Previous Article | Next Article ![]()
Journal of Bacteriology, May 2007, p. 3335-3347, Vol. 189, No. 9
0021-9193/07/$08.00+0 doi:10.1128/JB.01745-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, P.O. Box 475, Canberra ACT 0200, Australia,1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, Pennsylvania 168022
Received 13 November 2006/ Accepted 12 February 2007
|
|
|---|
|
|
|---|
The activity of the cyanobacterial CCM in the studied freshwater organisms Synechococcus sp. strain PCC 7942 and Synechocystis sp. strain PCC 6803 and the euryhaline (coastal/estuarine) strain Synechococcus sp. strain PCC 7002 is strongly Ci responsive and is fully engaged under Ci-limiting conditions. The apparent photosynthetic affinity for Ci, as measured by K0.5(Ci), ranges between a low-affinity, constitutive state (approximately 200 µM) under Ci-replete conditions and a high-affinity, induced state (10 to 15 µM; reviewed in references 3, 8, and 19) under Ci limitation. In freshwater strains, the transition between these states is characterized by dynamic and large changes in the expression and activity of inducible HCO3 and CO2 transport systems (11, 14-16, 20, 23, 28, 29). The signal response pathways that control CCM activity in response to Ci availability are incompletely understood, particularly in euryhaline and marine strains of cyanobacteria. In the freshwater species Synechococcus sp. strain PCC 7942 a strong correlation between CCM activity and transient fluctuations in the Ci pool has been established, as well as a dependence on oxygen for full expression of CCM activity (30). The downstream events in the Ci signaling pathway of freshwater species has been better characterized, and LysR-type transcription factors are known to be involved in the regulation of high-affinity Ci transporter gene expression as both activators and repressors (7, 15, 28).
In the euryhaline cyanobacterium Synechococcus sp. strain PCC 7002, two Na+-dependent inducible HCO3 transport activities have been characterized (20): a high-affinity, low-flux system, originally characterized in Synechocystis sp. strain PCC 6803 (23), which is encoded by the sbtA gene and a medium-affinity, high-flux transporter termed BicA, which is widely distributed across cyanobacterial species. A gene encoding a putative HCO3 porin (porB; the Synechocystis sp. strain PCC 6803 homologue [slr0042] is part of a known HCO3 transporter operon [15]) is strongly Ci responsive also in Synechococcus sp. strain PCC 7002 (20). The active transport of CO2 in cyanobacterial species including Synechococcus sp. strain PCC 7002 is associated with specialized NDH-1 dehydrogenase complexes that are proposed to convert CO2 to HCO3 within the cell. The ndhF4, NdhD4, and chpX (cupB) genes are required for a low-affinity constitutive CO2 transport activity termed NDH-14, whereas an inducible, high-affinity CO2 transporter, NDH-13, requires expression of the ndhD3, ndhF3, and chpY (cupA) genes (9, 10, 12, 13, 24). The role of LysR transcription factors in CCM regulation is currently unclear in this organism.
Euryhaline cyanobacterial strains such as Synechococcus sp. strain PCC 7002, which occur in coastal or estuarine environments, would certainly be subject to habitat fluctuations such as light, nutrients (especially Ci) and temperature owing to the injection of freshwater and nutrients from land, and tidal influences (4). Consequently, a regulatory system would be required to modulate CCM activity. In the present study, we have examined the genomic structure and transcriptional regulation of low-CO2 induced Ci uptake systems in Synechococcus sp. strain PCC 7002, revealing some unique and compact gene organization. Signifying the importance of transcriptional controls on CCM activity in this system, we generated a mutant of a LysR family transcriptional regulator that exhibited complete derepression of CCM activity under Ci-replete conditions. Based on this discovery, it would be reasonable for this LysR factor to be termed CcmR, for CCM regulator, as suggested by Wang et al. (26).
