. Contact-dependent inhibition of growth in Escherichia coli. Science 309:1245-1248.[Abstract/Free Full Text]
  8. 5
  9. Baker, K. E., K. P. Ditullio, J. Neuhard, and R. A. Kelln. 1996. Utilization of orotate as a pyrimidine source by Salmonella typhimurium and Escherichia coli requires the dicarboxylate transport protein encoded by dctA. J. Bacteriol. 178:7099-7105.[Abstract/Free Full Text]
  10. 6
  11. Bock, A., and G. Sawers. 1996. Fermentation, p. 262-282. In F. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
  12. 7
  13. Boogerd, F. C., L. Boe, O. Michelsen, and P. R. Jensen. 1998. atp mutants of Escherichia coli fail to grow on succinate due to a transport deficiency. J. Bacteriol. 180:5855-5859.[Abstract/Free Full Text]
  14. 8
  15. Burkovski, A., and R. Kramer. 2002. Bacterial amino acid transport proteins: occurrence, functions, and significance for biotechnological applications. Appl. Microbiol. Biotechnol. 58:265-274.[CrossRef][Medline]
  16. 9
  17. Burkovski, A., B. Weil, and R. Kramer. 1995. Glutamate excretion in Escherichia coli: dependency on the relA and spoT genotype. Arch. Microbiol. 164:24-28.[CrossRef][Medline]
  18. 10
  19. Castanie-Cornet, M. P., K. Cam, and A. Jacq. 2006. RcsF is an outer membrane lipoprotein involved in the RcsCDB phosphorelay signaling pathway in Escherichia coli. J. Bacteriol. 188:4264-4270.[Abstract/Free Full Text]
  20. 11
  21. Castanie-Cornet, M. P., T. A. Penfound, D. Smith, J. F. Elliott, and J. W. Foster. 1999. Control of acid resistance in Escherichia coli. J. Bacteriol. 181:3525-3535.[Abstract/Free Full Text]
  22. 12
  23. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
  24. 13
  25. Diez-Gonzalez, F., and Y. Karaibrahimoglu. 2004. Comparison of the glutamate-, arginine- and lysine-dependent acid resistance systems in Escherichia coli O157:H7. J Appl. Microbiol. 96:1237-1244.[CrossRef][Medline]
  26. 14
  27. Foster, J. W. 2004. Escherichia coli acid resistance: tales of an amateur acidophile. Nat. Rev. Microbiol. 2:898-907.[CrossRef][Medline]
  28. 15
  29. Gajiwala, K. S., and S. K. Burley. 2000. HDEA, a periplasmic protein that supports acid resistance in pathogenic enteric bacteria. J. Mol. Biol. 295:605-612.[CrossRef][Medline]
  30. 16
  31. Giangrossi, M., S. Zattoni, A. Tramonti, D. De Biase, and M. Falconi. 2005. Antagonistic role of H-NS and GadX in the regulation of the glutamate decarboxylase-dependent acid resistance system in Escherichia coli. J. Biol. Chem. 280:21498-21505.[Abstract/Free Full Text]
  32. 17
  33. Gong, S., H. Richard, and J. W. Foster. 2003. YjdE (AdiC) is the arginine:agmatine antiporter essential for arginine-dependent acid resistance in Escherichia coli. J. Bacteriol. 185:4402-4409.[Abstract/Free Full Text]
  34. 18
  35. Gorden, J., and P. L. C. Small. 1993. Acid resistance in enteric bacteria. Infect. Immun. 61:364-367.[Abstract/Free Full Text]
  36. 19
  37. Hayes, E. T., J. C. Wilks, P. Sanfilippo, E. Yohannes, D. P. Tate, B. D. Jones, M. D. Radmacher, S. S. BonDurant, and J. L. Slonczewski. 2006. Oxygen limitation modulates pH regulation of catabolism and hydrogenases, multidrug transporters, and envelope composition in Escherichia coli K-12. BMC Microbiol. 6:89.[CrossRef][Medline]
  38. 20
  39. Hersh, B. M., F. T. Farooq, D. N. Barstad, D. L. Blankenshorn, and J. L. Slonczewski. 1996. A glutamate-dependent acid resistance gene in Escherichia coli. J. Bacteriol. 178:3978-3981.[Abstract/Free Full Text]
  40. 21
  41. Hirakawa, H., Y. Inazumi, T. Masaki, T. Hirata, and A. Yamaguchi. 2005. Indole induces the expression of multidrug exporter genes in Escherichia coli. Mol. Microbiol. 55:1113-1126.[CrossRef][Medline]
  42. 22
  43. Hommais, F., E. Krin, J. Y. Coppee, C. Lacroix, E. Yeramian, A. Danchin, and P. Bertin. 2004. GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli. Microbiology 150:61-72.[Abstract/Free Full Text]
  44. 23
  45. Hong, W., W. Jiao, J. Hu, J. Zhang, C. Liu, X. Fu, D. Shen, B. Xia, and Z. Chang. 2005. Periplasmic protein HdeA exhibits chaperone-like activity exclusively within stomach pH range by transforming into disordered conformation. J. Biol. Chem. 280:27029-27034.[Abstract/Free Full Text]
  46. 24
  47. Iyer, R., T. M. Iverson, A. Accardi, and C. Miller. 2002. A biological role for prokaryotic ClC chloride channels. Nature 419:715-718.[CrossRef][Medline]
  48. 25
  49. Iyer, R., C. Williams, and C. Miller. 2003. Arginine-agmatine antiporter in extreme acid resistance in Escherichia coli. J. Bacteriol. 185:6556-6561.[Abstract/Free Full Text]
  50. 26
  51. Kern, R., A. Malki, J. Abdallah, J. Tagourti, and G. Richarme. 2006. Escherichia coli HdeB is an acid-stress chaperone. J. Bacteriol. 189:603-610.
