This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dos Santos, P. C.
Right arrow Articles by Dean, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dos Santos, P. C.
Right arrow Articles by Dean, D. R.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2007, p. 2854-2862, Vol. 189, No. 7
0021-9193/07/$08.00+0     doi:10.1128/JB.01734-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Controlled Expression of nif and isc Iron-Sulfur Protein Maturation Components Reveals Target Specificity and Limited Functional Replacement between the Two Systems{triangledown} ,{dagger}

Patricia C. Dos Santos, Deborah C. Johnson, Brook E. Ragle, Mihaela-Carmen Unciuleac, and Dennis R. Dean*

Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061

Received 10 November 2006/ Accepted 16 January 2007


arrow
ABSTRACT
 
The nitrogen-fixing organism Azotobacter vinelandii contains at least two systems that catalyze formation of [Fe-S] clusters. One of these systems is encoded by nif genes, whose products supply [Fe-S] clusters required for maturation of nitrogenase. The other system is encoded by isc genes, whose products are required for maturation of [Fe-S] proteins that participate in general metabolic processes. The two systems are similar in that they include an enzyme for the mobilization of sulfur (NifS or IscS) and an assembly scaffold (NifU or IscU) upon which [Fe-S] clusters are formed. Normal cellular levels of the Nif system, which supplies [Fe-S] clusters for the maturation of nitrogenase, cannot also supply [Fe-S] clusters for the maturation of other cellular [Fe-S] proteins. Conversely, when produced at the normal physiological levels, the Isc system cannot supply [Fe-S] clusters for the maturation of nitrogenase. In the present work we found that such target specificity for IscU can be overcome by elevated production of NifU. We also found that NifU, when expressed at normal levels, is able to partially replace the function of IscU if cells are cultured under low-oxygen-availability conditions. In contrast to the situation with IscU, we could not establish conditions in which the function of IscS could be replaced by NifS. We also found that elevated expression of the Isc components, as a result of deletion of the regulatory iscR gene, improved the capacity for nitrogen-fixing growth of strains deficient in either NifU or NifS.


arrow
INTRODUCTION
 
Iron-sulfur clusters ([Fe-S] clusters) are inorganic prosthetic groups that are required for the activities of a wide class of proteins, often referred to as [Fe-S] proteins. Such [Fe-S] proteins and their cognate [Fe-S] clusters are involved in many different metabolic functions, including electron transfer, substrate activation, gene regulation, and environmental sensing. Although there are many different types of [Fe-S] clusters, including some that contain other metal atoms or organic constituents, the simplest types are [2Fe-2S] and [4Fe-4S] clusters, and these are usually attached to their protein partners through cysteine thiolate ligands. In spite of their simple composition and architecture, the biological formation of [Fe-S] clusters is surprisingly complex (3, 15).

The first clues that specific gene products are involved in the biological formation of [Fe-S] clusters emerged from studies of gene products required for the maturation of nitrogenase in the nitrogen-fixing organism Azotobacter vinelandii. Nitrogenase catalyzes nitrogen fixation and is composed of two components, called the Fe protein and the MoFe protein, both of which require [Fe-S] clusters for their functions (8). The as-translated products of the genes that encode the Fe protein and the MoFe protein are not active. Instead, a variety of accessory proteins are involved in the assembly and insertion of the [Fe-S] clusters necessary for their activities. Deletion of either of two such genes, nifU and nifS, substantially lowers the activity of both the Fe protein and the MoFe protein (14). Other nitrogenase maturation proteins are required for activation of only the Fe protein or only the MoFe protein (7, 23). These observations indicate that NifU and NifS could have specialized functions in the specific acquisition of iron or sulfur necessary for formation of the [Fe-S] clusters required to activate both of the nitrogenase catalytic components. Support for this hypothesis was obtained when it was shown that NifS is a pyridoxal phosphate-dependent cysteine desulfurase (33) and that [Fe-S] clusters can be assembled on NifU in vitro when it is incubated with NifS, L-cysteine, and Fe (31). Clusters assembled on the NifU scaffold in this way were subsequently used for the in vitro activation of an apo form of the Fe protein (9, 26). Loss of either the NifU function or the NifS function drastically lowers, but does not eliminate, the capacity for diazotrophic growth. This feature suggested that another cellular function, probably a function involved in the maturation of [Fe-S] proteins unrelated to nitrogenase, might supplant the functions of NifS and NifU, but only at a very low level. This hypothesis led to identification of the "Isc" gene cluster, whose gene products have now been shown to be required for activation of a variety of "housekeeping" [Fe-S] proteins, such as aconitase (32). The Isc system is more complicated than the Nif system and includes eight contiguous genes (iscR, iscS, iscU, iscA, hscB, hscA, fdx, and iscX). The products of iscS, iscU, hscB, hscA, and fdx have been shown to be essential in A. vinelandii under standard culture conditions, and the product of iscA is essential under elevated-oxygen conditions (17). The product of iscS has a primary sequence similar to that of NifS and exhibits cysteine desulfurase activity. The iscU gene product exhibits primary sequence similarity to the N-terminal domain of NifU, and [Fe-S] clusters can be assembled in vitro on IscU when they are incubated with IscS, Fe, and L-cysteine (1). Figure 1A shows a comparison of the genetic organization of the isc gene cluster and the genetic organization of the relevant nif gene cluster. In previous work it was shown that both IscS and IscU are essential in A. vinelandii and that the null growth phenotypes associated with loss of the IscS or IscU function cannot be rescued by growing the mutants under diazotrophic conditions in which NifS and NifU are expressed (16, 17).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 1. (A) A. vinelandii [Fe-S] cluster biosynthetic gene regions. Genes whose products are thought to have similar functions are indicated by the same color. (B) Schematic diagram of the incorporation of a gene into the A. vinelandii genome through homologous recombination. The red lines indicate locations of reciprocal recombination events. The approximate position of the araBAD promoter is indicated by bent arrows.