|
|
|---|
ccmR and ccmR mutants, kanamycin was included at a final concentration of 150 µg ml1. To induce a medium- to high-affinity CCM rapidly, exponentially growing cells (optical density at 730 nm of 0.3 to 0.4), which had been bubbled with an air-CO2 mixture containing 2% (vol/vol) CO2, were harvested by centrifugation at 4,800 x g for 6 min and resuspended in an equivalent volume of modified BG-11 medium containing a final concentration of approximately 0.1 mM Ci before transfer to bubbling with air or CO2-free air, respectively. The
ccmR deletion mutant was constructed sequentially. First, a pUC18-based construct consisting of the 0.90- and 0.93-kb regions immediately upstream and downstream of ccmR was assembled. The primers for amplifying the upstream sequence were forward (5'-TTGAGCTCATCTAGGGCTTGGCGATC) and reverse (5'-TTGGATCCTCCTGAACTTGTGCTGTTATG) introducing the SacI and BamHI sites at the 5' and 3' ends, respectively. The primers for amplifying the downstream flanking sequence were forward (5'-TAGGATCCTTTCCCGTGCCTTTGGTAG) and reverse (5'-AAAAGCTTAATCAGCACCCAGGCTCCAG) introducing the BamHI and HindIII sites at the 5' and 3' ends, respectively, for assembly inside pUC18. A kanamycin resistance marker gene from the Tn903 transposon (GenBank X06404) was cloned as a BamHI fragment into the resulting BamHI site in both transcriptional orientations relative to the ccmR flanking sequences. The cartridge was used to transform wild-type Synechococcus strain PCC 7002 cells as described by Sültemeyer et al. (26), and segregation was confirmed by PCR analysis. The construct for generating a ccmR insertional mutant was assembled in pGEMT. The primers for amplifying the ccmR open reading frame (ORF) were forward (5'-AAGGATCCAAGTTCAGGAGTAAACCCATGATC) and reverse (5'-AGCGGCCGCCAACAATTTTGAGCTTTTAGGG). A kanamycin resistance marker from the Tn903 transposon was cloned into the XbaI site in the 5' half of the ORF in the forward transcriptional orientation relative to the ccmR sequence. The cartridge was used for transformation of wild-type cells as described above.
The
nha mutant was made by assembling a construct in vector pGEMT (Invitrogen, Carlsbad, CA). A region from 860 bp upstream to 810 bp downstream of the SmaI and XbaI sites in nhaS3 and mnhD1, respectively (see Fig. 5A), was amplified by PCR, and the section internal to the SmaI and XbaI sites (Fig. 5A) was replaced by cloning of a chloramphenicol acetyltransferase gene (conferring chloramphenicol resistance). The primers used to amplify the flanking sequences were as follows: forward, 5'-AATTCTATGCTAAGTCCCACAATCTTTTC, and reverse, 5'-AATTGCGGCTGGATAACTGTCC. Segregation of the
nha allele from wild-type alleles after three rounds of chloramphenicol selection was confirmed by PCR (results not shown).
![]() View larger version (25K): [in a new window] |
FIG. 5. Structure, regulation, and function of the bicA genomic region in Synechococcus strain PCC 7002. (A) Map of the bicA genomic region. Cotranscribed regions are indicated with arrows (dashed lines represent the range of 5' and 3' delimits for each mRNA as determined by RT-PCR; see Table 6). nhaS3, Na+/H+ antiporter (HMM PF00999); mnhC (HMM PF00420), mnhD1/2 (HMM PF00361), and mnhB (HMM PF04039), NADH:ubiquinone oxidoreductase-like subunits from a putative multisubunit Na+/H+ antiporter; T'glycosylase, transglycosylase (PFAM03562); recB, nuclease (COG2251.1); HC, hypothetical conserved protein. (B) Relative mRNA abundance of the ORFs downstream of bicA in wild-type (WT) cells transferred from bubbling with 2% CO2 in air to bubbling with air. Transcript changes were determined by quantitative RT-PCR (n = 4), and symbols represent transcript expression ± the SE relative to the housekeeping gene, rnpA (set at 1.0). (C) Relative mRNA abundance of ORFs in the bicA region in wild-type (WT) or ccmR mutant cells bubbled continuously with 2% (vol/vol) CO2 in air. Transcript changes were determined by quantitative RT-PCR (n = 4), and symbols represent transcript expression relative to the wild-type 0-min amount (set at 100%) ± the SE. (D) HCO3-dependent oxygen evolution in air-grown wild-type cells and cells containing a deletion between the indicated SmaI and XbaI sites (see panel A) of the nhaS3 and mnhD1 genes ( nha). Cells were analyzed by membrane inlet mass spectrometry at the indicated Ci concentrations in the presence of added CA or the CO2 uptake inhibitor, EZ. (E) Relative photosynthetic affinity for Ci for cells (part D) as measured by the K0.5(Ci) (Ci concentration for half maximal rate). Note the break in the y axis in panel B.
