Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ravin, N. V. Articles by Lane, D. Search for Related Content PubMed PubMed Citation Articles by Ravin, N. V. Articles by Lane, D.

 Previous Article  |  Next Article 

Journal of Bacteriology, May 2008, p. 3538-3545, Vol. 190, No. 10
0021-9193/08/$08.00+0     doi:10.1128/JB.01993-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Extended Function of Plasmid Partition Genes: the Sop System of Linear Phage-Plasmid N15 Facilitates Late Gene Expression

Nikolai V. Ravin,¹ Jérôme Rech,² and David Lane^2*

Centre Bioengineering, Russian Academy of Sciences, 7-1 Prosp. 60 let Oktiabria, Moscow, 117312 Russia,¹ Laboratoire de Microbiologie et Génétique Moléculaires, CNRS UMR5100, Campus Paul Sabatier, 118 route de Narbonne, 31062 Toulouse, France²

Received 21 December 2007/ Accepted 10 March 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The mitotic stability of the linear plasmid-prophage N15 of Escherichia coli depends on a partition system closely related to that of the F plasmid SopABC. The two Sop systems are distinguished mainly by the arrangement of their centromeric SopB-binding sites, clustered in F (sopC) and dispersed in N15 (IR1 to IR4). Because two of the N15 inverted repeat (IR) sites are located close to elements presumed (by analogy with phage ) to regulate late gene expression during the lytic growth of N15, we asked whether Sop partition functions play a role in this process. In N15, a putative Q antiterminator gene is located 6 kb upstream of the probable major late promoter and two intrinsic terminator-like sequences, in contrast to , where the Q gene is adjacent to the late promoter. Northern hybridization and lacZ reporter activity confirmed the identity of the N15 late promoter (p52), demonstrated antiterminator activity of the Q analogue, and located terminator sequences between p52 and the first open reading frame. Following prophage induction, N15 mutated in IR2 (downstream from gene Q) or IR3 (upstream of p52) showed a pronounced delay in lysis relative to that for wild-type N15. Expression of ir3^–-p52::lacZ during N15 wild-type lytic growth was strongly reduced relative to the equivalent ir3⁺ fusion. The provision of Q protein and the IR2 and SopAB proteins in trans to ir3⁺-p52::lacZ increased expression beyond that seen in the absence of any one of these factors. These results indicate that the N15 Sop system has a dual role: partition and regulation of late gene transcription during lytic growth.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The genetic determinants that govern the active partition of low-copy-number plasmids are generally devoted to that function alone. The deletion of sopABC, parABS, or parMRC from F, P1, and R1 miniplasmids (to cite well-studied cases) results in no immediate phenotype except the instability of their plasmids (1, 11, 26). We have found that the partition functions of phage N15, which are closely related to the well-known SopABC system of plasmid F (14, 28), exercise a distinct regulatory activity unrelated to plasmid maintenance. The activity is the subject of this paper.

N15 is a temperate coliphage with sequence, structural, and physiological similarities to lambdoid phages. But unlike , which integrates, the N15 prophage is a linear plasmid with covalently closed ends (33, 38; for a review, see reference 29), a property it shares with two more recently described plasmids, pY54 of Yersinia enterocolitica (16) and KO2 of Klebsiella oxytoca (7), as well as with the linear replicons of Borrelia burgdorferi (17) and one of the two chromosomes of Agrobacterium tumefaciens (12). The prophage state is maintained by a lambda-like primary immunity system (24). The repressor gene, cB (Fig. 1), is flanked by operators (not shown), both leftward, upstream of the replication gene (repA), and rightward, within a promoter region that controls the expression of gene 39, homologous to cro, and gene 40, homologous to that of the antiterminator of late gene transcription, Q. Further rightward is a putative late promoter upstream of an operon encoding lambdoid phage-like lysis and virion proteins. Sequences resembling Rho-independent terminators are located between the promoter and the first gene, an arrangement characteristic of late promoters regulated by Q-mediated antitermination (34). Like , N15 prophage is induced as part of the SOS response, although the mechanism, inactivation by an induced antirepressor rather than by RecA-mediated autocleavage, appears to differ (25, 31).

View larger version (38K): [in this window] [in a new window]

FIG. 1. N15 late operon control region. The major elements of the linear N15 prophage-plasmid are shown, approximately to scale, at the top. Genes are numbered (above) or named along with IR centromere sites (below). Two regions relevant to late gene expression are expanded to display their details. Four p52-lacZ fusions integrated into the chromosome in strains NR427 to 430 are shown schematically. The p52 late promoter region is shown in nucleotide sequence detail at the bottom. Inverted repeats T1 and T2 are predicted intrinsic terminators; Tapp is a terminator suggested by the experiment of Fig. 2. The double underlined sequence is the complement of the 52-RNA5' oligonucleotide used as a probe for Northern hybridization (Fig. 2A). SD, Shine-Dalgarno motif.

Mitotic stability (partition) of N15 prophage depends on multiple inverted repeats (IR) similar in sequence to the sopC centromere sites of F, a SopB protein which binds to them to create a partition complex, and a Walker-box ATPase, SopA, needed for segregating N15 molecules carrying the partition complexes into the daughter cells-to-be (28). The N15 proteins also resemble those of F in acting as autoregulators of their own sopAB operon, with SopA as the primary repressor and SopB as the corepressor (30). However, the N15 centromere elements (IR1 to IR4) differ from those of circular bacterial replicons in that rather than constituting a tandem array adjacent to their operon, like sopC, they occupy distinct sites close to elements which potentially regulate lytic development (14, 28). In particular, IR2 is situated 193 bp downstream of the putative Q gene, and IR3 is 23 bp upstream of a probable late promoter, p52, from which the lysis gene operon would be transcribed (Fig. 1). The location of the IRs suggests that the N15 Sop system could do double duty as a regulator of lytic development and as an executor of plasmid partition.