The apparent lack of functional cross talk between the Nif and Isc systems in A. vinelandii led us to propose that there is target specificity with the two [Fe-S] cluster biosynthetic systems. In contrast to our work, Tokumoto and colleagues heterologously expressed NifU- and NifS-like proteins from certain other organisms, including Helicobacter pylori, in Escherichia coli strains deficient in Isc functions, and they concluded that there is a capacity for functional cross talk (28). However, it should be noted that H. pylori does not fix nitrogen, and NifU- and NifS-like proteins from this organism have been shown to have generalized functions in [Fe-S] protein maturation (22). Nevertheless, the results of Tokumoto and coworkers led us to reexamine the capacity for functional cross talk between the Nif and Isc systems in A. vinelandii. In previous work the experimental strategy involved asking whether expression of either the Nif or Isc [Fe-S] cluster biosynthetic system at levels sufficient to perform the normal functions could also provide [Fe-S] clusters normally supplied by the other system. In the present work complementary experiments were performed to determine whether a component of one [Fe-S] cluster biosynthetic system can replace a component of the other system when it is expressed at elevated levels or when cells are cultured under different conditions.


arrow
MATERIALS AND METHODS
 
Growth and genomic analysis of A. vinelandii strains. All chemicals were obtained from Sigma unless indicated otherwise. A. vinelandii strains were grown at 30°C on modified Burks minimal medium containing 2% sucrose (B medium) or 2% glucose (BG medium) as the sole carbon source (27). Ammonium acetate was used as the fixed nitrogen source and, when it was used, was added to a final concentration of 13 mM. Gene deletions and amino acid substitutions were confirmed by amplification using the PCR method and DNA sequence analysis. Genomic DNA was prepared using a commercial DNA extraction kit (QuickExtract), PCR amplification was performed using a kit purchased from Epicentre, and DNA sequence analysis was performed by a service provided by the Virginia Bioinformatics Institute.

Strain and plasmid construction. The procedures used for strain construction were the procedures described previously in detail (13, 14). The general principle used for strain construction involved DNA transformation experiments in which homologous reciprocal recombination occurred between cloned, isolated A. vinelandii DNA in a recombinant plasmid and a corresponding region of the genome. Correct insertion or deletion of selected DNA segments in targeted genomic regions was confirmed by PCR analysis of genomic DNA by using an appropriate set of amplification primers. None of the plasmids used for strain construction in this work is capable of autonomous replication in A. vinelandii. The regions used for homologous recombination included the A. vinelandii isc gene region, the sucrose catabolic gene region (scr), and the acetone carboxylase gene region (acx). Detailed descriptions of the A. vinelandii isc and scr regions have been published previously (17, 32). The acx gene region was identified in the present work by examination of the draft A. vinelandii genome sequence. Our preliminary genetic analysis of the A. vinelandii acx region revealed that it is not essential for growth under standard laboratory growth conditions. For this reason the acx region could be used as a carrier for incorporation of other DNA segments into the A. vinelandii genome. A typical genetic construction is described below and is also shown schematically in Fig. 1B. This genetic construction involved reciprocal recombination between A. vinelandii genomic regions on plasmid pDB1637 and the A. vinelandii chromosome, which resulted in placement of a duplicate copy of the nifS gene in the A. vinelandii acx gene region. In this case, expression of the duplicated nifS gene was controlled by the E. coli araBAD promoter and the araC gene, both of which were also in pDB1637 and were incorporated into the A. vinelandii chromosome as a result of recombination. Construction of pDB1637 required multiple steps. In the first step a 1.3-kb genomic segment of A. vinelandii that spanned the putative acx promoter through part of acxA gene, which encodes the acetone carboxylase {alpha}-subunit, was amplified by PCR (see the physical map in the supplemental material). The PCR product was then digested with restriction enzymes SphI and SacI and ligated into the SphI-SacI sites of pUC119 to obtain pDB1304. The cloned acx region in pDB1304 contained a SmaI site located immediately upstream from the acxA coding region. An XmnI-SmaI fragment from pDB1568, which was derived from pARA13, which contained the entire araC gene and the araBAD promoter, was ligated into the SmaI site of pDB1304 to obtain pDB1631. Plasmid pDB1631 also contained a polylinker sequence (TCCATGGCCCATATGGATATCATGCATCTCGAGGGATCCT) that was inserted into the NcoI site originally present in pARA13 (4), which overlapped the araB initiation codon. The polylinker fragment retained the original NcoI site and also included an NdeI site (both underlined in the polylinker sequence). Plasmid pDB1631 was digested with NdeI and BglII and ligated with an NdeI-BamHI DNA fragment that contained the nifS coding sequence (33) to obtain pDB1637. This construction placed expression of nifS under control of the ara regulatory elements, as shown in Fig. 1B. The same type of experimental strategy was used for all plasmid and strain construction. A comprehensive list and descriptions of plasmids used in this work, as well as a physical map of the gene regions manipulated, are shown in Table S1 and Fig. S1 in the supplemental material. The relevant genotypes of strains used in this work are shown in Table 1, and schematic diagrams of the organizations of relevant gene constructs are shown in Fig. 2 to 7.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Relevant genotypes of strains used in this studya


Figure 2
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 2. Analysis of nif-, scr- and ara-regulated expression of NifUS. (A) Schematic diagrams of the genetic organizations of strains DJ, DJ1475, and DJ1626. The complete genotypes of these strains are shown in Table 1. The cross-hatched regions indicate deletions. Expression of genes regulated by the nif control elements is induced in the absence of a fixed nitrogen source and is repressed in the presence of a fixed nitrogen source. Expression of genes regulated by the scr control elements and expression of genes regulated by the ara control elements are induced by inclusion of sucrose and arabinose, respectively, in the growth medium. (B) Coomassie brilliant blue-stained 15% SDS-PAGE gel containing crude extracts of strains DJ, DJ1475, and DJ1626 grown under different culture conditions. Lane 1, crude extract of DJ grown in the absence of a fixed nitrogen source with sucrose as the carbon source; lane 2, crude extract of DJ1475 grown in the absence of a fixed nitrogen source with sucrose as the carbon source; lane 3, crude extract of DJ1626 grown in the absence of a fixed nitrogen source with sucrose as the carbon source and arabinose added to the growth medium; lane 4, crude extract of DJ1626 grown in the presence of a fixed nitrogen source with sucrose as the carbon source and arabinose added to the growth medium; lane 5, crude extract of DJ1626 grown in the presence of a fixed nitrogen source with sucrose as the carbon source and no arabinose added to the growth medium. Unlabeled lanes contained Mr standards (phosphorylase b, bovine serum albumin, ovalbuminn, carbonic anhydrase, and soybean trypsin inhibitor). The positions of nitrogenase catalytic components are indicated as follows: D, nitrogenase MoFe protein {alpha}-subunit; K, nitrogenase MoFe protein ß-subunit; and H, nitrogenase Fe protein. Bands corresponding to these components are apparent in lanes 1, 2 and 3 but not in lane 4 or 5. The positions of NifU and NifS are indicated by U and S, respectively. The accumulation of NifS could not be evaluated on stained SDS-PAGE gels because of the presence of another band at the same location. (C) Western blot analysis of NifS accumulation. A duplicate of the SDS-PAGE gel shown in panel B was used for blotting and analysis of NifS accumulation using anti-NifS antibodies. High levels of NifS in lanes 3 and 4 relative to the levels in lanes 1, 2, and 5 are apparent.