|
Use of genome and protein databases. Synechococcus sp. strain PCC 7002 sequences were accessed from the complete genome database constructed by Donald Bryant and Tao Li (Pennsylvania State University) and Jindong Zhao (College of Life Sciences, Peking University) and are available at GenBank (for accession numbers, see Table 3). For other cyanobacterial sequences, gene object identifiers (GOIs) from the Integrated Microbial Genomes database (DOE, Joint Genome Institute; http://img.jgi.doe.gov/cgi-bin/pub/main.cgi) were used in preference to GenBank accession numbers if locus tags were unavailable. Information about the databases used to detect conserved protein domains is available at http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml.
|
View this table: [in a new window] |
TABLE 3. Sequences of the gene-specific primers used in quantitative RT-PCR assays for Synechococcus strain PCC 7002a
|
|
View this table: [in a new window] |
TABLE 1. Sequences of the gene-specific primers used in RT-PCR assays of the ccmR genomic region of Synechococcus strain PCC 7002a
|
|
View this table: [in a new window] |
TABLE 2. Sequences of the gene-specific primers used in RT-PCR assays of the bicA genomic region of Synechococcus strain PCC 7002a
|
Determination of TSPs. Transcription start points (TSPs) for bicA and ndhF3 were determined by RNA ligase-mediated amplification of full-length 5' cDNA ends (RLM-RACE) using the Generacer kit (L1500-1502; Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer. In brief, total RNA was isolated from wild-type cells bubbled with air for 60 min (as described above). First-strand cDNA was generated from 3 µg of dephosphorylated RNA with full-length mRNA subsequently decapped and ligated to a specific RNA oligonucleotide. Nested PCR was performed, and specific products cloned and sequenced in the vector pCR4Blunt-TOPO. The following primers were used: ndhF3 reverse, 5'-GCCCATTCAGCCAGACCATCAAA; ndF3 reverse nested, 5'-CCACAGCATAGAGTTGGGCGAGTAA; bicA reverse, 5' CAGAAATCACGGTGTAGGGCATCAT; and bicA reverse nested, ATGGGCAATCACAGCGGTCATAA.
Luciferase assays and luxAB fusions. Putative promoter elements were amplified by PCR with the primers indicated in Table 4, cloned to pENTR (Invitrogen, Carlsbad, CA), and fused to Vibrio luciferase genes (luxAB) by Gateway LR recombination in a version of the Synechococcus sp. strain PCC 7002 neutral-site-integration reporter vector, pMBB, modified for lambda site-specific recombination. The pMBB vector (kindly provided by G. Bullerjahn) is a modified version of the Synechococcus sp. strain PCC 7942 luciferase reporter construct, pAM1414 (1), and contains a neutral integration site encoding omega-3 desaturase (desB) (21). Luminescence in liquid cyanobacterial cultures was measured in triplicate in freshly harvested 2-ml aliquots after the rapid addition of 4 µl of 0.025 to 0.05% (vol/vol) Decanal (D7384; Sigma, St. Louis, MO) in a TD-20/20 luminometer. Substrate was diluted in 100% dimethyl sulfoxide. The optimal decanal concentration was determined for each experiment. The average raw luminescence was normalized on a chlorophyll a basis and is expressed as a percentage of the empty vector control (high-Ci cells). The chlorophyll a concentration was determined as previously described (17).
|
View this table: [in a new window] |
TABLE 4. Sequences of the primers used to amplify Synechococcus sp. strain PCC 7002 DNA fragments from the upstream regions of the ndhF3 [ndhF3(P550)] and bicA genes (722F/R and clones 2 to 12) for analysis as luxAB fusions in the integration vector pMBB
|
|
|
|---|
![]() View larger version (14K): [in a new window] |
FIG. 1. Turnover of mRNA encoding Ci transporters in Synechococcus strain PCC 7002 cells. Exponentially growing high-Ci cells were swapped to buffer containing approximately 100 µM Ci and bubbled with CO2-free air for 30 min. At this time (time zero) cells were transferred to either CO2-free air or 2.0% CO2 in the presence or absence of 200 µg of RIF ml1. The relative abundance of chpY, sbtA, bicA, and porB mRNA was determined by quantitative RT-PCR (n = 4). Symbols represent mRNA abundance relative to the 0-min amount (set at 100%) ± the standard error (SE).
|
Deletion of a CbbR-like transcription factor (CcmR) derepresses CCM activity in Synechococcus sp. strain PCC 7002. We found that CbbR-like proteins from diverse cyanobacterial species cluster into two main groups (Fig. 2A). The less-divergent sequences (group 1) may represent proteins with an essential function, such as the Calvin cycle gene regulator CbbR, since this cluster contains the Synechocystis sp. strain PCC 6803 sll0998 locus which cannot be stably inactivated (7, 15, G. D. Price, unpublished data). A more divergent grouping (group 2) containing CmpR and NdhR/CcmR from Synechocystis sp. strain PCC 6803 (abbreviated as 6803) is evident. NdhR/CcmR_6803 would appear to repress the transcription of both ndhF3 ndhD3 chpY (cupA) and sbtA (7, 28), whereas CmpR_6803 appears to activate transcription of the cmpABCD operon (15). The freshwater strain Synechococcus sp. strain PCC 7942 has a single group 2 representative, CmpR_7942 (15). A single group 2 representative is also apparent in Synechococcus sp. strain PCC 7002.
