Previous Article | Next Article ![]()
Journal of Bacteriology, May 2008, p. 3482-3488, Vol. 190, No. 10
0021-9193/08/$08.00+0 doi:10.1128/JB.01978-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology, Cornell University, Ithaca, New York 14853-8101
Received 20 December 2007/ Accepted 4 March 2008
|
|
|---|
A promoter
200 bp upstream of yciC and a second site near the translational start point (C1). Zur binds to both of these sites to mediate strong, zinc-dependent repression of yciC. Deletion studies indicate that either Zur box is sufficient for repression, although repression by Zur bound to C2 is more efficient. Binding studies demonstrate that both sites bind Zur with high affinity. Sequence alignment of these and previously described Zur boxes suggest that Zur recognizes a more extended operator than other Fur family members. We used synthetic oligonucleotides to identify bases critical for DNA binding by Zur. Unlike Fur and PerR, which bind efficiently to sequences containing a core 7-1-7 repeat element, Zur requires a 9-1-9 inverted repeat for high-affinity binding. |
|
|---|
The B. subtilis Zur protein represses expression of at least 10 genes in response to zinc sufficiency (14, 26). Orthologs of Zur have been found in a wide range of species, including E. coli, Mycobacterium tuberculosis, Salmonella enterica, and Staphylococcus aureus (4, 20, 21, 27). In B. subtilis, the genetic response to zinc starvation includes, as expected, the derepression of a high-affinity zinc uptake system, an ABC transporter encoded by the ycdHI-yceA operon (13). Zur also represses three genes (ytiA, rpmGC, and yhzA) encoding paralogs of ribosomal proteins (26). The ytiA gene encodes an alternative form of L31 lacking zinc. L31 (encoded by rpmE) is a small, zinc-containing protein that associates with the large ribosomal subunit (23). When zinc is limiting in the cell, YtiA is expressed and displaces L31 (RpmE) from the ribosome, which is then postulated to liberate zinc for essential cellular functions (1). The RpmGC protein, encoding a zinc-free L33 paralog, is postulated to play a similar role by displacement of one or both of the other two zinc-containing L33 proteins (encoded by rpmGA and rpmGB). Finally, the Zur-regulated YhzA protein can functionally replace S14, a zinc metalloprotein required for ribosomal assembly. Expression of YhzA provides a "fail-safe" mechanism to allow continued ribosome assembly even under severe zinc limitation (24).
Recently, insights have begun to emerge into the functions of the remaining Zur-regulated genes. ZinT is postulated to function in zinc trafficking, but few details are understood. YciA represents a novel class of GTP cyclohydrolases, enzymes typically requiring a zinc metal cofactor (11). When there is insufficient zinc to support the catalytic activity of MtrA, a zinc-containing GTP cyclohydrolase essential for folate biosynthesis, derepression of YciA allows continued growth (unpublished results). YciC was originally identified as an abundant, membrane-associated protein in extracts of zur mutant cells. Early studies suggested that a yciC mutation further exacerbated the growth defect of a transporter-deficient strain under zinc limitation (13). This observation led to the speculation that this protein might play a secondary role in zinc uptake. However, protein sequence comparisons indicated that YciC has similarities with factors implicated in protein metallation reactions, suggesting that YciC may instead be involved as a metallochaperone (19). It is not yet known whether YciC functions as a zinc metallochaperone or perhaps as a chaperone for one or more other metal ions.