Figure 7
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 7. Elevated expression of Isc components improves the diazotrophic growth capacity of strains with nifU deleted. (A) Schematic diagrams of the genetic organizations of DJ1421, DJ1616, DJ1646, and DJ1734. (B) Diazotrophic growth of DJ1421 (•), DJ1616 ({blacksquare}), and DJ1646 ({blacklozenge}). Strain DJ1734 exhibited the same very slow diazotrophic growth exhibited by DJ1616 (data not shown). OD (600 nm), optical density at 600 nm.

Growth of A. vinelandii with 40% or 5% oxygen. For growth of cells in the presence of 40% oxygen at 1 atm, petri plates were placed in vented BBL GasPak jars (Becton, Dickinson and Company). The ambient air was evacuated using a Schlenk line apparatus, and the jar was regassed by flushing it with 40% O2 balanced with 60% N2 using a regulated gas tank (Airgas Inc.). No more than four petri plates (100 by 15 mm) at a time were placed in each jar, which could hold up to 12 plates. Sealed jars were incubated at 30°C and were evacuated and reflushed with a 40% O2-60% N2 gas mixture every 2 days. Cells were grown under low-oxygen conditions using a Coy chamber containing 5% oxygen balanced with N2 gas from a regulated gas tank (Airgas Inc.).

Western immunoblotting. Strains DJ, DJ1475, and DJ1626 were grown in liquid cultures using Burk's medium without a fixed nitrogen source and with sucrose as the sole carbon source. When arabinose was used for induction, it was added to the culture medium at a concentration of 3 g/liter. Cell extracts were prepared by French press disruption (12,000 lb/in2) in degassed, argon-sparged 25 mM Tris-HCl (pH 8.0) and were clarified by centrifugation at 100,000 x g for 30 min. Each lane of a 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel was loaded with 30 µg of protein in crude extract. Gels were either stained with Coomassie blue dye or transferred to nitrocellulose. After blotting with a 4% dried milk solution, a 1:15,000 dilution of rabbit serum containing anti-A. vinelandii NifS was used as the primary antibody. Alkaline phosphate-conjugated anti-rabbit goat immunoglobulin G was used as the secondary antiserum (1:30,000 dilution; Sigma-Aldrich Inc.). A chemiluminescent method was used for detection (LumiPhos WB; Pierce).

Aconitase and isocitrate dehydrogenase assays for IscS-depleted cells. For depletion of IscS from strains DJ1454, DJ1450, and DJ1726, cells were initially cultured in liquid media with sucrose as the carbon source. When the optical density at 600 nm reached 1, the cells were harvested by centrifugation and washed twice with Burks medium containing glucose in place of sucrose. Resuspended cells were diluted into fresh glucose medium to obtain an optical density at 600 nm of 0.07. IscS depletion was achieved after 17 to 20 h of growth, cells were harvested by centrifugation at 5,000 rpm for 5 min, and cell pellets were frozen until they were used. Crude extracts were prepared as described above and immediately placed in sealed, air-tight vials under anoxic conditions maintained using either Schlenk lines or a Coy anaerobic chamber containing 5% hydrogen gas balanced with nitrogen gas. Protein concentrations were estimated using the biuret method (5). Aconitase activity was measured spectrophotometrically at 240 nm at room temperature by monitoring the production of cis-aconitate (3.4 mM–1 cm–1 at 240 nm) (24). Assays (1 ml) were performed using sealed, anoxic cuvettes containing 10 to 50 µl of supernatant and 900 µl of 100 mM Tris-HCl (pH 8.0), and reactions were initiated with 100 µl of 200 mM citrate. Isocitrate dehydrogenase was used as an internal control, and the activity of this enzyme was assayed by determining the production of NADPH (6).


arrow
RESULTS
 
Elevated expression of NifU and NifS. We previously used the natural transformation system of A. vinelandii and the sucrose catabolic regulon to develop a method for controlled gene expression in this organism. Such controlled expression can be accomplished by replacing the genomic scrX gene, whose expression is negatively controlled by the scrR gene product, with any gene or cluster of genes. The expression of genes placed under control of the scr regulatory elements is induced when cells are cultured using sucrose as the carbon source and is severely repressed when cells are cultured using glucose as the carbon source (17). This method was used to prepare a strain of A. vinelandii that contains two separate copies of the contiguous and cotranscribed nifUS genes. In one of these copies the nifUS genes are in their normal genomic context and the expression is controlled by the nif regulatory elements, whereas in the other expression of a duplicated genomic copy of nifUS is under control of the scr regulatory elements. Subsequent deletion of the nif-regulated copy of nifUS (strain DJ1475) (16) resulted in a strain that could grow only under nitrogen-fixing conditions when sucrose was added to the growth medium, so that expression of the scrR-regulated copy of nifUS was activated (Fig. 2A shows a schematic diagram of the DJ1475 genes). Attempts to isolate a strain with iscU or iscS deleted in this genetic background were not successful. These results indicate that levels of NifU and NifS that are sufficient to supply the [Fe-S] clusters necessary for nitrogenase maturation cannot also satisfy the demand for [Fe-S] clusters for maturation of housekeeping [Fe-S] proteins normally provided by the Isc system.

In the present work we examined whether elevated levels of NifU and NifS could be used to replace the corresponding functions of IscU and IscS. In order to obtain a high level of expression of NifU and NifS, a duplicate copy of the nifUS genes was placed under control of the ara regulatory elements from E. coli, including the araBAD promoter and the araC regulatory gene, and incorporated into the A. vinelandii genome through homologous recombination (Fig. 2A). A. vinelandii has no endogenous capacity to catabolize arabinose. Figure 2B and C show the relative levels of NifU and NifS produced by cells when nifUS expression was controlled by the nif regulatory elements, controlled by the scr regulatory elements, or controlled by the E. coli ara regulatory elements. The results show that placing nifUS under control of the E. coli ara regulatory elements resulted in accumulation of high levels of NifU and NifS compared to the levels obtained under other conditions. In separate experiments (Fig. 2B and C, lanes 3 and 4) it was found that elevated expression of nifUS, when it was placed under control of the ara regulatory elements, occurred only when arabinose was added to the growth medium.