Before pursuing this idea, we considered it necessary to settle the uncertain status of the putative late gene expression control elements, until now assigned only by analogy and homology. N15 and lambdoid phages appear to differ significantly with respect to late gene regulation. First, N15 has no analogue of the N antitermination system. Second, the putative Q gene of N15 overlaps the putative cro gene, while in lambdoid phages the Q gene is typically 5 to10 kb downstream of cro, at the distal end of the early right operon; this position plays a role in the timing of late gene expression. Third, although gene 40 mutants behave like Q mutants, lysogenizing but failing to grow lytically (35), the transcription of gene 40 appears incompatible with the role of late gene regulator. It is almost as strong from the prophage as during lytic growth, even though transcription of the late prophage operon(s) from gene 52 on is weak or undetectable (32). Thus, the functional equivalence of N15 gene 40 and the Q genes of lambdoid phages was unclear.

We addressed this issue as well as the question of whether the IR sites and the complexes formed on them by the binding of SopB intervene in late gene expression and so influence lytic development. In this paper, we present evidence that the gene 40 product and elements upstream of gene 52 do indeed act as expected for late gene regulators and that the Sop partition system facilitates their action. The N15 Sop system is thus bifunctional.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bacterial strains, media, and growth conditions. The lacZ strain of Escherichia coli K12, MC1061 (6), was the host for reporter gene experiments and for phage N15 propagation, and strain DH10B (13) was the recipient for cloning experiments. Bacteria were grown in LB broth (22) or on LB agar at 37 C°, supplemented as appropriate with ampicillin (final concentration,100 µg/ml), chloramphenicol (20 µg/ml), kanamycin (50 µg/ml), and arabinose (0.1%).

Bacteriophages and plasmids. Bacteriophage N15 was described by Ravin and Shulga (33). N15 coordinates are based on the complete sequence (GenBank accession number, AF064539). Bacteriophage N15ir3 was obtained by cleaving circularized N15 prophage DNA at its unique NcoI site in IR3, filling it with Klenow polymerase, and recircularizing it with DNA ligase. N15ir2 was obtained by recombineering (9). MC1061 N15⁺ cells carrying pKD46 (8) were induced to produce -red recombinase by growth in LB with 0.2% arabinose, washed, electroporated with oligonucleotide IR2mut (complementary to the lagging strand at IR2), diluted, and plated on LB agar. Eleven of 230 colonies screened by PCR using primers IR2mutscr and Q15-1 tested positive; two of these were sequenced and one was confirmed to be the expected N15ir2 mutant. The mutation does not alter the coding properties of a hypothetical open reading frame, g40.1, in which IR2 lies.

Plasmids for expression of N15 genes. sopAB was constitutively expressed from pDAG216 and pDAG242, and sopB from pDAG434 (28, 30). CB repressor and AntA antirepressor were produced from pCA15 and pCA12, respectively (31). A Q antiterminator production plasmid, pBAD-Q, was constructed by inserting N15 g40 DNA, amplified using primers Q-L and Q-R, between the EcoRI and HindIII sites of expression vector pBAD24 (15). Expression of cB, anta, and g40 was induced by the addition of arabinose to 0.1%.

Promoter-lacZ reporter plasmids. Fragments of N15 comprising IR3 and the presumed p52 promoter as well as various potential terminators were amplified from N15 DNA using the upstream oligonucleotide IR3L-1 and the downstream oligonucleotides IR3L-2, IR3L-4, and IR3L-3. The fragment ends were cleaved with EcoRI and BamHI and inserted between the corresponding sites upstream of lacZ in the transcription reporter vector pRS551 (36) to yield plasmids pNR251 (N15 nucleotides [nt] 41084 to 41230; no terminator), pNR253 (nt 41084 to 41265; T1), and pNR252 (nt 41084 to 41410; T1, T2, and g52 codons 1 to 8). pNR254 is the equivalent of pNR252 derived from N15ir3. The p52::lacZ fusions were transferred by recombination and lysogenization to the att site of MC1061, using RS88 (36), to yield strains NR427, NR429, NR428, and NR430.

From pRS551, these pNR plasmids inherit a terminator, trpt, just upstream of lacZ. Derivatives of NR251, NR252, and NR253 with an RNase III cleavage site in place of trpt were made by replacing their BamHI-SacI (trpt-lacZ') fragments with the equivalent fragment of pTL61T (23) to form pNR325, pNR326, and pNR327, respectively. The corresponding RS88 lysogens are DLT2450, DLT2451, and DLT2452.

Enzymes and oligonucleotides. DNA polymerase I Klenow fragment T4 DNA ligase, T4 polynucleotide kinase (New England BioLabs), restriction enzymes (Promega, New England BioLabs, Fermentas, SibEnzyme), and RNase-free DNase (amplification grade; Sigma) were used according to the manufacturers' recommendations. PCR amplification was carried out using DNA polymerase Pfu (Promega) or Phusion (Finnzymes) and oligonucleotides (5' to 3') as follows: IR3L-1, CGGAATTCTCACTAACAAACGAGTATG; IR3L-2, CGGGATCCGTTATTCGGAAGTCAGGCG; IR3L-3, CGGGATCCATTGATTTGTGTAGT; IR3L-4, CGGGATCCCACTTTTTCAGGCACA; Q-L, TGGAATTCACAATGGAACTAAATAGCATTCG; Q-R, CCCAAGCTTATCTGGTTTCCTGAGCATAACC; IR2mut (mutations are in bold; IR2 sequences are underlined), GGCCTTGCTTAAATGGAGTATTCTTCATTATCTCATGGCTTCGTGGCCGAACCCTCTTTGATTTCCAGATAACGTTTGAGCCAGA; IR2mutscr, GGAGTATTCTTCATTATCTCATGGCTT; 52-RNA5', ATTCGGAAGTCAGGCGTAAAAATCCCAACT; Q15-1, CTGCATGATTCGGATATTGATGGA; Q15-2, GCATAACCTGCTGACACAGGCAGGT; GALE1, ATGAGAGTTCTGGTTACCGGT; and GALE2, GGGCTGATCGCCATAAACGGT.