Here, we report a series of studies performed to define the genetic requirements for the zinc-dependent repression of yciC transcription. Although also expressed as part of the Zur-regulated yciABC operon, the bulk of yciC transcripts initiate from within the yciB-yciC intergenic region. We demonstrate that this region contains a
A-dependent promoter and two Zur boxes separated by nearly 200 bp. While either Zur box can mediate zinc-responsive repression of yciC, complete repression requires the promoter-proximal C2 box. DNA-binding studies demonstrated that Zur recognizes a minimal operator site (a 9-1-9 inverted sequence motif) that is somewhat larger than that reported for other characterized Fur family members.
|
|
|---|
C1-yciC'-cat-lacZ) and HB8542 (CU1065 SPβ 8509 PyciC
C2-yciC'-cat-lacZ) were created by cloning (see below) to investigate each Zur box individually. B. subtilis was grown in LB medium or in a defined minimal medium as previously described (14). Erythromycin (1 µg/ml) and lincomycin (25 µg/ml) (for testing macrolide-lincosamide-streptogramin B resistance), spectinomycin (Spc) (100 µg/ml), kanamycin (10 µg/ml), neomycin (10 µg/ml), and chloramphenicol (5 µg/ml) were used for selection of various B. subtilis strains. Selection of spontaneous mutants derepressed for yciC'-cat-lacZ. HB8010 was grown overnight in LB medium containing 5 µM Zn and 2 µg/ml chloramphenicol. LB medium containing 5 µM Zn(II) and 4 µg/ml chloramphenicol was inoculated using a 1:20 dilution of the culture and grown overnight. This process was repeated for LB medium containing 5 µM Zn and 7 µg/ml chloramphenicol and for LB medium containing 5 µM Zn and 10 µg/ml chloramphenicol. Phage were induced and used to transduce CU1065, which was followed by selection for the phage and screening for loss of repression. Cells were also cured of phage by incubation at 50°C overnight, followed by screening for loss of phage-linked antibiotic resistance.
Construction of mini-Tn10 libraries. To determine the possible locus of the trans-acting mutations, transposon insertion mutagenesis was used to identify mutants derepressed for yciC'-cat-lacZ expression. Libraries of random mini-Tn10 insertions in HB8010 were constructed using plasmid pIC333 (31), which contains a ColE1 origin and a thermosensitive origin of replication for gram-positive bacteria, which is inactive at temperatures above 35°C. HB8010 was transformed with pIC333, and transformants were selected for Spc resistance on LB medium plates incubated at 30°C overnight. Single colonies were inoculated onto plates containing LB medium with erythromycin, MLS, and Spc and grown overnight at 30°C. Five microliters of LB medium containing MLS and Spc was inoculated using a 1:100 dilution of the overnight culture, and the resulting culture was incubated for 3 h at 30°C and then for 4 h at 37°C. Dilutions (1:500) of this culture were plated on LB medium and LB medium containing Spc. Frozen permanent stocks were made from approximately 20% of the remaining culture, while 10% was plated on medium containing chloramphenicol to select for the derepression of yciC'-cat-lacZ. The transposition frequency was estimated from the ratio of colonies on selective medium to colonies on nonselective medium and was consistent with the frequency (0.01 to 1%) reported for this system.
Isolation of mini-Tn10 insertions that derepress yciC'-cat-lacZ. Chromosomal DNA was prepared from derepressed mutants and transformed into strain HB8010 with selection for Spc resistance. Transformants were screened for derepression to determine if the phenotype was linked to the transposon insertion. After verification of linkage, DNA from the derepressed strains was recovered by plasmid rescue. Restriction analysis suggested that some plasmids were identical, but five unique plasmids were further characterized by sequencing.
Construction of a strain merodiploid for zur. HB8519 was constructed using the pXT system, which allows integration by double crossover at the thrC locus of the B. subtilis chromosome. The pXT plasmid is a derivative of pDG1731 (10), which fuses a xylose-inducible promoter to the gene of interest. Strains were selected for Spcr and screened for MLSs and threonine auxotrophy. A primer located upstream of the putative ribosome-binding site (underlined) and containing an engineered BamHI site (bold type) (5' GTTCGGATCCAAAGCGAAAAGGGGG 3') was used in conjunction with a primer located downstream of a putative hairpin terminator (5' CGCGTGAATTCCTGAAAAAGGAGCCC 3') with an engineered EcoRI site (bold type) to amplify zur with Pfu polymerase. The resulting PCR product was digested with BamHI and EcoRI and cloned into pXT (10) digested with the same enzymes. The resulting plasmid was linearized with ScaI and used to transform competent HB1000 cells. The resulting strain (HB8520) was transduced with SPβ-8008 (yciC'-cat-lacZ).