Elevated levels of NifUS can replace the IscU function but not the IscS function. To determine whether elevated levels of the combined NifU and NifS proteins can replace the function of IscU or IscS, we attempted to construct strains with either iscU or iscS deleted in a genetic background in which expression of nifUS was up-regulated by the ara regulatory elements (Fig. 3A). It was not possible to recover a strain with iscS deleted in this genetic background, indicating that combined elevated expression of NifU and elevated expression of NifS cannot replace the function of IscS. This result was directly confirmed in other experiments described below. In contrast, it was possible to construct a strain with iscU deleted in a genetic background in which expression of NifU and expression of NifS were elevated, and this strain was able to grow only when arabinose was added to the culture medium (Fig. 3B). Thus, the combined elevated expression of NifU and elevated expression of NifS could replace the function of IscU.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 3. Rescue of the null growth phenotype associated with the functional loss of IscU by elevated ara-directed expression of NifUS. (A) Schematic diagrams of the genetic organizations of DJ1626, DJ1639, and DJ1640. See Table 1 for complete genotypes of these strains. (B) Growth of strains DJ1626, DJ1639, and DJ1640 when they were cultured in the absence ({blacktriangleup}) or in the presence ({blacksquare}) of arabinose. Cells were precultured in media containing arabinose and were switched to the growth conditions indicated above at zero time. OD (600 nm), optical density at 600 nm.

HscA and Fdx are not required for elevated levels of NifU to replace the IscU function. HscB, HscA, and Fdx (Fig. 1) are essential for growth of A. vinelandii under standard conditions. Functional depletion of HscB, HscA, or Fdx in A. vinelandii also results in a severe defect in the maturation of aconitase, an enzyme that requires a [4Fe-4S] cluster for catalytic activity (17). Although the specific functions of these proteins are not known yet, HscB and HscA exhibit sequence identity to the molecular chaperones DnaJ and DnaK, respectively (29, 30, 32). Furthermore, an HscBA complex has been shown to have an intrinsic in vitro ATPase activity that is greatly stimulated by interaction with IscU (11). This stimulation requires a Leu-Pro-Pro-Val-Lys motif located in IscU (12), and replacement of the Lys residue in this motif by Ala results in a null growth phenotype for A. vinelandii when intact IscU is depleted (17). The Leu-Pro-Pro-Val-Lys motif is not conserved in NifU. In the case of Fdx, the nif operon does not encode a strict homolog of Fdx, but the central domain of NifU does contain a [2Fe-2S] cluster that has redox properties similar to those of Fdx (Fig. 1) (10, 18). For these reasons it was of interest to determine if HscB, HscA, and Fdx are required to sustain growth when elevated levels of NifU and NifS are produced in an iscU-deficient background. In the first experiment, a polar Kmr insertion mutation was placed in the iscU gene in a strain in which expression of nifU and nifS was placed under control of the ara regulatory elements (DJ1640) (Fig. 3A). In this case cells were able to grow if arabinose was added to the growth medium. This result is consistent with the possibility that HscB, HscA, and Fdx, whose corresponding genes are cotranscribed and located downstream from iscU, are not required for general maturation of [Fe-S] proteins when elevated levels of NifU and NifS are available (Fig. 3B). However, this result is not necessarily conclusive because there is evidence that a weak internal promoter, located downstream from iscU, is able to drive a low level of hscBA fdx expression (17). Therefore, two other strains were also constructed. One of these strains had a Kmr insertion in hscA (DJ1743), and the other had a Kmr insertion in fdx (DJ1744). In both strains the expression of nifU and nifS was under control of the ara regulatory elements. These strains were also able to grow, but only when arabinose was added to the growth medium, indicating that functional copies of neither HscA nor Fdx are required for [Fe-S] protein maturation when NifU and NifS are expressed at high levels (data not shown).

Elevated levels of NifU are necessary and sufficient to replace the function of IscU. In separate experiments we asked if elevated levels of both NifU and NifS are required to replace the function of IscU or if elevated expression of NifU alone is sufficient. In these experiments we addressed the question of whether assembly of [Fe-S] clusters on the proposed NifU scaffold specifically requires S2– delivery from NifS. For these experiments we constructed strain DJ1680 (Fig. 4), which contained (i) the endogenous isc gene cluster with the iscU gene deleted; (ii) a duplicated intact copy of the isc gene cluster, whose expression was placed under control of the scr regulatory elements; (iii) the endogenous nifUS genes under control of the normal nif regulatory elements but with a deletion in nifU; and (iv) a duplicated intact copy of nifU whose expression was placed under control of the ara regulatory elements. This genetic construct permitted assessment of the ability of elevated NifU levels to rescue the loss of IscU function in the absence of NifS by growing cells under conditions in which expression of the scr-regulated copy of the isc components was repressed, expression of the nif-regulated copy of nifS was repressed, and the ara-regulated copy of nifU was induced. As shown in Fig. 4, plate D, elevated expression of NifU rescued the null growth phenotype associated with IscU depletion. Control experiments showed that IscU is otherwise essential in A. vinelandii and that IscU can be effectively depleted from DJ1680 when the strain is cultured using glucose as the carbon source. For example, DJ1680 exhibited normal growth when it was cultured using sucrose as the carbon source, when the scr-regulated copy of iscU was induced (Fig. 4, plate B). However, DJ1680 could not grow when it was cultured using glucose as the carbon source, when expression of the scr-regulated copy of iscU was repressed and expression of the ara-regulated copy of nifU was also repressed (Fig. 4, plate C). A final control experiment (Fig. 4, plate A) demonstrated that the ara-regulated copy of nifU was functional because strain DJ1680, in which the nif-regulated copy of nifU was deleted, was capable of normal diazotrophic growth only when it was cultured under conditions in which expression of the ara-regulated copy of nifU was activated. Together, these results show that an elevated level of NifU is necessary and sufficient to rescue the null phenotype associated with IscU depletion.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 4. Effect of ara-dependent NifU or NifS expression on growth of cells with IscU or IscS depleted. (Top) Schematic diagrams of the genetic organizations of DJ1421, DJ1680, and DJ1713. See Table 1 for complete genotypes of these strains. (Bottom) Growth phenotypes of DJ1421, DJ1680, and DJ1713 when they were cultured under the conditions indicated. Genes whose expression was under control of the nif regulatory elements were induced when N2 was used as the nitrogen source and were repressed when NH3 was used as the nitrogen source. Genes whose expression was under control of the scr regulatory elements were induced when sucrose was used as the carbon source and were repressed when glucose was used as the carbon source. Genes whose expression was under control of the ara regulatory elements were induced when arabinose was added to the growth medium.