![]() View larger version (28K): [in a new window] |
FIG. 2. CbbR-like genes in Synechococcus sp. strain PCC 7002. (A) Phylogenetic tree of proteins with >27% amino acid identity to Rhodobacter sphaeroides CbbR from cyanobacteria representing diverse habitats. Proteins were aligned by using CLUSTAL W and the dendrogram generated in the TREEVIEW program. Species name abbreviations: alr/all, Nostoc sp. strain PCC 7120; Avar, Anabaena variabilis ATCC 29413; Cwat, Crocosphaera watsonii WH8501; gll/glr, Gloeobacter violaceus (strain PCC 7421); Npun, Nostoc punctiforme ATCC 29133; PMM, Prochlorococcus marinus (subsp. pastoris, strain CCMP 1378/MED4); Selo, Synechococcus sp. strain PCC 7942 (elongatus); slr/sll, Synechocystis sp. strain PCC 6803; SynW8102, Synechococcus sp. strain WH8102; 7002, Synechococcus sp. strain PCC 7002; tlr/tll, Thermosynechococcus elongatus strain BP-1; Tery, Trichodesmium erythraeum IMS101; YSA' and YSB', Synechococcus sp. strain Yellowstone A-Prime and B-Prime. Locus tags are given for the Anabaena, Synechocystis strain PCC 6803, and Gloeobacter violaceus genes. GOIs from the Integrated Microbial Genomes database (DOE, Joint Genome Institute; http://img.jgi.doe.gov/cgi-bin/pub/main.cgi) are used elsewhere except for the Yellowstone species, for which the GenBank accession numbers are given. (B) Physiological phenotype of the group 2 "ccmR" deletion mutant. Rates of Ci-dependent O2 evolution for wild-type (WT) and ccmR cells grown continuously with 2% (vol/vol) CO2 in air (two replicates are shown). (C) Structure of the ccmR genomic region in Synechococcus sp. strain PCC 7002. Possible cotranscribed regions are indicated with arrows (dashed lines represent the range of 5' and 3' delimits for each mRNA as indicated by RT-PCR; see Table 5). Predicted stem and loop structures are shown. ndhF3/D3, NAD(P)H-dehydrogenase (NDH-13) subunit genes; chpY/cupA, gene for putative CO2 hydration protein associated with NDH-1; orf133, conserved gene of unknown function associated with NDH-1 genes; cytP450, cytochrome p450 (PFAM00067); DSBA, DSBA thioredoxin (PFAM 03123).
|
ccmR allele from wild-type alleles after three rounds of kanamycin selection was confirmed by PCR (results not shown). As shown in Fig. 2B, mutant cells grown continuously at high Ci had a striking physiological phenotype. The cells have a very high photosynthetic affinity for Ci, with a K0.5(Ci) of approximately 10 µM, compared to the wild type, which has a K0.5(Ci) of approximately 250 µM. This result suggests that CcmR ordinarily functions to repress high-affinity CCM activity under nonlimiting Ci conditions.
CcmR represses expression of high-affinity Ci transporters in Synechococcus sp. strain PCC 7002 under nonlimiting Ci conditions.