Selection for derepressed mutants in a zur merodiploid strain. Selection and screening for derepressed mutants in the merodiploid zur strain were carried out on LB medium plates containing 10 µM Zn, 40 µg/ml X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside), 20 mM xylose, and increasing concentrations of chloramphenicol (2, 4, 6, 8, and 10 µg/ml). Four phage-linked mutants were isolated that were derepressed for yciC'-cat-lacZ expression. Chromosomal DNA was isolated from these strains and used as a template for PCR with primers 533 and 366. The resulting PCR products were characterized by sequencing using the 533 forward primer (GTACATATTGTCGTTAGAAC) located upstream of the multiple-cloning site in pJPM122 (30) and the 366 reverse primer (ACTCTCCGTCGCTATTGTAACCAG) located in cat gene of pJPM122.
Construction of C1- and C2-cat-lacZ fusions. Primer 240 (5' CTGAAGCTTCCAGATGCGAAATGGGTATA 3') and primer C2rev (5' GGCTTATCATTGTCTGTGGATCCGTG 3') were used to clone a fragment containing only the C2 box and associated promoter into pJPM122 to make promoter-cat-lacZ fusions in the SPβ phage. Primer C1for (5' TTTAAAGCTTTAGAAATCGGGCGG 3') and primer 241 (5' AAAACAACATTGCTGAAGACGATTGGATCCG 3') were used to clone a fragment containing the previously proposed promoter elements and C1 box into pJPM122. These constructions were used to test β-galactosidase activity.
Construction of deletions of C1 or C2 in the full-length yciC promoter. Primer delC1rev (5' AAACTGCAGACTTCGCCGTATGTACAATGG 3') containing a PstI site (bold type) to replace part of C1 and primer 240 were used to amplify chromosomal DNA. Primer delC1for (5' AAACTGCAGGCACTATTATGAAAAAAATTC 3') and primer 241 also containing a PstI site were used to amplify chromosomal DNA. The two resulting products were digested with PstI and ligated together. The 450-bp fragment was gel purified (Qiagen) and digested with HindIII and BamHI. The product was purified (Qiagen) and ligated to pJPM122 cut with the same enzymes to construct promoter-cat-lacZ fusions. The same process was used to create the C2 deletion using primer 240 with primer delC2rev (5' AAACTGCAGTACGACTTAAATTGTCTTTTTTCC 3') and primer delC2for (5' AAACTGCAGTGGCTTATCATTGTCTGTGCA 3') with primer 241.
β-Galactosidase assays. Zinc deficiency was achieved as described previously (13). The cultures were grown overnight, and cells were harvested to assay β-galactosidase activity as described elsewhere (5, 22).