In contrast to the situation with NifU, the same experimental approach was used to show that an elevated level of NifS was unable to rescue the null growth phenotype in cells with IscS depleted (strain DJ1713) (Fig. 4, plate D) under any of the experimental conditions examined. The controls that were used for DJ1680 also demonstrated that IscS can be functionally depleted by this experimental method and that the ara-regulated copy of nifS is functional with respect to nitrogenase maturation (Fig. 4, plates A, B and C).

Elevated levels of NifS cannot satisfy the [Fe-S] cluster biosynthetic function of IscS. Previous analyses of E. coli strains defective in IscS function have shown that IscS is involved in general sulfur trafficking and that IscS supplies sulfur for thiolation of tRNA and a variety of organic cofactors, in addition to supplying S2– for [Fe-S] protein maturation (19). A recent study showed that certain amino acid substitutions in IscS can differentially affect the specificity of IscS for sulfur delivery to different types of targets (20, 21). Thus, it seemed reasonable to expect that in A. vinelandii the inability of NifS to rescue the null phenotype associated with IscS depletion might be specifically related to an inability of NifS to replace an IscS function involving thiolation of tRNA or organic cofactor biosynthesis rather than an inability to replace the role of IscS in supplying S2– for [Fe-S] protein maturation. Data shown in Fig. 5A and B confirmed that depletion of IscS resulted in a severe loss of the activity of aconitase, a citric acid cycle enzyme that requires a [4Fe-4S] cluster for activity, compared to the activity of isocitrate dehydrogenase, a citric acid cycle enzyme that does not contain a [Fe-S] cluster. This loss of activity could not be substantially rescued by elevated levels of NifS, indicating that NifS cannot effectively replace the function of IscS with respect to mobilization of S2– for the general maturation of [Fe-S] proteins. Whether NifS can replace other sulfur-trafficking functions of IscS was not investigated in this work.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 5. Effect of IscS depletion on aconitase activity in the presence or absence of arabinose-induced NifS expression. (A) Schematic diagrams of the genetic organizations of strains DJ1454, DJ1450, and DJ1726. (B) Ratio of aconitase activity to isocitrate dehydrogenase activity for cells with IscS depleted (DJ1450 and DJ1726) normalized to the ratio for control cells (DJ1454) (WT) in which IscS was not depleted. IscS was depleted from DJ1450 and DJ1726 by a carbon source shift (sucrose to glucose) as described in Materials and Methods. Arabinose was also added at the time of the carbon source shift for DJ1726 in order to induce a high level of NifS expression. The values are the averages of at least two independent experiments.

N-terminal domain of NifU is required for functional replacement of IscU. Primary sequence comparisons and biochemical studies have shown that NifU is a modular protein (Fig. 1). The N-terminal module exhibits sequence identity with IscU, the central module contains a [2Fe-2S] cluster whose function is unknown, and the C-terminal module exhibits sequence identity with another proposed class of [Fe-S] assembly scaffold proteins designated Nfu. Previous in vitro experiments established that [Fe-S] clusters can be assembled on both the N-terminal and C-terminal modules of NifU. Also, [Fe-S] clusters assembled on either module can be used for in vitro activation of an apo form of the nitrogenase Fe protein (9, 26). It was therefore of interest to determine if it is the N-terminal or C-terminal module in NifU that is responsible for replacing the function of IscU when NifU is expressed at high levels. This question was addressed by constructing a strain (DJ1691) having the same genotype as DJ1680 (Fig. 4) except that in NifU, whose expression was under control of the ara regulatory elements in DJ1691, the Cys35 residue was replaced by Ala35. Previous biochemical and genetic studies have shown that all three cysteine residues conserved in the N-terminal module of NifU and IscU, including Cys35, are essential for in vitro assembly of [Fe-S] clusters on the N-terminal domain, as well as for full physiological activity of NifU (2, 9). High levels of the NifU with the Ala35 substitution could not rescue the null phenotype associated with depletion of IscU (data not shown), demonstrating that an intact N-terminal domain in NifU is required to supplant the function of IscU. In contrast, previous work demonstrated that replacement of the NifU Cys35 residue by alanine resulted in only a lower capacity for diazotrophic growth (2), whereas combinations of substitutions in which alanine replaced cysteine in both the N-terminal and C-terminal domains nearly eliminated the capacity for diazotrophic growth (9). These results indicated that [Fe-S] clusters assembled on either the N-terminal or C-terminal domain of NifU could be used for nitrogenase maturation, and this possibility was confirmed by biochemical experiments. For this reason, it was also of interest to determine whether the capacity for assembly of [Fe-S] clusters on the C-terminal domain of NifU is also required for replacement of the IscU function under conditions in which there is elevated NifU expression. To address this question, strain DJ1760 was constructed, which is isogenic with strain DJ1680 (Fig. 4) except that in the ara-regulated copy of NifU the Cys275 residue is replaced by alanine. Strain DJ1760 exhibited the phenotype shown for DJ1680 in Fig. 4. Therefore, a form of NifU that cannot assemble [Fe-S] clusters in the C-terminal domain, whose expression is elevated, is still able to replace the function of IscU. Thus, the N-terminal domain of NifU, which exhibits primary sequence similarity to IscU, is necessary and sufficient to replace IscU when it is expressed at elevated levels.

Functional replacement of IscU by NifU under conditions in which the availability of oxygen is low. After it was established that NifU is able to replace the function of IscU when NifU is expressed at high levels, we examined whether normal levels of NifU or NifS could functionally replace IscU or IscS under physiological conditions that might be expected to decrease the demand for [Fe-S] cluster synthesis. For this analysis the abilities to rescue the null phenotype associated with depletion of IscU or IscS under nitrogen-fixing conditions and under either an ambient atmosphere (~20% oxygen) or an atmosphere containing 5% oxygen were examined. Previous work showed that depletion of IscU or IscS resulted in a null growth phenotype when cells were cultured using an atmosphere containing 20 or 5% oxygen under conditions in which nif gene expression was repressed (17). In contrast, Fig. 6 shows that NifU could replace IscU under conditions in which the availability of oxygen was low when cells were cultured under nitrogen-fixing conditions. In contrast, NifS could not replace the function of IscS under the same conditions. In related experiments, it was found that the ability of elevated levels of NifU to replace IscU under an atmosphere containing 20% oxygen was eliminated when cells were grown under an atmosphere containing 40% oxygen. It did not appear that the latter results reflected oxygen sensitivity of the NifUS [Fe-S] cluster biosynthetic machinery under the conditions used because wild-type A. vinelandii cells, as well as DJ1626 (Fig. 2A), were capable of normal diazotrophic growth when they were cultured under an atmosphere containing 40% oxygen (data not shown).