  52. 27
  53. Li, Y. H., N. M. Hanna, G. Svensater, R. P. Ellen, and D. G. Cvitkovitch. 2001. Cell density modulates acid adaptation in Streptococcus mutans: implications for survival in biofilms. J. Bacteriol. 183:6875-6884.[Abstract/Free Full Text]
  54. 28
  55. Lin, J., M. P. Smith, K. C. Chapin, H. S. Baik, G. N. Bennett, and J. W. Foster. 1996. Mechanisms of acid resistance in enterohemorrhagic Escherichia coli. Appl. Environ. Microbiol. 62:3094-3100.[Abstract]
  56. 29
  57. Lo, T. C., and M. A. Bewick. 1978. The molecular mechanisms of dicarboxylic acid transport in Escherichia coli K12. The role and orientation of the two membrane-bound dicarboxylate binding proteins. J. Biol. Chem. 253:7826-7831.[Abstract/Free Full Text]
  58. 30
  59. Ma, Z., S. Gong, H. Richard, D. L. Tucker, T. Conway, and J. W. Foster. 2003. GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12. Mol. Microbiol. 49:1309-1320.[CrossRef][Medline]
  60. 31
  61. Ma, Z., N. Masuda, and J. W. Foster. 2004. Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli. J. Bacteriol. 186:7378-7389.[Abstract/Free Full Text]
  62. 32
  63. Ma, Z., H. Richard, and J. W. Foster. 2003. pH-dependent modulation of cyclic AMP levels and GadW-dependent repression of RpoS affect synthesis of the GadX regulator and Escherichia coli acid resistance. J. Bacteriol. 185:6852-6859.[Abstract/Free Full Text]
  64. 33
  65. Ma, Z., H. Richard, D. L. Tucker, T. Conway, and J. W. Foster. 2002. Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW). J. Bacteriol. 184:7001-7012.[Abstract/Free Full Text]
  66. 34
  67. Masuda, N., and G. M. Church. 2002. Escherichia coli gene expression responsive to levels of the response regulator EvgA. J. Bacteriol. 184:6225-6234.[Abstract/Free Full Text]
  68. 35
  69. Masuda, N., and G. M. Church. 2003. Regulatory network of acid resistance genes in Escherichia coli. Mol. Microbiol. 48:699-712.[CrossRef][Medline]
  70. 36
  71. Nishino, K., and A. Yamaguchi. 2001. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183:5803-5812.[Abstract/Free Full Text]
  72. 37
  73. Otto, K., and T. J. Silhavy. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. USA. 99:2287-2292.[Abstract/Free Full Text]
  74. 38
  75. Price, G. P., and A. C. St. John. 2000. Purification and analysis of expression of the stationary phase-inducible Slp lipoprotein in Escherichia coli: role of the Mar system. FEMS Microbiol. Lett. 193:51-56.[CrossRef][Medline]
  76. 39
  77. Richard, H., and J. W. Foster. 2004. Escherichia coli glutamate- and arginine-dependent acid resistance systems increase internal pH and reverse transmembrane potential. J. Bacteriol. 186:6032-6041.[Abstract/Free Full Text]
  78. 40
  79. Richard, H. T., and J. W. Foster. 2003. Acid resistance in Escherichia coli. Adv. Appl. Microbiol. 52:167-186.[CrossRef][Medline]
  80. 41
  81. Rowbury, R. J. 2000. Killed cultures of Escherichia coli can protect living organisms from acid stress. Microbiology 146:1759-1760.[Free Full Text]
  82. 42
  83. Rowbury, R. J., and M. Goodson. 1999. An extracellular acid stress-sensing protein needed for acid tolerance induction in Escherichia coli. FEMS Microbiol. Lett. 174:49-55.[CrossRef][Medline]
  84. 43
  85. Rowbury, R. J., and M. Goodson. 1998. Induction of acid tolerance at neutral pH in log-phase Escherichia coli by medium filtrates from organisms grown at acidic pH. Lett. Appl. Microbiol. 26:447-451.[CrossRef][Medline]
  86. 44
  87. Shin, S., M. P. Castanie-Cornet, J. W. Foster, J. A. Crawford, C. Brinkley, and J. B. Kaper. 2001. An activator of glutamate decarboxylase genes regulates the expression of enteropathogenic Escherichia coli virulence genes through control of the plasmid-encoded regulator, Per. Mol. Microbiol. 41:1133-1150.[CrossRef][Medline]
  88. 45
  89. Shul'ga, A. A., F. T. Kurbanov, R. R. Khristoforov, E. L. Darii, and B. S. Sukhareva. 1999. Glutamate decarboxylase of Escherichia coli: expression of gadA gene, purification and properties of GAD. Mol. Biol. (Moscow) 33:560-566.