Protein purification. B. subtilis Zur protein was expressed in E. coli BL21(DE3)/pLysS (13). For purification of Zur, a single colony was grown overnight in LB medium containing ampicillin (200 µg/ml) and 0.4% (wt/vol) glucose. The overnight culture was used to inoculate 500 ml LB medium containing ampicillin (200 µg/ml) and 0.4% (wt/vol) glucose, and the flask was incubated at 37°C with vigorous shaking to obtain an optical density at 600 nm of 0.8. Isopropyl-β-D-thiogalactopyranoside (final concentration, 1 mM) and zinc (final concentration, 50 µM) were added, and cells continued to grow at 30°C. The addition of zinc and the temperature shift significantly increased the soluble portion of Zur. The cells were harvested after further incubation for 4 h. Cells were harvested by centrifugation at 10,000 rpm for 5 min at 4°C, and the pellet was stored at –80°C until it was used. The cell pellet was thawed on ice for 30 min and suspended in 10 ml resuspension solution (50 mM Tris-Cl [pH 8.0], 2 mM EDTA [pH 8.0], 0.1 mM dithiothreitol, 1 mM β-mercaptoethanol, 100 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 5% glycerol), and the cells were broken by sonication. The lysate was clarified by centrifugation at 10,000 rpm for 5 min at 4°C and applied to a heparin column. Bound proteins were eluted with gradient of NaCl (0.05 to 1 M) in elution buffer (50 mM Tris-Cl [pH 8.0], 2 mM EDTA, 0.1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 5% glycerol). Samples were loaded onto a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel to identify the fractions that contained Zur. Proteins were then loaded onto a Bio-Rad Q2 ion-exchange column via fast protein liquid chromatography (Pharmacia). A linear gradient of 0.05 to 1 M NaCl was used to elute the protein, and then the peak fractions were injected into a Superdex 200 column (Pharmacia). Purified Zur was stored at –20°C in buffer A (20 mM Tris-Cl [pH 8.0], 1 mM dithiothreitol, 5% glycerol) containing 50% glycerol.
EMSA of Zur binding.
PCR fragments containing the full yciC promoter region, the C1 Zur box, the C2 Zur box, the D1.5 deletion, or the D2.1 deletion were purified from an agarose gel and used in electrophoretic mobility shift assay (EMSA) experiments as previously described (13). Synthetic oligonucleotides were synthesized (Integrated DNA Technologies Incorporated), and 30 fmol was end labeled with [
-32P]ATP. After labeling and removal of the unincorporated label, 30 fmol of the complementary oligonucleotide was added and annealed by incubation at 95°C for 10 min, followed by transfer to room temperature. Duplex oligonucleotide probes were incubated with Zur and run on a 12% polyacrylamide gel for 45 min at 100 V. Kd (dissociation constant) values for the full-length probes were determined by quantifying the disappearance of the free probe using the program ImageQuant. Percent shift was plotted versus protein concentration, and Kd was defined as the concentration of protein required to shift 50% of the DNA probe. For the oligonucleotide studies, relative Kd values were approximated by the appearance of the shifted complex due to the amount of background caused by the unshifted single-stranded probe.
Primer extension analysis. Total RNA was isolated from wild-type or zur mutant cells using an RNeasy RNA isolation kit (Qiagen). For primer extension analysis, 100 µg of total RNA was precipitated with 4 pmol of end-labeled reverse primer, and the reverse transcripts were generated as described previously (15, 16). Reverse transcripts were analyzed by 8 M urea-6% polyacrylamide gel electrophoresis. The PCR product was sequenced using the same primer to index the reverse transcripts.
5' RACE. Total RNA was isolated from mid-exponential growing zur mutant cells using an RNeasy RNA isolation kit (Qiagen). Two micrograms of isolated RNA was used with a 5' random amplification of cDNA ends (RACE) kit (Invitrogen) according to the manufacturer's protocol. Products were sequenced at the Cornell Biotechnology Resource Center.
Sequence logo creation. The Zur box sequence logo was created by alignment of the eight known Zur regulon members of B. subtilis and three orthologous genes from Bacillus amyloliquefaciens and from Oceanobacillus iheyensis. The ClustalW alignment was entered into the http://weblogo.berkeley.edu/ website to create the logo (29).