p52 activity-lacZ reporter transcription. Cultures of strains harboring p52::lacZ fusions were maintained for 6 generations in exponential growth or treated to induce N15 prophage (see Fig. 3) and then sampled for β-galactosidase assays as described previously (21).

View larger version (20K): [in this window] [in a new window]

FIG. 3. Transcription from p52 during lytic development. Exponentially growing cultures of NR427, 428, and 430 derivatives carrying N15 and the antirepressor plasmid pCA12 were treated with arabinose to induce the prophage and sampled for β-galactosidase assays at intervals until lysis. The presence of terminators (t+) and IR3 (ir3+) in the lacZ fusions is indicated in parentheses.

Northern analysis. RNA was extracted from culture samples taken into ethanol-phenol (37) by the hot-phenol method (2) and further purified by digestion with RNase-free DNase (Sigma; amplification grade). Twenty micrograms of each RNA was fractionated by denaturing 6% polyacrylamide gel electrophoresis and electroblotted to Hybond N⁺ membranes (Amersham). Blotted RNAs were prehybridized in 0.5 M Na-phosphate (pH 7.0), 7% sodium dodecyl sulfate, 1 mM Na₃-EDTA, and 100 µg/ml denatured herring sperm DNA prior to the addition of 20 pmol of 5'-³²P-labeled oligonucleotide 52-RNA5' (3 x 10⁶ dpm/pmol) and further incubation for 4 h. After being washed at room temperature (final solution, 0.03 M Na-phosphate-0.1% sodium dodecyl sulfate), the membranes were exposed to phosphorimager screens, and the images were processed with MultiGauge software (Fujifilm).

Q mRNA: slot blot hybridization. RNAs prepared as above were denatured and applied to Hybond N⁺ membranes by standard methods, using a slot blot apparatus (5 µg per slot). The membranes were incubated and treated essentially as above, with hybridization probes consisting of DNA fragments amplified from pBAD-Q and E. coli chromosomal DNA, using Q15-1/2 and GALE1/2, respectively, and ³²P-labeled using a random priming kit (MegaPrime; New England BioLabs).

Western blot analysis. SopA protein was detected as described previously (28), except that the transfer buffer was Tris-glycine and the antibody was a polyclonal antiserum (kindly provided by S. Hiraga) to allow normalization using cross-reacting E. coli proteins.

N15 one-step growth curves. Exponential cultures of MC1061 N15 lysogens carrying pCA12 were treated with arabinose (final concentration, 0.4%) to induce prophage (time zero). At intervals, one 10-µl sample was added to 1 ml ice-cold 20 mM MgSO₄ and plated directly (after appropriate dilution) to estimate the number of PFUs, and a second was added to 1 ml 20 mM MgSO₄, 0.1 mg/ml lysozyme, and 5 mM KCN, incubated 5 min at 37°C, vortexed briefly with 50 µl CHCl₃, and plated to estimate the number of intracellular PFU. Plating was done in 0.6% agar-LB on LB agar, using MC1061 as the indicator.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Initiation and premature termination of transcription upstream of gene 52. To ascertain whether the putative promoter and terminators shown in Fig. 1 act as such in vivo we first performed Northern blot hybridization of total RNA purified from cultures of an induced N15 lysogen. Hybridization with a ³²P-labeled oligonucleotide complementary to the first 30 nt of the presumed transcript (Fig. 2A) revealed two small RNA species. They were first detected 20 min after induction and increased to a constant level by 30 min. The shorter species, at 53 nt, is just the length expected for initiation at the presumed promoter and termination within the U run that follows the T1 inverted repeat. The larger one, at 100 nt, was shorter than the 165-nt species expected for termination at T2. It could indicate termination at an imperfect inverted repeat sequence, which we dubbed T_app (Fig. 1), although this repeat does not precede a U run characteristic of intrinsic terminators; processing of a longer transcript has not been ruled out as the source of the 100 nt species.

View larger version (43K): [in this window] [in a new window]

FIG. 2. Termination of transcription initiated at p52. (A) Hybridization of a 32P-labeled oligodeoxyonucleotide representing the 5' end of p52-initiated mRNA to a Northern blot of total RNA extracted at the times (min') shown after induction of MC1061 (N15+) pCA12 and from exponentially growing cultures of MC1061 carrying plasmids pRS551 (–) and pNR251, 252, and 253. The markers are 32P-end-labeled HinfI fragments of X174 DNA. (B) Specific activity of β-galactosidase in exponentially growing cultures of MC1061 derivatives that carry the p52-terminator-lacZ fusions of pNR251, 252, 253, and 254 (open bars), and of pNR325, 326, and 327 (shaded bars) integrated at att. The values shown are normalized to those of NR427 (1,740 Miller units) and DLT2450 (7,920 units), which do not include the putative terminator sequences.