Figure 6
View larger version (34K):
[in this window]
[in a new window]

  		FIG. 6. IscU is not essential under nitrogen-fixing conditions when cells are cultured under an atmosphere containing 5% oxygen. (A) Schematic diagrams of the genetic organizations of DJ1454, DJ1450, and DJ1445. (B) Growth of strains under nitrogen-fixing conditions with an atmosphere containing either 20 or 5% oxygen using glucose as the carbon source, when either IscU (DJ1445) or IscS (DJ1450) was depleted. Growth of DJ1454 was eliminated when this strain was cultured under an atmosphere containing 5% oxygen if a fixed source of nitrogen was added to the growth medium (data not shown).

Elevated levels of IscU or IscS can partially replace the function of NifU or NifS. The hypothesis that the Isc machinery can partially replace the function of NifU and NifS cannot be directly tested by deletion of genes encoding the Isc machinery because these genes are essential. Therefore, a different approach was necessary to test this possibility. In the case of E. coli it has been shown that IscR is a negative repressor of expression of the isc transcriptional unit and that deletion of iscR results in elevated expression of the other Isc components (25). IscR has the same function in A. vinelandii because deletion of iscR resulted in an approximately fivefold increase in the expression of Isc components (data not shown). In the present work we found that the very low levels of diazotrophic growth exhibited by strains with nifU or nifS deleted were greatly enhanced in a strain in which iscR was also deleted (data are shown for nifU and nifU iscR deletion mutants in Fig. 7A and B). In order to determine if the partial rescue of the nifU or nifS deletion phenotypes was specifically related to elevated levels of IscU or IscS or was related to the loss of IscR function in some other indirect way, two other experiments were performed.

In the first experiment, a strain derived from DJ1616 (DJ1734) (Fig. 7A and B), in which iscR, iscU, and nifU were deleted, did not exhibit diazotrophic growth. In this case a low level of IscU that was sufficient to sustain growth under non-nitrogen-fixing conditions was provided by the duplicated copy of the isc gene cluster, whose expression was under control of the scr regulatory elements (Fig. 7A). In the second experiment, the expression of iscS-iscU-iscA-hscB-hscA-fdx-iscX was placed under control of the strong ara regulatory elements in genetic backgrounds in which nifU or nifS was also deleted (DJ1683 and DJ1698) (Table 1). For both of these strains, diazotrophic growth was also greatly stimulated by addition of arabinose to the growth medium (data not shown).


arrow
DISCUSSION
 
In this study we found that the E. coli arabinose catabolic regulatory elements can be transferred to the A. vinelandii genome and can be used for controlled high-level expression of target proteins. These abilities have two potential applications. First, because the ara regulatory elements are placed in the genome, gene dosage effects and stability issues commonly associated with expression vectors are eliminated. Second, although A. vinelandii is an obligate aerobe, this organism is able to produce active forms of oxygen-sensitive enzymes (for example, nitrogenase). Thus, the system described here could have general biotechnological applications involving the heterologous expression of oxygen-sensitive enzymes in A. vinelandii.

With respect to the maturation of [Fe-S] proteins, previous work established that the normal physiological accumulation of NifU and NifS, which is necessary and sufficient to supply [Fe-S] clusters required for the maturation of nitrogenase, is unable to also supply [Fe-S] clusters for the maturation of other cellular [Fe-S] proteins, such as aconitase (16). In the present work we found that in the case of IscU, this apparent target specificity can be overcome by increasing the level of NifU. The capacity for an elevated level of NifU to functionally replace IscU does not also require NifS, indicating that the S2– normally supplied to NifU by NifS can be replaced in some other way, most likely by the activity of IscS. However, under normal physiological conditions there is probably a specific functional interaction between NifU and NifS because a loss of NifS function results in a dramatic reduction in the maturation of the nitrogenase components. In complementary experiments it was shown that an increase in the level of IscU increases the capacity for diazotrophic growth when nifU is deleted. Thus, under these conditions, bidirectional functional replacement can occur between NifU and IscU, but only when there is an increase in the level of the complementing component beyond the level necessary for the normal physiological functions.

We also found that the null growth phenotype associated with depletion of IscU can be rescued when cells are cultured under nitrogen-fixing conditions, provided that the concentration of oxygen is lowered. In these experiments NifU and NifS were produced at their normal physiological levels. Although there could be a number of different explanations for the results, the original experimental rationale was to ask if normal physiological levels of NifU can functionally replace IscU under conditions in which a demand for [Fe-S] cluster production is expected to be lower.

In contrast to the situation with NifU and IscU, we found no experimental conditions under which the function of IscS can be replaced by NifS. This is not surprising because IscS has been shown to be a general agent of intracellular sulfur trafficking and it is required not only for the maturation of [Fe-S] proteins but also for thiolation of tRNA and biosynthesis of a variety of sulfur-containing cofactors (19). Nevertheless, biochemical studies reported here demonstrated that an elevated level of NifS is unable to replace the [Fe-S] protein maturation function of IscS. Although NifS cannot replace the function of IscS, elevated expression of IscS can partially replace the function of NifS. These results are in line with the observation that elevated expression of NifU can replace the function of IscU without the attendant elevated expression of NifS, indicating that there is probably a weak functional interaction between IscS and NifU.

In summary, results reported here and elsewhere reveal that there is a specific interaction between NifU and NifS that permits optimal physiological assembly of [Fe-S] clusters on the NifU scaffold, as well as target specificity for the delivery of [Fe-S] clusters assembled on NifU for the maturation of nitrogenase components. The same type of specificity is also apparent for the IscU and IscS components. Nevertheless, there is a clear, limited capacity for reciprocal functional replacement between NifU and IscU under conditions in which these proteins are produced at high levels. Although IscS can partially replace the function of NifS, there is no experimental evidence that NifS can replace the function of IscS. Because there is a great deal of primary sequence conservation between NifS and IscS, as well as between the N-terminal domain of NifU and IscU, work described here provides a basis for development of genetic and biochemical strategies for understanding the target specificity between [Fe-S] cluster assembly scaffolds and their complementary S2– delivery agents, as well as the specificity between [Fe-S] cluster assembly scaffolds and their target [Fe-S] proteins.


arrow
ACKNOWLEDGMENTS
 
This work was supported by National Science Foundation grant MCB-021138.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg VA 24061. Phone: (540) 231-5895. Fax: (540) 231-7126. E-mail: deandr{at}vt.edu. Back