Nucleotide sequence corrections. We identified a single amino acid difference in B. subtilis 168 strains relative to the previously reported zur sequence (17). The change is in codon 12, from GGA (Gly) to GAA (Glu). This difference is consistent with the conservation of a negatively charged amino acid at this position in other Zur homologs.
|
|
|---|
A-type promoter (13). Since the sequence requirements for DNA binding by Zur are not well characterized, we initially considered a genetic approach to define critical components of the Zur box. In analogous studies, we selected for chloramphenicol resistance using an mrgA'-cat-lacZ reporter fusion and identified point mutations and small deletions that defined important bases within the Per box element (6). We reasoned that a similar genetic approach, using a yciC'-cat-lacZ reporter fusion (see Materials and Methods), might identify bases within the Zur box critical for recognition by the Zur protein. In an initial study, we selected spontaneous mutants that were derepressed for yciC'-cat-lacZ expression. Since the yciC'-cat-lacZ reporter is carried on the SPβ prophage, cis-acting mutations are easily identified by virtue of being linked to the phage DNA in transduction experiments. Our initial studies failed to identify any cis-acting mutations. In contrast, we found that eight strains cured of phage were still derepressed when a yciC'-cat-lacZ fusion was reintroduced, consistent with the presence of a trans-acting mutation. When the selection was repeated with mini-Tn10 mutagenesis using plasmid pIC333 (31), all sequenced transposants had insertions within the zur gene.
To significantly reduce the frequency with which zur mutants were recovered, a merodiploid zur strain was created. Using this strain, two unique cis-acting mutations were obtained, and both contained large deletions (deletion mutants 1 and 2) (Fig. 1C). Surprisingly, these deletions included both the Zur box and the previously proposed promoter (13). These findings led to the discovery of a second candidate
A promoter and a second potential Zur box element in the yciB-yciC intergenic region. In retrospect, the deletion mutations removed both of the Zur box elements, thereby placing the upstream yciC promoter region adjacent to the cat-lacZ reporter fusion.
![]() View larger version (31K): [in a new window] |
FIG. 1. (A) yciABC complex operon. Open reading frames are indicated by open arrows, promoter sites are indicated by bent arrows, and Zur boxes are indicated by filled ellipses. (B) Primer extension mapping of the transcription start site of yciC. The primer extension product was generated using RNA isolated from either wild-type (WT) or zur mutant cells grown in LB medium. The sequence ladder was generated by PCR cycle sequencing with the same primer. (C) Partial sequence of the intergenic region between yciB and yciC. On the left are 11 bases not shown to the stop codon of yciB and 170 bases between the box C2 and C1 regions. Single arrowheads frame the bases missing in deletion mutant 1 (276 bases), and double arrowheads frame the missing bases in deletion mutant 2 (246 bases). Solid bars indicate the area which was deleted to create strains possessing only one functional Zur box, C1 (deletion of 29 bases) and C2 (deletion of 21 bases). The ribosome-binding site and transcription start site are indicated by bold type, while the –10 and –35 promoter elements are underlined and in italics. The originally proposed promoter for yciC in the downstream region is italicized. The start codon (ATG) for yciC is indicated by a bent arrow.
|
85% of the yciC-hybidizing transcripts initiated from within the yciB-yciC intergenic region, while a small fraction corresponded to read-through transcription from the upstream yciA promoter (and hybridized with a yciA probe) (data not shown). In light of our genetic results, we hypothesized that the abundant monocistronic yciC transcript initiated from the candidate promoter 260 bp upstream of the yciC start codon. Indeed, a strong transcript from this promoter was detected by primer extension analysis when RNA extracted from the zur mutant was used but not when RNA extracted from wild-type cells was used (Fig. 1B). To determine if there was any transcription from the downstream promoterlike sequence, nested primers were used to probe for a transcription start site using 5' RACE experiments. The only strong and reproducible start site observed in numerous 5' RACE experiments corresponded to initiation from the G residue at the upstream promoter, consistent with the primer extension results. There are no conserved open reading frames within this leader region, and we therefore suggest that the yciC gene is expressed with an unusually long 5' untranslated region. This leader region contains both the originally noted Zur box (designated C1) and the upstream promoter-proximal Zur box (C2). Note that in our previous description of the Zur regulon we included the correct yciC promoter based on the data presented here (14).