To facilitate further analysis, we made transcriptional reporters consisting of the IR3 centromere site, the presumed p52 –35 and –10 motifs, and various stretches of downstream N15 DNA fused to lacZ on a pBR322-based vector (Fig. 1). RNA extracted from cells carrying these plasmids contained a short species that comigrated with the 53-nt transcript seen in the induced lysogen when the T1 element was present on the plasmid (pNR252, pNR253) but not when it was absent (pNR251), consistent with the promoter and terminator functions assigned above. Termination further downstream was barely perceptible, whether T_app was present (pNR252) or not (pNR253). Termination at T1 might have reduced the level of longer transcripts below the detection threshold. The strong band in the pNR251 sample, migrating just ahead of the 100-nt species, is probably an artifact: it is of just the size expected for a transcript stopped at the weak trpt terminator upstream of lacZ in the pRS551 vector (23). Although this terminator is also present in pNR252 and 253, no corresponding RNA species was seen in these samples, again possibly because the N15 terminators limit its production to below the detection threshold.

The Northern transfer technique used here was not suited to the detection of species longer than 1-kb expected to result from antitermination of some fraction of the transcripts made from N15 and the lacZ reporter plasmids. To clarify and quantitate termination in the p52 region, we integrated the four reporter constructs (Fig. 1) into the chromosome, yielding strains NR427, NR428, NR429, and NR430. The steady-state β-galactosidase activity in exponentially growing cells of the resulting strains was measured (Fig. 2B). Transcription from p52 in the reporter strains clearly shows the effect of sequences containing the putative terminators. In NR429, T1 alone reduces β-galactosidase production sevenfold, and inclusion of T_app (and T2) in NR428 reduces it sevenfold again, in agreement with the results of the Northern analysis discussed above.

To verify that the differences in β-galactosidase accurately reflected translatable transcript number, we repeated these assays, using equivalent constructions with an RNase III cleavage site substituted for the trpt terminator present between the cloning site and lacZ in the pRS551 vector, as described by Linn and St. Pierre (23). Cleavage by endogenous RNase III renders the 5' ends of all transcripts identical, thus minimizing any contribution of variable stability and translation efficiency to differences in p52::lacZ expression. The relative β-galactosidase activities were essentially unchanged (Fig. 2B), although the absolute levels rose four- to fivefold, presumably due to removal of the trpt element.

The data shown in Fig. 2B thus confirm the activity of the promoter and strongly suggest that the main factor limiting late gene transcription is termination at T1 and T_app.

The product of N15 gene 40 is the transcription antiterminator. The action of the N15 putative gene 40 product, a Q gene homologue, as an antiterminator of late gene transcription had been suggested by the inability of N15 40 mutants to grow lytically (35). A corollary of this observation would be failure of N15 to lysogenize when gene 40 expression is forced. We placed gene 40 under control of the arabinose-inducible P_BAD promoter as plasmid pBAD-Q and analyzed the effect of its expression on N15 propagation. N15 formed clear plaques on MC1061 carrying pBAD-Q in the presence of arabinose, indicating that gene 40 expression suppresses lysogenization. When arabinose was added to an exponentially growing culture of an N15 lysogen of MC1061/pBAD-Q to activate gene 40, but the prophage was left uninduced, the culture lysed 3 h later, presumably reflecting production of the holin, lysozyme, and Rz protein products of late operon genes 53 to 55.1 (32) without significant phage production (data not shown). A reverse transcription-PCR analysis by Ravin et al. (32) had revealed low-level transcription of these genes from N15 prophage, which presumably provides enough antiterminator substrate for accumulation of the lytic enzymes. These results are consistent with the gene 40 product being the antiterminator of late gene transcription.

To confirm the antiterminator activity of gene 40 protein, we introduced pBAD-Q into the p52::lacZ reporter strains (above) and measured the influence of gene 40 expression on β-galactosidase activity (Table 1). Induction of gene 40 resulted in a 25-fold increase in lacZ transcription in NR428 and DLT2451, to nearly half the level of transcription in strains NR427 and DLT2450, which lack terminators. It also raised the level of β-galactosidase 1.4-fold in NR427 itself. This modest increase was abolished by removal of trpt (DLT2450), implying that the product of gene 40 enables limited bypass of the vector terminator and that about 30% of the stimulation in the NR strains is due to this factor. The upstream regulatory system, consisting of the major N15 repressor CB, had essentially no effect on p52-initiated transcription, in accordance with the absence from this region of any sequence resembling the known CB-binding sites (24). These data, taken together with the circumstantial evidence cited above, are best explained as antitermination by gene 40 protein, which is henceforth named Q.

View this table: [in this window] [in a new window]

TABLE 1. β-galactosidase activity expressed by p52::lacZ transcriptional fusions

Regulation of p52-initiated transcription during lytic growth. To examine the activity of the p52 promoter during lytic development, when all N15 regulatory elements are present at their normal concentrations, we lysogenized the p52::lacZ reporter strains with N15 and then introduced the plasmid pCA12, which carries the antA antirepressor gene under control of the arabinose-inducible P_BAD promoter (31). The addition of arabinose to exponentially growing cultures of the resulting strains activated lytic development, culminating in lysis about 45 min after induction. Figure 3 shows the synthesis of β-galactosidase from the chromosomal p52::lacZ fusions during this latent period. The steady level of enzyme in the induced NR427 lysogen shows that the intrinsic activity of the gene 52 promoter remained approximately constant during lytic growth. In contrast, basal activity in the equivalent NR428 cells, which carry the terminators, was very low early after induction but began to rise about one-third way through the latent period to approach the level seen in induced NR427 by lysis. This response is consistent with the first appearance of p52-initiated transcription at this time seen in the Northern blot analysis (Fig. 2A); there it appeared as termination products, here as a consequence of antitermination.

Here, however, another regulatory factor appears to be involved. Activation of transcription from p52 in the NR430 lysogen, which carries a mutant IR3 site, was attenuated, rising to only a quarter of the NR428 level by lysis. This finding suggests that formation of a SopB-IR3 complex is needed for full late gene expression.