The expression of CcmR_7002 gene-flanking genes (Fig. 2C), high-affinity Ci transporter genes, and carboxysome-associated genes was assessed in
ccmR and wild-type cells bubbled with high Ci or air (Fig. 3). The mRNA abundance for the divergently oriented cytochrome p450 gene was largely unaffected by the replacement of the ccmR gene with a kanamycin resistance marker, irrespective of orientation (Fig. 3A). Thus, the mutant that contained the resistance marker in the same transcriptional orientation as ccmR was used in all subsequent experiments. The close juxtaposition in Synechococcus sp. strain PCC 7002 of ccmR and the genes for high-affinity CO2 uptakendhF3, ndhD3, chpY (cupA), and orf133is unique among the sequenced cyanobacterial genomes (Fig. 2C). Unlike the freshwater strain Synechocystis sp. strain PCC 6803 (7, 28), transcriptional derepression of this region was not observed in
ccmR. Instead, a low-level constitutive expression of the region was found, irrespective of the Ci concentration or transgene orientation. It should be noted that the Tn903 kanamycin cassette lacks a typical terminator and is likely to provide basal expression of the ndhF3, ndhD3, chpY, and orf133 genes downstream of ccmR and be nonresponsive to CO2. In contrast, and consistent with the increased photosynthetic affinity for Ci in the mutant (Fig. 2B),
ccmR cells grown at high Ci had relatively abundant mRNA pools for the inducible HCO3 transporter genes bicA and sbtA and the putative HCO3 porin gene, porB, compared to wild-type cells (Fig. 3B). These levels approached the maximal levels in air-induced wild-type cells (Fig. 3B). We also investigated whether carboxysome-associated genes are targets for CcmR action but found little difference in the mRNA abundance for these genes between mutant and wild-type cells (Fig. 3D). Given that these genes are not strongly Ci responsive in the wild type, this result is not surprising. An exception was the mRNA pool encoding the carboxysomal CA, ccaA, which was more strongly induced under air limitation in
ccmR cells. This mild induction of ccaA mRNA has been noted in other CCM-deficient mutants (6).
![]() View larger version (15K): [in a new window] |
FIG. 3. Gene expression in ccmR. The relative abundance of mRNA for ccmR-neighboring genes (A), bicarbonate transporter genes (B), and carboxysomal genes (C and D) in wild-type and ccmR cells after transfer from bubbling with 2% (vol/vol) CO2 in air to bubbling with air alone for 60 min was determined. Transcript changes were determined by quantitative RT-PCR (n = 4), and symbols represent transcript expression relative to the wild-type (WT) 0-min amount (set at 100%) ± the SE. Note the break in the y axis in panels A and B. The experiment was independently replicated, and representative data are shown.
|
ccmR mutant (Fig. 3B), led us to investigate the transcriptional regulation of this region. We generated an insertional ccmR mutant at the XbaI site (Fig. 2C) located 420 bp from the start of the ccmR ORF; however, the phenotype was the same as the deletion mutant (results not shown). This result indicates that it is difficult to engineer mutations at this locus that do not interfere with transcription of the downstream gene cluster. The expression of the 5' half of the ccmR transcript, upstream of the insertion site for the antibiotic resistance marker, was monitored in the insertional mutant by quantitative RT-PCR and found to be elevated at high Ci (Fig. 4B). This result signifies that CcmR ordinarily autorepresses ccmR transcription, as previously found for NdhR/CcmR in the freshwater strain Synechocystis sp. strain PCC 6803 (7).
![]() View larger version (23K): [in a new window] |
FIG. 4. Transcriptional regulation of the ccmR region in Synechococcus strain PCC 7002. (A) Relative mRNA abundance of the ORFs downstream from ccmR in wild-type cells transferred from bubbling with 2% CO2 in air to bubbling with normal air. Transcript changes were determined by quantitative RT-PCR (n = 4), and symbols represent transcript expression ± the SE relative to the housekeeping gene, rnpA (set at 1.0). (B) Relative mRNA abundance of ccmR in wild-type (WT) or ccmR insertional mutant cells after transfer from bubbling with 2% (vol/vol) CO2 in air to bubbling with normal air. Transcript changes were determined by quantitative RT-PCR (n = 4), and symbols represent transcript expression relative to the wild-type high-Ci amount (set at 100%) ± the SE. Note the break in the y axis in panel A. (C) Predicted promoter structure of the ndhF3 upstream region. Consensus LysR binding sites are in boldface, and putative 35 and 10 elements (as predicted by BPROM) are also shown. The most 5' TSP determined experimentally is marked with an arrow. (D) Luciferase activity directed by the 550-bp ndhF3 upstream region fused to luxAB genes (pF3:P550) and stably integrated into the genome of Synechococcus sp. strain PCC 7002 cells. Cells were grown at high Ci or with air bubbling for 5 h. A positive Ci-responsive control (pbicA:P722F) consisting of a 722-bp fragment from the upstream region of the bicA gene fused to luxAB, is shown (see Fig. 6A). Relative luminescence units are expressed on a chlorophyll a basis as a percentage of the value obtained for high-Ci cells containing the empty vector control ± the standard deviation.