{triangledown} Published ahead of print on 19 January 2007. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Agar, J. N., C. Krebs, J. Frazzon, B. H. Huynh, D. R. Dean, and M. K. Johnson. 2000. IscU as a scaffold for iron-sulfur cluster biosynthesis: sequential assembly of [2Fe-2S] and [4Fe-4S] clusters in IscU. Biochemistry 39:7856-7862.[CrossRef][Medline]
    2. 2
  2. Agar, J. N., P. Yuvaniyama, R. F. Jack, V. L. Cash, A. D. Smith, D. R. Dean, and M. K. Johnson. 2000. Modular organization and identification of a mononuclear iron-binding site within the NifU protein. J. Biol. Inorg. Chem. 5:167-177.[CrossRef][Medline]
    3. 3
  3. Barras, F., L. Loiseau, and B. Py. 2005. How Escherichia coli and Saccharomyces cerevisiae build Fe/S proteins. Adv. Microb. Physiol. 50:41-101.[CrossRef][Medline]
    4. 4
  4. Cagnon, C., V. Valverde, and J. M. Masson. 1991. A new family of sugar-inducible expression vectors for Escherichia coli. Protein Eng. 4:843-847.[Abstract/Free Full Text]
    5. 5
  5. Chromy, V., J. Fischer, and V. Kulhanek. 1974. Re-evaluation of EDTA-chelated biuret reagent. Clin. Chem. 20:1362-1363.[Abstract]
    6. 6
  6. Cribbs, R., and E. Englesberg. 1964. L-Arabinose negative mutants of the L-ribulokinase structural gene affecting the levels of L-arabinose isomerase in Escherichia coli. Genetics 49:95-108.[Free Full Text]
    7. 7
  7. Dos Santos, P. C., D. R. Dean, Y. Hu, and M. W. Ribbe. 2004. Formation and insertion of the nitrogenase iron-molybdenum cofactor. Chem. Rev. 104:1159-1173.[CrossRef][Medline]
    8. 8
  8. Dos Santos, P. C., R. Y. Igarashi, H. I. Lee, B. M. Hoffman, L. C. Seefeldt, and D. R. Dean. 2005. Substrate interactions with the nitrogenase active site. Acc. Chem. Res. 38:208-214.[CrossRef][Medline]
    9. 9
  9. Dos Santos, P. C., A. D. Smith, J. Frazzon, V. L. Cash, M. K. Johnson, and D. R. Dean. 2004. Iron-sulfur cluster assembly: NifU-directed activation of the nitrogenase Fe protein. J. Biol. Chem. 279:19705-19711.[Abstract/Free Full Text]
    10. 10
  10. Fu, W., R. F. Jack, T. V. Morgan, D. R. Dean, and M. K. Johnson. 1994. The nifU gene product from Azotobacter vinelandii is a homodimer that contains two identical [2Fe-2S] clusters. Biochemistry 33:13455-13463.[CrossRef][Medline]
    11. 11
  11. Hoff, K. G., J. J. Silberg, and L. E. Vickery. 2000. Interaction of the iron-sulfur cluster assembly protein IscU with the Hsc66/Hsc20 molecular chaperone system of Escherichia coli. Proc. Natl. Acad. Sci. USA 97:7790-7795.[Abstract/Free Full Text]
    12. 12
  12. Hoff, K. G., D. T. Ta, T. L. Tapley, J. J. Silberg, and L. E. Vickery. 2002. Hsc66 substrate specificity is directed toward a discrete region of the iron-sulfur cluster template protein IscU. J. Biol. Chem. 277:27353-27359.[Abstract/Free Full Text]
    13. 13
  13. Jacobson, M. R., K. E. Brigle, L. T. Bennett, R. A. Setterquist, M. S. Wilson, V. L. Cash, J. Beynon, W. E. Newton, and D. R. Dean. 1989. Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii. J. Bacteriol. 171:1017-1027.[Abstract/Free Full Text]
    14. 14
  14. Jacobson, M. R., V. L. Cash, M. C. Weiss, N. F. Laird, W. E. Newton, and D. R. Dean. 1989. Biochemical and genetic analysis of the nifUSVWZM cluster from Azotobacter vinelandii. Mol. Gen. Genet. 219:49-57.[Medline]
    15. 15
  15. Johnson, D. C., D. R. Dean, A. D. Smith, and M. K. Johnson. 2005. Structure, function, and formation of biological iron-sulfur clusters. Annu. Rev. Biochem. 74:247-281.[CrossRef][Medline]
    16. 16
  16. Johnson, D. C., P. C. Dos Santos, and D. R. Dean. 2005. NifU and NifS are required for the maturation of nitrogenase and cannot replace the function of isc-gene products in Azotobacter vinelandii. Biochem. Soc. Trans. 33:90-93.[CrossRef][Medline]
    17. 17
  17. Johnson, D. C., M. C. Unciuleac, and D. R. Dean. 2006. Controlled expression and functional analysis of iron-sulfur cluster biosynthetic components within Azotobacter vinelandii. J. Bacteriol. 188:7551-7561.[Abstract/Free Full Text]
    18. 18
  18. Jung, Y. S., H. S. Gao-Sheridan, J. Christiansen, D. R. Dean, and B. K. Burgess. 1999. Purification and biophysical characterization of a new [2Fe-2S] ferredoxin from Azotobacter vinelandii, a putative [Fe-S] cluster assembly/repair protein. J. Biol. Chem. 274:32402-32410.[Abstract/Free Full Text]
    19. 19
  19. Kessler, D. 2006. Enzymatic activation of sulfur for incorporation into biomolecules in prokaryotes. FEMS Microbiol. Rev. 30:825-840.[CrossRef][Medline]
    20. 20
  20. Lauhon, C. T., E. Skovran, H. D. Urbina, D. M. Downs, and L. E. Vickery. 2004. Substitutions in an active site loop of Escherichia coli IscS result in specific defects in Fe-S cluster and thionucleoside biosynthesis in vivo. J. Biol. Chem. 279:19551-19558.[Abstract/Free Full Text]
    21. 21
  21. Lundgren, H. K., and G. R. Bjork. 2006. Structural alterations of the cysteine desulfurase IscS of Salmonella enterica serovar Typhimurium reveal substrate specificity of IscS in tRNA thiolation. J. Bacteriol. 188:3052-3062.[Abstract/Free Full Text]
    22. 22
  22. Olson, J. W., J. N. Agar, M. K. Johnson, and R. J. Maier. 2000. Characterization of the NifU and NifS Fe-S cluster formation proteins essential for viability in Helicobacter pylori. Biochemistry 39:16213-16219.[CrossRef][Medline]
    23. 23
  23. Rubio, L. M., and P. W. Ludden. 2005. Maturation of nitrogenase: a biochemical puzzle. J. Bacteriol. 187:405-414.[Free Full Text]
    24. 24
  24. Saas, J., K. Ziegelbauer, A. von Haeseler, B. Fast, and M. Boshart. 2000. A developmentally regulated aconitase related to iron-regulatory protein-1 is localized in the cytoplasm and in the mitochondrion of Trypanosoma brucei. J. Biol. Chem. 275:2745-2755.[Abstract/Free Full Text]
    25. 25
  25. Schwartz, C. J., J. L. Giel, T. Patschkowski, C. Luther, F. J. Ruzicka, H. Beinert, and P. J. Kiley. 2001. IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc. Natl. Acad. Sci. USA 98:14895-14900.[Abstract/Free Full Text]
    26. 26
  26. Smith, A. D., G. N. Jameson, P. C. Dos Santos, J. N. Agar, S. Naik, C. Krebs, J. Frazzon, D. R. Dean, B. H. Huynh, and M. K. Johnson. 2005. NifS-mediated assembly of [4Fe-4S] clusters in the N- and C-terminal domains of the NifU scaffold protein. Biochemistry 44:12955-12969.[CrossRef][Medline]
    27. 27
  27. Strandberg, G. W., and P. W. Wilson. 1968. Formation of the nitrogen-fixing enzyme system in Azotobacter vinelandii. Can. J. Microbiol. 14:25-31.[Medline]
    28. 28
  28. Tokumoto, U., S. Kitamura, K. Fukuyama, and Y. Takahashi. 2004. Interchangeability and distinct properties of bacterial Fe-S cluster assembly systems: functional replacement of the isc and suf operons in Escherichia coli with the nifSU-like operon from Helicobacter pylori. J. Biochem. (Tokyo) 136:199-209.[Abstract/Free Full Text]
    29. 29
  29. Tokumoto, U., and Y. Takahashi. 2001. Genetic analysis of the isc operon in Escherichia coli involved in the biogenesis of cellular iron-sulfur proteins. J. Biochem. (Tokyo) 130:63-71.[Abstract/Free Full Text]
    30. 30
  30. Vickery, L. E., J. J. Silberg, and D. T. Ta. 1997. Hsc66 and Hsc20, a new heat shock cognate molecular chaperone system from Escherichia coli. Protein Sci. 6:1047-1056.[Medline]
    31. 31
  31. Yuvaniyama, P., J. N. Agar, V. L. Cash, M. K. Johnson, and D. R. Dean. 2000. NifS-directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc. Natl. Acad. Sci. USA 97:599-604.[Abstract/Free Full Text]
    32. 32
  32. Zheng, L., V. L. Cash, D. H. Flint, and D. R. Dean. 1998. Assembly of iron-sulfur clusters. Identification of an iscSUA-hscBA-fdx gene cluster from Azotobacter vinelandii. J. Biol. Chem. 273:13264-13272.[Abstract/Free Full Text]
    33. 33
  33. Zheng, L., R. H. White, V. L. Cash, R. F. Jack, and D. R. Dean. 1993. Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynthesis. Proc. Natl. Acad. Sci. USA 90:2754-2758.[Abstract/Free Full Text]