Influence of the IR3 centromere on p52 activity and phage growth. The presence of IR3 20 bp upstream of p52 raised the possibility that it affects promoter activity. The data in Table 1 show this to be the case. Production of SopB reduced transcription to about half that seen without it (NR427 and 428), unless the IR3 was mutated (NR430), in which case transcription was not affected. This modest repression appeared to be unrelated to termination of transcription, since it was seen in NR427 lacking terminators as well as in NR428. It could indicate diminished initiation of transcription, since N15 SopB is known to silence promoters near to its binding sites (14). The presence of SopA reduced transcription still further, possibly by enhancing SopB-mediated silencing, as was also seen with SopA and SopB of the F plasmid (D. Lane, unpublished results).

To evaluate the significance of SopB-IR3 interactions, we examined the propagation of an N15 mutant carrying an inactivated IR3. The mutation had no major consequences at a gross level; N15ir3^– forms lysogens and achieves productive lysis, forming turbid plaques on a lawn of strain MC1061. However, the level of spontaneous phage production by MC1061 N15ir3^– lysogens was half that of the wild-type lysogen (data not shown). Therefore, we examined the lytic development of N15ir3⁺ and ir3^–, adding arabinose to induce the corresponding prophages as described above. Wholesale lysis following induction took about 15 min longer for the ir3^– mutant than for the N15 wild-type (Fig. 4A). This delay was due less to the rate of mature phage production, which trailed only slightly behind that of the wild-type (Fig. 4C), than to slower phage release, which began about 5 min later than that of the wild-type and rose more slowly (Fig. 4B). This difference implies that lysis operon (genes 52 to 58) expression is the primary focus of IR3-mediated regulation.

View larger version (22K): [in this window] [in a new window]

FIG. 4. Involvement of IR2 and IR3 centromeres in lytic development. (A) Progression of visible lysis following the induction of N15+ (open symbols) and N15ir3– (filled symbols). OD600, optical density at 600 nm. (B) One-step growth curve of N15+ and N15ir3–. (C) Intracellular phage production, assayed in prematurely lysed samples as described in Materials and Methods. (D) A second experiment carried out as for panel A, with the addition of induced N15ir2–. The key under panel D shows the relevant centromere genotypes of the N15 strains.

These data concur with the reduced expression of lacZ from p52 in the ir3 mutant reporter strain NR430 observed under identical conditions (Fig. 3). Taken together, these results imply that SopB-IR3 complexes play a significant role in optimizing late gene expression through antitermination. Note that this activity is distinct from, and contrary to, the moderate, terminator-independent silencing of p52 exerted by SopB (and SopA) seen in the data of Table 1.

Involvement of IR2 and Sop proteins in p52 activity. The position of another centromere site, IR2, 190 bp downstream from the Q gene (Fig. 1), suggests that it also might influence Q antiterminator function. This suggestion was strengthened by the observation that the mutation of IR2 resulted in a delay in lysis following prophage induction identical to that observed for the IR3 mutant (Fig. 4D). We again measured the effect on p52 activity of Q protein produced from pBAD-Q, this time in parallel with that from the equivalent plasmid carrying the downstream IR2 site as well (pBAD-Qir2). The results are shown in Fig. 5. Provision of Q alone (lane 2) increased antitermination about 20-fold, as seen previously (Table 1). The level of stimulation by Q protein increased when IR2 was included (Fig. 5, lane 3), consistent with enhancement of transcription by IR2, and decreased in the presence of SopAB (Fig. 5, lane 4), corresponding to the silencing seen previously (Table 1). However, these differences, while reproducible, were at the limit of significance and could have resulted, for example, from variations in Q protein production through effects of the downstream IR2 on Q mRNA stability. That this is not the case was shown by Northern hybridization (Fig. 5B); the concentration of Q mRNA was at least as high in the absence of the downstream sequence and IR2 as in their presence.

View larger version (37K): [in this window] [in a new window]

FIG. 5. Involvement of Sop proteins and centromere IR2 in antitermination. (A) lacZ expression from p52 in NR428 (open bars) and DLT2451 (shaded bars) carrying pBAD24 (lane 1), pBAD-Q (lanes 2 and 4), or pBAD-Qir2 (lanes 3 and 5) with (lanes 4 and 5) or without (lanes 2 and 3) the SopABN15-producing F miniplasmid, pDAG216. Specific activities are normalized to those of NR427 and DLT2450, without terminators (lane 6). "chr.," in the box at the top, illustrates the relevant elements; brackets around T2 signify lack of evidence for terminator function, and the filled hairpin denotes the trpt terminator in the vector. ara, arabinose. (B) Q mRNA concentrations in the cells analyzed for panel A. Duplicate 5-µg aliquots of total RNA were applied in slots and hybridized with a radioactively labeled Q gene probe and a probe to galE taken as a constitutively expressed internal control. (C) Western blot of total proteins from MC1061 N15+ pCA12 induced at 0 min by the addition of arabinose and from MC1061 with or without (–) pDAG216. The cross-reacting host protein was used as an internal standard for quantification.