|
|
View this table: [in a new window] |
TABLE 5. Amplification of mRNA sequences from the ccmR region of Synechococcus strain PCC 7002 by RT-PCRa
|
The bicA gene is part of a large CcmR-regulated operon. Our finding that Synechococcus sp. strain PCC 7002 CcmR represses full expression of the bicA gene at nonlimiting Ci (Fig. 3B) led us to examine the regulation and function of neighboring genes. Figure 5A shows the genomic organization of the region surrounding the bicA locus (GenBank accession no. AF381039). Suggestive of the existence of an operon, nine ORFs occur immediately downstream of bicA without significant intergenic sequences. Immediately downstream of bicA is an ORF that encodes a protein with domains of a Na+/H+ antiporter from the CPA1 family, HMM PF00999, which we have termed nhaS3 after the Synechocystis sp. strain PCC 6803 homologue (sll0689). The subsequent eight ORFs encode hydrophobic sequences resembling a class of cation/proton antiporter proposed to function as a hetero-oligomer (27). The nomenclature of these transporters is unresolved. We have chosen Mnh for multisubunit Na+/H+ antiporter (alternatively Mrp, Mnh, Pha, Sha 27), since Nostoc strain PCC 7120 mutants at a similar locus display Na+ sensitivity (5). Several of these Mnh genes in Synechococcus sp. strain PCC 7002 encode proteins with similarity to the hydrophobic subunits of proton-pumping NADH:ubiquinone oxidoreductases, including MnhC (HMM PF00420), MnhD1/2 (HMM PF00361), and MnhB (HMM PF04039); however, their general role, if any, in transporter energization is obscure (27). This tripartite clustering of genes encoding transportersbicA, nhaS3, and mnhis unique within the sequenced cyanobacterial genomes.
Quantitative RT-PCR analysis (Fig. 5B) showed that nhaS3 plus the mnh-like genes in Synechococcus sp. strain PCC 7002 are upregulated in response to Ci limitation and, as with bicA, nhaS3 and mnh gene expression is also derepressed at high Ci in
ccmR (Fig. 5C). Previously, similar regulation of mnh genes in the freshwater strains Synechocystis sp. strain PCC 6803 (28) and Nostoc sp. strain PCC 7120 (5) has been demonstrated. RT-PCR was carried out with primers that span the junctions of the ORFs in the bicA region in Synechococcus sp. strain PCC 7002 (Table 2). Consistent with the cotranscription of these genes as an operon (Table 6), products that span the intergenic regions were successfully amplified from first-strand cDNA. The failure to detect products at 300 bp upstream of the presumptive bicA start codon suggests the 5' untranslated region is contained in the intervening region (Table 6, primer pair 1279F-1980R). Relatively weak, Ci-responsive transcription was detected up to 172 bp beyond the presumptive stop codon for MnhB (Fig. 5A); however, quantitative RT-PCR showed that, beyond this point, transcripts were not detectable above background levels (results not shown), even though very weak bands were detected using a nonquantitative RT-PCR endpoint approach (Table 6, primer pair 10181F-10692R).
|
View this table: [in a new window] |
TABLE 6. Amplification of mRNA sequences from the bicA region of Synechococcus strain PCC 7002 by RT-PCRa
|
nha allele from wild-type alleles was confirmed by PCR after three rounds of chloramphenicol selection (results not shown). The HCO3-dependent oxygen evolution (a surrogate measure for net HCO3 uptake) was determined in air-grown wild-type and
nha cells incubated with the known CO2 uptake inhibitor, ethoxyzolamide (EZ) (18, 20). Control cells were incubated with 10 µg of bovine CA/ml to ensure rapid equilibrium of Ci species. As shown in Fig. 5D, at Ci concentrations between approximately 20 and 130 µM, oxygen evolution in mutant cells incubated with 300 µM EZ was markedly reduced compared to the wild type. That is, when active HCO3 uptake was the major route for Ci uptake, oxygen evolution was diminished in the mutant but not in the wild type. The relative photosynthetic affinity for Ci in the presence of EZ, as measured by the K0.5(Ci), was 15.5 ± 2.6 µM in the wild type but only 74.9 ± 1.5 µM in the mutant (Fig. 5E). This suggests that the nhaS3-mnh region ordinarily has a role in supporting maximal HCO3 uptake in this cyanobacterium. The growth of the mutant was investigated at high pH, under air limitation, to maximize the contribution of HCO3 transport to growth. However, no difference in growth rate compared to the wild type was detected (data not shown). Analysis of the structure of the bicA promoter. To identify potential Ci-responsive elements within the region immediately upstream and downstream of the bicA start codon, a series of DNA fragments from this region (Fig. 6A) were fused to genes encoding Vibrio luciferase (luxAB) in a version of the Synechococcus sp. strain PCC 7002 neutral-site integration reporter vector, pMBB, modified for lambda site-specific recombination. Elements were selected according to proximity to consensus LysR binding sites and predicted 35 and 10 elements (Fig. 6B). Using RLM-RACE, several TSPs were mapped to a region that supports this predicted promoter structure (Fig. 6B).
