Previous Article | Next Article ![]()
Journal of Bacteriology, June 2008, p. 4079-4083, Vol. 190, No. 11
0021-9193/08/$08.00+0 doi:10.1128/JB.01889-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Molecular Microbiology, John Innes Centre, Norwich Research Park, Colney, NR4 7UH Norwich, United Kingdom
Received 3 December 2007/ Accepted 10 March 2008
|
|
|---|
|
|
|---|
Here, we report the construction of an S. coelicolor rnc null mutant and phenotypic characterization of this mutant. In addition, we used high-resolution S1 nuclease mapping experiments to determine when and how the gene encoding RNase III gene is transcribed.
Phenotypic analysis of an S. coelicolor rnc null mutant.
PCR-targeted mutagenesis was used for replacement of the S. coelicolor rnc gene with an apramycin resistance marker, apr (13). The requisite PCR product was amplified from the apramycin resistance gene insert of pIJ773 using primers SCO5572 KO FOR (AGGTCCTCGAGGTCTGAGCGGCTGGTGAGAGGCACTGTGATTCCGGGGATCCGTCGACC) and SCO5572 REV (TGCCGGGGCGGGCGTTCGGACCGTGCGGTGGACGGGTCATGTAGGCTGGAGCTGCTTC). The PCR product was introduced into E. coli BW25113/pIJ790 harboring cosmid St7A1 and expressing
RED recombinase. The resultant recombinant cosmid, St7A1
rnc::apr, was introduced via E. coli strain ET12567/pUZ8002 into S. coelicolor M600 by conjugation. M600 is a plasmid-free derivative of the wild-type strain (15). Exconjugants lacking the rnc gene were identified by selection for apramycin resistance and kanamycin sensitivity. Gene replacement was confirmed by PCR analysis of both the recombinant cosmid and genomic DNA from the null mutant, S. coelicolor J3410
rnc::apr.
As expected, the phenotype of the constructed S. coelicolor rnc null mutant closely resembled that reported for the absB mutant. The null mutant did not produce actinorhodin or the prodiginines when it was grown on any of the nine different solid media tested (Fig. 1). These results are notable because the phenotypes of other mutants with pleiotropic defects in antibiotic production are dependent on the growth medium (8). Furthermore, the null mutant did not produce antibiotics when it was grown in SMM, a minimal liquid medium optimized for antibiotic production in S. coelicolor (15). After 48 h of growth in this medium, the null mutant did not contain measurable quantities of actinorhodin or the prodiginines, while wild-type S. coelicolor grown under identical conditions produced these antibiotics copiously (data not shown). In this medium, the null mutant and wild-type strain have comparable growth kinetics, but the null mutant accumulates about 20% more biomass than the parent strain by late stationary phase (Fig. 2).
![]() View larger version (58K): [in a new window] |
FIG. 1. The S. coelicolor rnc gene is absolutely required for antibiotic production. Wild-type S. coelicolor M600, S. coelicolor J3410 rnc::apr, S. coelicolor J3410/pJS72, and S. coelicolor J3410/pJS72+IRS (clockwise from the top left) were grown on minimal, complex, and chemically defined Evans media (15, 20). Ectopic expression of the S. coelicolor rnc gene with and without the 3' inverted repeat sequence (IRS) causes overproduction of actinorhodin on SMMS, R2, and all chemically defined Evans media.
|
![]() View larger version (11K): [in a new window] |
FIG. 2. Comparison of growth kinetics of wild-type S. coelicolor and the rnc null mutant. Both strains were grown as shaken liquid cultures in SMM from an initial inoculum of 108 CFU/ml for 36 h at 30°C. Production of the pigmented antibiotics was visible by 24 h in the wild-type cultures. The growth curves reflect the averages of three separate experiments.
|
![]() View larger version (73K): [in a new window] |
FIG. 3. The S. coelicolor rnc gene is required for proper formation of sporulation septa: scanning electron micrographs of the rnc null mutant and the wild-type strain grown for 5 days on MS medium at 30°C.
|
BT1 attP site (12). These constructs were introduced into the S. coelicolor rnc null mutant via E. coli strain ET12567/pUZ8002 by conjugation. Only provision of the rnc gene in cis with the two upstream genes restored antibiotic production (Fig. 4B), suggesting that the rnc gene is the last gene in a tricistronic message. Additional complementation experiments were designed to verify that the rnc gene alone was sufficient to restore the wild-type phenotype. The S. coelicolor rnc gene (both with and without its 3' inverted repeat sequence) was placed under the control of the strong, constitutive ermE promoter in the hygromycin-resistant, attP integrative vector pIJ10275 (H.-J. Hong, unpublished). The gene was amplified by PCR from cosmid St7A1 using primer SCO5572 FOR (AACATATGTCAGTCCCCAAGAAGGC) and primer SCO5572 REV (AAGGATCCAAGCTTTCAGGCGGAGGCGGA) or SCO5572IRS REV (AAGGATCCAAGCTTGCCGGTGGATGAGCGA) (engineered NdeI and BamHI sites are underlined), cloned into the EcoRV site of pBluescript KS+ (Stratagene), and sequenced. NdeI and XhoI fragments from the cloning constructs were ligated into complementary sites of pIJ10275. The resulting plasmids (pJS72 and pJS72IRS) were introduced into the rnc null mutant of S. coelicolor by conjugation. In the null mutant, constitutive expression of the rnc gene not only restored antibiotic production but also caused overproduction of actinorhodin on certain solid media (Fig. 1). All complementation plasmids that restored normal antibiotic production to the rnc null mutant also restored proper formation of sporulation septa (data not shown).