The results were less equivocal when both IR2, as pBAD-Qir2, and the Sop proteins were present following the induction of Q. Expression of lacZ was about twice that seen in the absence of any one of these three factors (lane 5). Owing to the unavailability of antiserum to N15 SopB protein, we estimated SopB levels indirectly, by assuming production at a constant level relative to that of SopA and performing Western analysis of extracts, using the cross-reaction of anti-SopA_F with SopA_N15 (28). The Western blot of Fig. 5C showed that in cells carrying pDAG216, SopA was present at 0.64- and 0.37-fold its concentration at 30 and 40 min, respectively, after N15 prophage induction. It should also be noted that in these experiments, IR2 is in trans to the p52::lacZ fusion, where it might be less effective than in its cis position in N15. SopB and IR2, even when provided less than optimally, appear able to stimulate transcription from p52 and thus to contribute to late gene expression and lytic development.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The results presented here show that in contrast to the unique role of the F plasmid Sop system, the closely related Sop system of N15 not only assures stability of the prophage but also optimizes lytic development of vegetative phage. In N15, centromeric sites (IRs) are not fixed at a single location, as in F, but are dispersed, which has presumably provided the opportunity for involvement in other processes. In this respect the N15 Sop system is like many of its homologues in bacterial chromosomes, which are often seen to serve other purposes through dispersed centromeric (parS) sites. The ParA/ParB protein duo of Streptomyces coelicolor regulates sporulation (19), Soj/Spo0J of Bacillus subtilis regulates both sporulation and initiation of replication (18, 27), ParA/B of Caulobacter crescentus is essential for cell division control (10), and ParA/B of Pseudomonas aeruginosa appears to play a role in cell physiology (3). This functional versatility and centromere dispersal is rare among plasmids so far studied but is a notable feature of the IncP-1 group. KorB, the SopB/ParB analogue of the IncP-1 archetype, RK2, not only forms partition complexes on scattered centromere-like sites but also binds to these sites to repress the promoters of genes involved in plasmid transfer, vegetative replication, and stable maintenance (20). Moreover, binding of KorB to these sites is modulated through interaction with other RK2 regulatory proteins. KorB and its partition partner, IncC2, are taxonomically more closely related to chromosomal analogues than to plasmid systems (4), and it will be interesting to see if the chromosomal Par proteins share this regulatory finesse. The obvious candidate for modulator of N15 SopB regulatory action is SopA, and enhancement of SopB-IR3 mediated silencing by SopA (Table 1) is preliminary evidence for such a role.

The participation of the Sop system in N15 propagation appears not to be limited to regulation of late gene antitermination. In unpublished work, we have found that the activity of a weak late promoter (of virion gene transcription) close to the IR4 centromere can be reduced in the presence of Sop proteins but is unaffected by Q protein and that the IR1 centromere in the repA gene mediates a stimulatory effect of the Sop proteins on N15 prophage replication. We do not yet understand either the mechanism or the purpose of these regulatory interventions of the Sop system. Involvement in replication complicates attempts to directly analyze SopB's role in antitermination. Hence, in the work reported here, the role of SopB in the stimulation of late transcription was inferred rather than demonstrated.

Although partition and transcriptional regulation appear to be very different processes, it is likely that the same properties of the N15 partition functions are involved in both, and it is interesting to consider how N15 exploits them. Late gene expression during lytic development of N15 is superficially similar to that of . A late operon comprising two major gene clusters, which encode the proteins needed for lysis and for virion formation, are controlled by intrinsic transcription terminators and are activated by a mechanism that suppresses termination. But the details differ. In , synthesis of the late operon antiterminator Q is itself dependent on antitermination by N protein and hence does not occur in the lysogenic state. The N antitermination system is not present in N15, and gene 40, whose product we have shown here to be the equivalent Q antiterminator, is transcribed from the prophage (32). Nevertheless, late gene transcription from the N15 prophage is negligible, suggesting that an additional control limits the amount or activity of N15 Q protein to below that needed to suppress termination. One limiting factor could be the 6-kb distance between gene 40 and the target of its product, the p52 late promoter. Unlike Q, whose gene is immediately upstream of its site of action at the late promoter, N15 Q would leave the cotranslating ribosome relatively distant from the late promoter and might be diluted beyond its effective concentration. If so, some mechanism must compensate for this separation when late gene expression is needed during lytic growth. Simply increasing Q synthesis or stability during lytic development would presumably contribute to antitermination. But our observation of delayed lysis and reduced p52 activity following induction of N15ir mutant prophages (Fig. 3 and 4) indicates that the N15 Sop system also plays a significant role in enhancing Q-mediated antitermination. Notably, during lytic growth, Sop protein levels begin to increase shortly after p52-initiated transcription is first detected (Fig. 2A and 5C), at just the time they would be needed to assist antitermination.

In apparent contradiction, the data of Table 1 show that the proximity of IR3 sensitizes p52 to the repressive effect of SopB, as could be expected from the known silencing activity of this protein (14). One approach to reconciling these observations is to propose that the IR3-SopB complex acts one way in the prophage and another way during lytic growth. In the prophage, its predominant function could be to trigger SopB spreading and so to silence p52, accounting for the inability of the N15 prophage to activate late transcription despite the presence of Q protein, whose action might in any case be diminished by the distance of its gene from its target. In contrast, during the latent period, its role would be to improve the efficiency with which Q finds its target (qut site) and interacts with RNA polymerase (40). An attractive mechanism for the latter activity is pairing between SopB molecules bound to IR2 and IR3 on the same N15 molecule (in cis), analogous to the pairing of complexes in trans widely thought to initiate plasmid segregation. Such pairing would effectively deliver Q to its qut site, so enhancing its effective concentration at p52. The exercise of both spreading and looping alternatives has also been invoked to explain regulatory activities of RK2 KorB (5). We have observed internal pairing in vivo (B. Dorokhov, N. V. Ravin, and D. Lane, manuscript in preparation), which, together with the increase seen in antitermination upon supplementing Q protein with IR2 and the Sop proteins (Fig. 5), implies that this is a plausible model. We are currently testing it.