![]() View larger version (15K): [in a new window] |
FIG. 6. Analysis of the bicA promoter region in Synechococcus sp. strain PCC 7002. (A) Luciferase activity directed by bicA upstream elements fused to luxAB genes and stably integrated into the genome of Synechococcus sp. strain PCC 7002 cells. Cells were grown at high Ci or with air bubbling for 5 h. Relative luminescence units are expressed on a chlorophyll a basis as a percentage of the value obtained for high-Ci cells containing the empty vector control ± the standard deviation. Asterisks indicate the location of putative LysR-binding motifs. (B) Predicted promoter structure of the bicA upstream region in Synechococcus sp. strain PCC 7002. Putative LysR binding sites are underlined, and putative 35 and 10 elements (as predicted by BPROM at www.softberry.com) are shown in boldface. The TSPs detected by using RLM-RACE are marked with arrowheads; although it is usual to place functional bias on the longest start points relative to the start codon, the shorter products may be genuine alternative TSPs. Note that the first base of the putative 10 box is a G and not the more usual T.
|
|
|
|---|
Prior to the present study, little physiological data has been reported for LysR regulators of CCM genes (NdhR/CcmR and CmpR), and there is an apparent complexity of function within the group 2 factors (i.e., both activators and repressors; Fig. 2A). The striking physiological phenotype of the Synechococcus sp. strain PCC 7002 group 2
ccmR mutant, in which CCM activity was fully induced at high Ci (reported here for the first time in cyanobacteria), was consistent with the types of genes that were shown to be constitutively upregulated (Fig. 3). Identified gene targets of CcmR repressor function include the known loci for high-affinity HCO3 transporters, sbtA and bicA, as well as that for the presumptive HCO3 porin, porB. Putative LysR binding motifs (TnA{n7/8}TnA, 22) exist within 500 bp of the sbtA, porB, and bicA start codons in the Synechococcus sp. strain PCC 7002 genome (Fig. 6 and 7). Interestingly, bicA was not previously identified as a target for NdhR/CcmR in Synechocystis sp. strain PCC 6803 on microarrays (28), since the gene appears to be constitutively expressed in this strain. Indeed, there is no recognizable bicA-like gene in the genome of the much-studied Synechococcus sp. strain PCC 7942.
![]() View larger version (13K): [in a new window] |
FIG. 7. Putative promoter structure of the sbtA (A), porB (B), and ccmR (C) upstream regions in Synechococcus sp. strain PCC 7002. Putative LysR binding sites are underlined, 35 and 10 elements are in boldface, and predicted TSPs are marked with an arrowhead (as predicted by BPROM).
|
Our finding that bicA is a target for CcmR function in Synechococcus sp. strain PCC 7002 prompted a closer examination of the regulation and function of the bicA genomic region (Fig. 5). An operon of 10 ORFs was defined: it commences with bicA and encodes two likely Na+/H+ antiporters, a CPA1 family member similar to NhaS3 from Synechocystis sp. strain PCC 6803 and a multigene Na+/H+ transporter that we have termed Mnh with components resembling NADH:ubiquinone oxidoreductases. This tripartite clustering of transporter activities is unique among known cyanobacterial genomes; however, some clustering of bicA-like genes with likely Na+/H+ antiporter genes can be discerned in other organisms, including Crocosphaera watsonii WH8501 (GOI 400892570) and Nostoc sp. strain PCC 7120 (GOI 4222050). Our deletion of a region downstream of bicA showed that it encodes factors essential to full HCO3 utilization (Fig. 5D). Although a Ci-responsive mnh-like operon is known in both Synechocystis sp. strain PCC 6803 and Nostoc sp. strain PCC 7120 (5, 28) and implicated in salt stress in Nostoc sp. strain PCC 7120, the potential role of the complex, if any, in HCO3 uptake was uncertain: the Mnh complex may be a primary extrusion mechanism to maintain the Na+ gradient required for HCO3 uptake, or it may harness an existing proton gradient to mitigate the cytosolic alkalinization resulting from HCO3 uptake (the subsequent conversion to and fixing of CO2 would necessitate effective proton exchange systems). This might be particularly significant in the case of BicA, which sustains a relatively high flux rate compared to other inducible systems (20). Our new data (Fig. 5D and E) showing that the genes from the bicA operon are required for maximal HCO3-uptake activity are consistent with both ideas, and further work is needed to more fully understand the physiological functions encoded by this operon.