Both the C1 and C2 Zur boxes mediate zinc responsiveness. The selection of deletion mutations removing most or all of the C1 and C2 Zur boxes suggested that removal of both sites was necessary to bypass Zur-mediated repression. As predicted, the deletion mutants displayed full promoter activity (as judged by lacZ fusion assays), and this activity was not repressible by added zinc (data not shown). Moreover, purified Zur was unable to bind to DNA fragments derived from the yciB-yciC intergenic regions carrying the large deletions as judged by EMSA experiments using up to 400 nM added Zur (data not shown). Together, these results suggest that inactivation or deletion of either box alone was not sufficient for derepression of yciC and therefore for the generation of chloramphenicol resistance under our selection conditions.
To assess the relative contributions of the C1 and C2 Zur boxes to Zur-mediated repression of yciC, we generated strains in which one of the boxes was individually inactivated. The first construct (designated
C2) contained the downstream box (C1 box) along with a deletion spanning over one-half of the upstream box (C2 box) while the –10 region and sequences spanning the transcription start site of the upstream promoter were left intact. In the second construct (designated
C1) the C1 box was removed (Fig. 1C). When analyzed in the context of lacZ reporter fusions, the three constructs all responded to added zinc, but with different efficiencies (Fig. 2). Both the wild-type and
C1 constructs show full repression with
1 µM added zinc. However, the overall promoter activity (as judged by Miller units) was decreased by 75% in the
C1 construct for reasons not yet clear. The
C2 construct was impaired in zinc-responsive repression, with only a 90% reduction in β-galactosidase activity in the presence of 1 µM zinc. Full repression of the yciC promoter was not obtained even with 10 µM added zinc. Interestingly, the promoter activity of the
C2 construct was at wild-type levels (as judged by Miller units), and the level of added zinc where repression was first observed matched that of the wild-type and
C1 constructs. It should be noted that the difference in promoter activity of the constructs may be due to effects on RNA stability since both constructs contain the wild-type ribosome-binding site and
A promoter elements.
![]() View larger version (16K): [in a new window] |
FIG. 2. Zinc-dependent repression mediated by the C1 and C2 Zur boxes of yciC. The promoter activity of the wild-type (WT) yciC promoter is compared with that of fusion constructs containing either C1 or C2 as a function of added zinc. The data shown are representative of experiments performed in at least five independent trials, each time using biological triplicate preparations for each point.
|
![]() View larger version (79K): [in a new window] |
FIG. 3. Binding of Zur to the yciC regulatory region. EMSA experiments with labeled PCR probes containing each of the yciC promoter constructs were used to measure Zur binding affinity. The concentrations of Zur (in nM) in the reaction mixtures are indicated above the lanes. The wild-type (wt) promoter fragment has a binding affinity in the range previously reported (Kd, 5 nM) (14). Deletion of the upstream C2 box decreases the Zur affinity only slightly, and deletion of the downstream C1 box decreases the affinity 2-fold compared to the wild type.
|
Several possible models could account for the role of these two Zur boxes in repression. We currently favor the hypothesis that Zur binds at both sites and each site can function independently. In this model we envision that the upstream site accounts for the bulk of the repression, but any RNA polymerase that initiates transcription is ultimately impeded in elongation by Zur bound at the downstream C1 site. The ability of the C1 site to mediate partial repression is apparent from analysis of the
C2 construct. In this construct, elongating RNA polymerases presumably stall upon encountering Zur bound at C1, and some or all of them may be dissociated by the action of Mfd (28). However, transient dissociation of Zur or displacement by elongating RNA polymerase may still allow significant expression of yciC. Alternatively, some Fur proteins are known to polymerize on DNA to create extended arrays of bound repressor (18), and it is possible that this also occurs between the C1 and C2 sites. We do not favor this idea, however, since Zur has not been observed to polymerize on DNA and our EMSA results did not show evidence for high-molecular-weight complexes. Finally, it is possible that sites C1 and C2 function cooperatively. While the EMSA results do suggest that the wild-type construct has a slightly higher affinity for Zur than either box alone, the in vivo data show that the C2 box is sufficient for full repression. Thus, if there is cooperativity in this system, it is modest and not critical for mediating repression.