The N15-like linear prophages K02 and pY54 carry different numbers of IR elements, but in both cases, IRs are present near their presumed Q genes and late promoters. Although we do not know whether the three prophages represent a succession or convergent evolution, they provide the raw material for addressing such intriguing questions as which function came first and was co-opted to the other, partition or regulation? A case for which this may have been answered is that of VirB, a positive regulator of virulence gene expression in Shigella flexneri. Although VirB is not a partition protein—it no longer has a ParA-like partner, for instance—its sequence and specific DNA-binding site show significant similarities with those of ParB of the P1 prophage-plasmid. Turner and Dorman (39) have recently suggested that the function of VirB has undergone an evolutionary shift, from partition to regulation. N15 SopB and its IR sites might be on the same path.

 
We thank Thomas Linn for kindly providing pTL61T, Kounthea Phok and Béatrice Clouet-D'Orval for assistance with Northern blotting, Taisia Strakhova for technical advice, and Jean-Yves Bouet for critical reading of the manuscript.

This work was supported by an INTAS Young Scientists Fellowship (04-83-3332) awarded to N.V.R. and RFBR grant 07-04-01078 and Agence National de Recherche grant 06-BLAN-0280-01 to D.L.

 
* Corresponding author. Mailing address: Laboratoire de Microbiologie et Génétique Moléculaires, CNRS UMR5100, Campus Paul Sabatier, 118 route de Narbonne, 31062 Toulouse, France. Phone: 33 5 61 33 59 68. Fax: 33 5 61 33 58 86. E-mail: dave{at}ibcg.biotoul.fr