  90. 46
  91. Small, P., D. Blankenhorn, D. Welty, E. Zinser, and J. L. Slonczewski. 1994. Acid and base resistance in Escherichia coli and Shigella flexneri: role of rpoS and growth pH. J. Bacteriol. 176:1729-1737.[Abstract/Free Full Text]
  92. 47
  93. Smith, D. K., T. Kassam, B. Singh, and J. F. Elliott. 1992. Escherichia coli has two homologous glutamate decarboxylase genes that map to distinct loci. J. Bacteriol. 174:5820-5826.[Abstract/Free Full Text]
  94. 48
  95. Tramonti, A., M. De Canio, F. Bossa, and D. De Biase. 2003. Stability and oligomerization of recombinant GadX, a transcriptional activator of the Escherichia coli glutamate decarboxylase system. Biochim. Biophys. Acta 1647:376-380.[Medline]
  96. 49
  97. Tramonti, A., M. De Canio, I. Delany, V. Scarlato, and D. De Biase. 2006. Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli. J. Bacteriol. 188:8118-8127.[Abstract/Free Full Text]
  98. 50
  99. Tramonti, A., P. Visca, M. De Canio, M. Falconi, and D. De Biase. 2002. Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system. J. Bacteriol. 184:2603-2613.[Abstract/Free Full Text]
  100. 51
  101. Tucker, D. L., N. Tucker, and T. Conway. 2002. Gene expression profiling of the pH response in Escherichia coli. J. Bacteriol. 184:6551-6558.[Abstract/Free Full Text]
  102. 52
  103. Tucker, D. L., N. Tucker, Z. Ma, J. W. Foster, R. L. Miranda, P. S. Cohen, and T. Conway. 2003. Genes of the GadX-GadW regulon in Escherichia coli. J. Bacteriol. 185:3190-3201.[Abstract/Free Full Text]
  104. 53
  105. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218:97-106.[Free Full Text]
  106. 54
  107. Xu, B., M. Jahic, G. Blomsten, and S. O. Enfors. 1999. Glucose overflow metabolism and mixed-acid fermentation in aerobic large-scale fed-batch processes with Escherichia coli. Appl. Microbiol. Biotechnol. 51:564-571.[CrossRef][Medline]


Journal of Bacteriology, April 2007, p. 2759-2768, Vol. 189, No. 7
0021-9193/07/$08.00+0     doi:10.1128/JB.01490-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Vandal, O. H., Nathan, C. F., Ehrt, S. (2009). Acid Resistance in Mycobacterium tuberculosis. J. Bacteriol. 191: 4714-4721 [Full Text]  
  • Kailasan Vanaja, S., Bergholz, T. M., Whittam, T. S. (2009). Characterization of the Escherichia coli O157:H7 Sakai GadE Regulon. J. Bacteriol. 191: 1868-1877 [Abstract] [Full Text]  
  • Tiaden, A., Spirig, T., Carranza, P., Bruggemann, H., Riedel, K., Eberl, L., Buchrieser, C., Hilbi, H. (2008). Synergistic Contribution of the Legionella pneumophila lqs Genes to Pathogen-Host Interactions. J. Bacteriol. 190: 7532-7547 [Abstract] [Full Text]  
  • Ruiz, C., McMurry, L. M., Levy, S. B. (2008). Role of the Multidrug Resistance Regulator MarA in Global Regulation of the hdeAB Acid Resistance Operon in Escherichia coli. J. Bacteriol. 190: 1290-1297 [Abstract] [Full Text]  
  • Inoue, K., Basu, S., Inouye, M. (2007). Dissection of 16S rRNA Methyltransferase (KsgA) Function in Escherichia coli. J. Bacteriol. 189: 8510-8518 [Abstract] [Full Text]  
  • Eguchi, Y., Itou, J., Yamane, M., Demizu, R., Yamato, F., Okada, A., Mori, H., Kato, A., Utsumi, R. (2007). B1500, a small membrane protein, connects the two-component systems EvgS/EvgA and PhoQ/PhoP in Escherichia coli. Proc. Natl. Acad. Sci. USA 104: 18712-18717 [Abstract] [Full Text]  
  • Bergholz, T. M., Tarr, C. L., Christensen, L. M., Betting, D. J., Whittam, T. S. (2007). Recent Gene Conversions between Duplicated Glutamate Decarboxylase Genes (gadA and gadB) in Pathogenic Escherichia coli. Mol Biol Evol 24: 2323-2333 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mates, A. K.
Right arrow Articles by Foster, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mates, A. K.
Right arrow Articles by Foster, J. W.
Right arrowPubmed/NCBI databases
*Domain*Gene
*GEO Profiles