Journal of Bacteriology, April 2007, p. 2854-2862, Vol. 189, No. 7
0021-9193/07/$08.00+0     doi:10.1128/JB.01734-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Setubal, J. C., dos Santos, P., Goldman, B. S., Ertesvag, H., Espin, G., Rubio, L. M., Valla, S., Almeida, N. F., Balasubramanian, D., Cromes, L., Curatti, L., Du, Z., Godsy, E., Goodner, B., Hellner-Burris, K., Hernandez, J. A., Houmiel, K., Imperial, J., Kennedy, C., Larson, T. J., Latreille, P., Ligon, L. S., Lu, J., Maerk, M., Miller, N. M., Norton, S., O'Carroll, I. P., Paulsen, I., Raulfs, E. C., Roemer, R., Rosser, J., Segura, D., Slater, S., Stricklin, S. L., Studholme, D. J., Sun, J., Viana, C. J., Wallin, E., Wang, B., Wheeler, C., Zhu, H., Dean, D. R., Dixon, R., Wood, D. (2009). Genome Sequence of Azotobacter vinelandii, an Obligate Aerobe Specialized To Support Diverse Anaerobic Metabolic Processes. J. Bacteriol. 191: 4534-4545 [Abstract] [Full Text]  
  • Lewis, J. A., Boyd, J. M., Downs, D. M., Escalante-Semerena, J. C. (2009). Involvement of the Cra Global Regulatory Protein in the Expression of the iscRSUA Operon, Revealed during Studies of Tricarballylate Catabolism in Salmonella enterica. J. Bacteriol. 191: 2069-2076 [Abstract] [Full Text]  
  • Yeom, J., Jeon, C. O., Madsen, E. L., Park, W. (2009). In Vitro and In Vivo Interactions of Ferredoxin-NADP+ Reductases in Pseudomonas putida. J Biochem 145: 481-491 [Abstract] [Full Text]  
  • Yeom, J., Jeon, C. O., Madsen, E. L., Park, W. (2009). Ferredoxin-NADP+ Reductase from Pseudomonas putida Functions as a Ferric Reductase. J. Bacteriol. 191: 1472-1479 [Abstract] [Full Text]  
  • Bandyopadhyay, S., Naik, S. G., O'Carroll, I. P., Huynh, B.-H., Dean, D. R., Johnson, M. K., Dos Santos, P. C. (2008). A Proposed Role for the Azotobacter vinelandii NfuA Protein as an Intermediate Iron-Sulfur Cluster Carrier. J. Biol. Chem. 283: 14092-14099 [Abstract] [Full Text]  
  • Zhao, D., Curatti, L., Rubio, L. M. (2007). Evidence for nifU and nifS Participation in the Biosynthesis of the Iron-Molybdenum Cofactor of Nitrogenase. J. Biol. Chem. 282: 37016-37025 [Abstract] [Full Text]  
  • Shimomura, Y., Kamikubo, H., Nishi, Y., Masako, T., Kataoka, M., Kobayashi, Y., Fukuyama, K., Takahashi, Y. (2007). Characterization and Crystallization of an IscU-type Scaffold Protein with Bound [2Fe 2S] Cluster from the Hyperthermophile, Aquifex aeolicus. J Biochem 142: 577-586 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dos Santos, P. C.
Right arrow Articles by Dean, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dos Santos, P. C.
Right arrow Articles by Dean, D. R.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»