Published ahead of print on 21 March 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Abeles, A. L., S. A. Friedman, and S. J. Austin. 1985. Partition of unit-copy miniplasmids to daughter cells. III. The DNA sequence and functional organization of the P1 partition region. J. Mol. Biol. 185:261-272.[CrossRef][Medline]
2
2. Aiba, H., S. Adhya, and B. de Crombrugghe. 1981. Evidence for two functional gal promoters in intact Escherichia coli cells. J. Biol. Chem. 256:11905-11910.[Abstract/Free Full Text]
3
3. Bartosik, A. A., K. Lasocki, J. Mierzejewska, C. M. Thomas, and G. Jagura-Burdzy. 2004. ParB of Pseudomonas aeruginosa: interactions with its partner ParA and its target parS and specific effects on bacterial growth. J. Bacteriol. 186:6983-6998.[Abstract/Free Full Text]
4
4. Bignell, C., and C. M. Thomas. 2001. The bacterial ParA-ParB partitioning proteins. J. Biotechnol. 91:1-34.[CrossRef][Medline]
5
5. Bingle, L. E., D. P. Macartney, A. Fantozzi, S. E. Manzoor, and C. M. Thomas. 2005. Flexibility in repression and cooperativity by KorB of broad host range IncP-1 plasmid RK2. J. Mol. Biol. 349:302-316.[CrossRef][Medline]
6
6. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179-207.[CrossRef][Medline]
7
7. Casjens, S. R., E. B. Gilcrease, W. M. Huang, K. L. Bunny, M. L. Pedulla, M. E. Ford, J. M. Houtz, G. F. Hatfull, and R. W. Hendrix. 2004. The pKO2 linear plasmid prophage of Klebsiella oxytoca. J. Bacteriol. 186:1818-1832.[Abstract/Free Full Text]
8
8. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
9
9. Ellis, H. M., D. Yu, T. DiTizio, and D. L. Court. 2001. High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. USA 98:6742-6746.[Abstract/Free Full Text]
10
10. Figge, R. M., J. Easter, and J. W. Gober. 2003. Productive interaction between the chromosome partitioning proteins, ParA and ParB, is required for the progression of the cell cycle in Caulobacter crescentus. Mol. Microbiol. 47:1225-1237.[CrossRef][Medline]
11
11. Gerdes, K., and S. Molin. 1986. Partitioning of plasmid R1. Structural and functional analysis of the parA locus. J. Mol. Biol. 190:269-279.[CrossRef][Medline]
12
12. Goodner, B., G. Hinkle, S. Gattung, N. Miller, M. Blanchard, B. Qurollo, B. S. Goldman, Y. Cao, M. Askenazi, C. Halling, L. Mullin, K. Houmiel, J. Gordon, M. Vaudin, O. Iartchouk, A. Epp, F. Liu, C. Wollam, M. Allinger, D. Doughty, C. Scott, C. Lappas, B. Markelz, C. Flanagan, C. Crowell, J. Gurson, C. Lomo, C. Sear, G. Strub, C. Cielo, and S. Slater. 2001. Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens C58. Science 294:2323-2328.[Abstract/Free Full Text]
13
13. Grant, S. G., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645-4649.[Abstract/Free Full Text]
14
14. Grigoriev, P. S., and M. B. Lobocka. 2001. Determinants of segregational stability of the linear plasmid-prophage N15 of Escherichia coli. Mol. Microbiol. 42:355-368.[CrossRef][Medline]
15
15. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P_BAD promoter. J. Bacteriol. 177:4121-4130.[Abstract/Free Full Text]
16
16. Hertwig, S., I. Klein, R. Lurz, E. Lanka, and B. Appel. 2003. PY54, a linear plasmid prophage of Yersinia enterocolitica with covalently closed ends. Mol. Microbiol. 48:989-1003.[CrossRef][Medline]
17
17. Hinnebusch, J., and A. G. Barbour. 1991. Linear plasmids of Borrelia burgdorferi have a telomeric structure and sequence similar to those of a eukaryotic virus. J. Bacteriol. 173:7233-7239.[Abstract/Free Full Text]
18
18. Ireton, K., N. W. Gunther IV, and A. D. Grossman. 1994. spo0J is required for normal chromosome segregation as well as the initiation of sporulation in Bacillus subtilis. J. Bacteriol. 176:5320-5329.[Abstract/Free Full Text]
19
19. Jakimowicz, D., S. Mouz, J. Zakrzewska-Czerwiska, and K. F. Chater. 2006. Developmental control of a parAB promoter leads to formation of sporulation-associated ParB complexes in Streptomyces coelicolor. J. Bacteriol. 188:1710-1720.[Abstract/Free Full Text]
20
20. Kostelidou, K., A. C. Jones, and C. M. Thomas. 1999. Conserved C-terminal region of global repressor KorA of broad-host-range plasmid RK2 is required for co-operativity between KorA and a second RK2 global regulator, KorB. J. Mol. Biol. 289:211-221.[CrossRef][Medline]
21
21. Lane, D., J. Cavaille, and M. Chandler. 1994. Induction of the SOS response by IS1 transposase. J. Mol. Biol. 242:339-350.[CrossRef][Medline]
22
22. Lennox, E. S. 1955. Transduction of linked genetic characters of the host by bacteriophage P1. Virology 1:190-206.[CrossRef][Medline]
23
23. Linn, T., and R. St. Pierre. 1990. Improved vector system for constructing transcriptional fusions that ensures independent translation of lacZ. J. Bacteriol. 172:1077-1084.[Abstract/Free Full Text]
24
24. Lobocka, M. B., A. N. Svarchevsky, V. N. Rybchin, and M. B. Yarmolinsky. 1996. Characterization of the primary immunity region of the Escherichia coli linear plasmid prophage N15. J. Bacteriol. 178:2902-2910.[Abstract/Free Full Text]
25
25. Mardanov, A. V., and N. V. Ravin. 2007. The antirepressor needed for induction of linear plasmid-prophage N15 belongs to the SOS regulon. J. Bacteriol. 189:6333-6338.[Abstract/Free Full Text]
26
26. Ogura, T., and S. Hiraga. 1983. Partition mechanism of F plasmid: two plasmid gene-encoded products and a cis-acting region are involved in partition. Cell 32:351-360.[CrossRef][Medline]
27
27. Ogura, Y., N. Ogasawara, E. J. Harry, and S. Moriya. 2003. Increasing the ratio of Soj to Spo0J promotes replication initiation in Bacillus subtilis. J. Bacteriol. 185:6316-6324.[Abstract/Free Full Text]
28
28. Ravin, N., and D. Lane. 1999. Partition of the linear plasmid N15: interactions of N15 partition functions with the sop locus of the F plasmid. J. Bacteriol. 181:6898-6906.[Abstract/Free Full Text]
29
29. Ravin, N. V. 2003. Mechanisms of replication and telomere resolution of the linear plasmid prophage N15. FEMS Microbiol. Lett. 221:1-6.[CrossRef][Medline]
30
30. Ravin, N. V., J. Rech, and D. Lane. 2003. Mapping of functional domains in F plasmid partition proteins reveals a bipartite SopB-recognition domain in SopA. J. Mol. Biol. 329:875-889.[CrossRef][Medline]
31
31. Ravin, N. V., A. N. Svarchevsky, and G. Deho. 1999. The anti-immunity system of phage-plasmid N15: identification of the antirepressor gene and its control by a small processed RNA. Mol. Microbiol. 34:980-994.[CrossRef][Medline]
32
32. Ravin, V., N. Ravin, S. Casjens, M. E. Ford, G. F. Hatfull, and R. W. Hendrix. 2000. Genomic sequence and analysis of the atypical temperate bacteriophage N15. J. Mol. Biol. 299:53-73.[CrossRef][Medline]
33
33. Ravin, V. K., and M. G. Shulga. 1970. Evidence for extrachromosomal location of prophage N15. Virology 40:800-807.[CrossRef][Medline]
34
34. Roberts, J. W., W. Yarnell, E. Bartlett, J. Guo, M. Marr, D. C. Ko, H. Sun, and C. W. Roberts. 1998. Antitermination by bacteriophage lambda Q protein. Cold Spring Harbor Symp. Quant. Biol. 63:319-325.[CrossRef][Medline]
35
35. San'kova, T. P., A. N. Svarchevski, and V. N. Rybchin. 1992. Isolation, characterization and mapping of the N15 plasmid insertion mutations. Genetika 28:66-76. (In Russian.)[Medline]
36
36. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96.[CrossRef][Medline]
37
37. Sugino, A., S. Hirose, and R. Okazaki. 1972. RNA-linked nascent DNA fragments in Escherichia coli. Proc. Natl. Acad. Sci. USA 69:1863-1867.[Abstract/Free Full Text]
38
38. Svarchevski, A. N., and V. N. Rybchin. 1984. Physical mapping of plasmid N15 DNA. Mol. Gen. Mikrobiol. Virusol. 10:16-22. (In Russian.)
39
39. Turner, E. C., and C. J. Dorman. 2007. H-NS antagonism in Shigella flexneri by VirB, a virulence gene transcription regulator that is closely related to plasmid partition factors. J. Bacteriol. 189:3403-3413.[Abstract/Free Full Text]
40
40. Yarnell, W. S., and J. W. Roberts. 1992. The phage gene Q transcription antiterminator binds DNA in the late gene promoter as it modifies RNA polymerase. Cell 69:1181-1189.[CrossRef][Medline]

---

Journal of Bacteriology, May 2008, p. 3538-3545, Vol. 190, No. 10
0021-9193/08/$08.00+0     doi:10.1128/JB.01993-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ravin, N. V. Articles by Lane, D. Search for Related Content PubMed PubMed Citation Articles by Ravin, N. V. Articles by Lane, D.