Zur binds to a conserved 9-1-9 inverted repeat. We previously reported that Zur binds to DNA sites with similarity to those recognized by two other Fur paralogs, Fur and PerR (14). The Zur box differs from the Fur and Per boxes at positions 5 and 6 within each half-site and also displays conservation of bases at flanking positions not strongly conserved in Fur and Per boxes (12) (Fig. 4A, positions 8, 9, and 10). Indeed, sequence searches using this conserved motif have been useful in providing insights into the Zur regulon in many different bacterial systems (26).
![]() View larger version (62K): [in a new window] |
FIG. 4. DNA sequence requirements for Zur-DNA binding. (A) Sequence logo illustrating conservation of bases within aligned Zur box sequences. (B) Representative EMSA experiments with duplex oligonucleotides and added Zur protein (0, 5, 20, 80, and 320 nM). Only the oligonucleotides where shifts were observed are shown. All shifts were done in the presence of 50 µM added zinc. The Kd (Table 1) was estimated to be the concentration of Zur at which half-maximal binding was observed.
|
100 nM). We note that the affinity measured for the C1 and C2 Zur boxes within these duplex oligonucleotides is less than that measured with larger DNA fragments, suggesting that flanking regions also contribute to the observed binding affinity. Nevertheless, in both experiments, the C1 and C2 boxes were found to have similar affinities for Zur. |
View this table: [in a new window] |
TABLE 1. Site-directed B. subtilis Zur box mutants
|
When the sequences of the C1 and C2 boxes are considered in light of these binding studies, it is apparent that neither site is optimal. Both sites contain multiple mismatches that likely account for their reduced affinity relative to the consensus sequence. Since we do not have a complete set of all possible single mutations, it is not possible to infer if some substitutions are more favorable than others. It is interesting to note, however, that the C1 box still contains one perfect half-site and that the C2 box contains one half-site with only one change from the consensus sequence.
Concluding remarks. We began this work with the intent of using genetic selection to identify bases critical for the Zur-mediated repression of yciC and with the expectation that this might provide insights into the Zur-operator DNA interaction. Unexpectedly, the yciC gene was found to be regulated by two Zur boxes (C1 and C2). As a result, derepression of this locus requires large deletions spanning both Zur boxes. Together, these two sites allow for very tight repression of yciC, which encodes a very abundant protein postulated to function as a metallochaperone. The significance of the long, untranslated leader region preceding yciC is not clear. Metal-responsive riboswitches have recently been described (8), so it is formally possible that this region could function in sensing zinc or a zinc complex within the cell. However, this seems unlikely since we did not detect any zinc responsiveness for a yciC-lacZ fusion in a zur mutant strain and neither the sequence nor structure of this intergenic region is conserved in other bacilli. In many related gram-positive bacteria, the yciA and yciC genes are clustered, but there is no obvious yciB homolog. The functions of the yciC and yciB genes clearly require additional study.
Next, we turned to DNA-binding (EMSA) studies using synthetic duplex oligonucleotides to define the critical determinants of the Zur-DNA interaction. Our results confirm the roles of the conserved bases within the Zur box and demonstrate that a 9-1-9 inverted repeat provides the minimum site needed for high-affinity binding. This contrasts with the related results for B. subtilis Fur and PerR (2, 12). To date, there are no structures available for protein-DNA complexes for proteins of the Fur family, so the structural basis for the fine-tuning of protein-DNA specificity is not yet clear.
Published ahead of print on 14 March 2008. ![]()
|
|
|---|
X protein is an extracytoplasmic function
factor contributing to survival at high temperature. J. Bacteriol. 179:2915-2921.This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»