We examined the structure of the bicA promoter by fusing a series of upstream elements to genes encoding vibrio luciferase and by measuring the resultant Ci-responsive luciferase activity of transformants. We identified a minimal 144-bp region required for Ci-responsive expression (Fig. 6A), as well as two LysR consensus-binding sites flanking the presumptive 35 and 10 elements that, when deleted, result in derepression of the promoter at high Ci. We speculate that, at high Ci, one or more of these sites ordinarily binds CcmR, suppressing futile expression of the operon, not unlike the situation for control of the ndhF3 promoter in Synechocystis sp. strain PCC 6803 (7). We are currently exploring the nature of any physical interaction between these elements and CcmR_7002 given the strongly positive evidence obtained in the present study that there is a functional link between CcmR and bicA regulation.
Our survey of CbbR-like factors in cyanobacteria revealed several interesting relationships (Fig. 2). All genomes investigated encoded a single CbbR-like protein belonging to a highly conserved family (group 1), which may indicate an essential function such as Calvin cycle gene regulation. Consistent with this idea, group 1 contains the Synechocystis sp. strain PCC 6803 sll0998 locus, which cannot be stably inactivated (7, 15; Price, unpublished). Based on Rubisco subtype (4), and exclusively open-ocean dwelling, the "alpha" strains are not represented in the more divergent group 2. With the exception of Trichodesmium erythraeum, the "beta" strains (freshwater species and some coastal or offshore marine strains) contain one or two group 2 proteins. The group 2 genomes also encode recognizable NDH-13 complexes for high-affinity CO2 transport (4) and, with the exception of Gloeobacter violaceus, all have two or three likely high-affinity HCO3 transporters (4). Conversely, strains that do not contain genes for group 2 proteins lack the genes for a recognizable NDH-13 complex, including Trichodesmium erythraeum. Owing to a habitat typified by fluctuating Ci concentrations, we speculate that group 2 CbbR-like proteins are a habitat-specific adaptation that is related to a requirement for high-affinity CO2 transport. Intriguingly, Synechococcus sp. strain PCC 7942 has no recognizable CcmR-like protein and yet it possess functional transporters encoded by cmpABCD, sbtA, and ndhF3 ndhD3 chpY (cupA) (19). Instead, it contains a single group 2 protein, CmpR, which is believed to function as an activator of the cmp operon, which encodes a high-affinity HCO3 transporter (15). This raises questions about how the CCM is regulated in Synechococcus sp. strain PCC 7942.
In conclusion, we have shown the importance of a "derepression" mechanism for CCM regulation in a coastal/estuarine cyanobacterium. Under growth conditions in which Ci is not limiting, a single LysR transcription factor, CcmR, is essential for strong and coordinate transcriptional repression of multiple genes encoding high-affinity Ci transporters. We hypothesize that under limiting Ci, CcmR is transiently inactivated, even though the mRNA for this factor is still abundant. Further work in this species could profitably focus on the role of metabolite binding (possibly HCO3) in the regulation of CcmR activity. Our survey of CbbR-like genes in cyanobacterial genomes shows that related genes are present only in the beta cyanobacteria that likely use high-affinity CO2 transport systems. Consequently, we propose that CcmR is a habitat-specific specialization for species that exist in environments subject to widely fluctuating Ci concentrations. Given the divergence of the NdhR/CmpR subgroup of LysR factors in the beta cyanobacteria and the fact that Synechococcus sp. strain PCC 7942 encodes only a more distant form of CcmR, a species-specific approach to characterizing CCM regulation is warranted. Considering the long evolutionary history of the cyanobacteria, it should not be surprising that organisms from differing ecological niches have evolved independent solutions to the problem of optimizing their Ci acquisition systems. The differences we have uncovered in the present study between Synechococcus sp. strain PCC 7002 and the freshwater models are a case in point.
|
|
|---|
This study was supported by a Discovery Grant from the Australian Research Council to F.J.W. and G.D.P. (DP0556115) and by grants from the National Institutes of Health (GM31625) and National Science Foundation (MCB-0519743) to D.A.B.
Published ahead of print on 16 February 2007. ![]()
|
|
|---|
ccmM (Cyanophyceae) mutant pseudoreverts to air growth without regaining carboxysomes. J. Phycol. 42:769-777.[CrossRef]This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»