![]() View larger version (29K): [in a new window] |
FIG. 4. Complementation of the S. coelicolor rnc null mutant. (A) Inserts of S. coelicolor J3410 ( rnc) complementing clones and comparison to the equivalent regions of the S. coelicolor chromosome (5; http://streptomyces.org.uk). rnc is SCO5572. SCO5570 encodes a protein with a predicted metal and nucleic acid binding domain, and SCO5571 encodes ribosomal protein L32 (rpmF). The vector in all of the clones is pMS81 (12). (B) Top and bottom views of plates showing complementation of S. coelicolor J3410 ( rnc) by pJS3 and pJS4 but not by pJS1. The cultures were grown on Difco nutrient agar for 4 days at 30°C.
|
-32P]ATP and the pBluescript T3-specific primer (GCGCAATTAACCCTCACTAAAGGG). When annealed to mRNA, the probes spanning the region surrounding the translation start sites of the rnc gene and the upstream gene SCO5571 encoding ribosomal protein L32 were fully protected from the S1 nuclease; however, significant S1 nuclease digestion of the SCO5570 probe was observed, yielding a 140-nucleotide protected DNA fragment (Fig. 5A). These results indicate that the three genes are cotranscribed in the exponential phase and that the transcription start site is upstream of SCO5570. Electrophoresis of the 140-nucleotide protected DNA fragment with a sequencing ladder (generated using the same radiolabeled oligonucleotide primer that was used to generate the S1 nuclease mapping probe) indicated that the most likely transcriptional start site is 82 bp upstream of the SCO5570 start codon (Fig. 5B). The putative –35 and –10 sequences of the SCO5570 promoter are TTGGGC-N18-TATCCT. This promoter is very likely to be recognized by the HrdB principal essential sigma factor (7).
![]() View larger version (57K): [in a new window] |
FIG. 5. Transcriptional analysis of the S. coelicolor rnc (SCO5572) gene and the two upstream genes, SCO5570 and SCO5571. (A) S1 nuclease mapping of the SCO5570, SCO5571, and SCO5572 mRNA transcripts among total RNA isolated at various time points from shaken liquid cultures of S. coelicolor M600 grown in liquid SMM at 30°C. The lanes are numbered from left to right. Lane 1 contained the X174/HinfI ladder. Lane 2 contained the undigested probes including 85-bp nonhomologous ends derived from the T3 site of pBluescript SCO5570 (428 bp), SCO5571 (320 bp), and SCO5572 (274 bp). Lane 3 contained the digested probes mixed with a tRNA control. Lanes 4 to 9 contained the S1 nuclease-protected probe-RNA hybrids. The three probes were simultaneously hybridized to total RNA. (B) S1 nuclease mapping of the transcriptional start site of SCO5570 was conducted using a 450-bp PCR product uniquely labeled at the 5' end. The asterisks indicate the probable transcriptional start sites. Lanes G, A, T, and C contained sequence ladders derived from the same labeled primer that was used to generate the PCR product.
|
10% of all cellular proteins (11). The apparent exponential-phase transcription of the S. coelicolor rnc gene and cotranscription with the upstream gene encoding ribosomal protein L32 are consistent with a role for S. coelicolor RNase III in the processing of rRNA, as is the case for its ortholog in E. coli. Curiously, the nearly identical vegetative growth kinetics of the S. coelicolor rnc null mutant and the wild-type strain in liquid culture raise questions about the significance of rRNA processing by RNase III in S. coelicolor. It is possible that RNase III is one of many cooperative proteins that regulate antibiotic production (6, 14, 16). For instance, RNase III could catalyze a hydrolysis reaction that inactivates an mRNA encoding a repressor or activates a transcript encoding an activator of antibiotic production (1, 10). Alternatively, the phenotype of the S. coelicolor rnc null mutant could be explained by incomplete processing of rRNA that yields ribosomes lacking the requisite processivity for translation of the atypically long mRNAs of secondary metabolism genes in S. coelicolor (5; http://streptomyces.org.uk). Biochemical experiments are needed to distinguish between these two possibilities.
This work was supported by a Career Award at the Scientific Interface from the Burroughs Wellcome Fund to J.K.S. and by a grant-in-aid to the John Innes Centre from the BBSRC.
Published ahead of print on 21 March 2008. ![]()
|
|
|---|
BT1 and development of site-specific integrating vectors. J. Bacteriol. 185:5320-5323.This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»