Previous Article | Next Article ![]()
Journal of Bacteriology, June 2008, p. 4181-4188, Vol. 190, No. 12
0021-9193/08/$08.00+0 doi:10.1128/JB.01873-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology and Molecular Genetics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba, 263-8522, Japan,1 Department of Preventive Dentistry, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, 061-0293, Japan2
Received 29 November 2007/ Accepted 1 April 2008
|
|
|---|
|
|
|---|
Lon, first identified in E. coli, has been shown to degrade specific regulatory proteins involved in a variety of biological processes: SulA, which regulates cell division (29); RcsA, a transcriptional activator for capsule synthesis (41);
N, which antagonizes the termination of early transcription of
DNA (26); and CcdA, the antitoxin of the ccd postsegregational killing system carried by the F plasmid (42). Lon has been shown to regulate virulence factors in some pathogenic bacteria. For instance, it specifically degrades HilC and HilD, which are transcriptional regulators for the expression of Salmonella pathogenicity island 1 in Salmonella enterica serovar Typhimurium (38). It recognizes YmoA, which regulates the Yop regulon in Yersinia pestis (17). Furthermore, it is involved in degrading HrpR, which regulates the expression of the Hrp system in Pseudomonas syringae (4). Proteolysis of these regulators by Lon is important for pathogenesis. In fact, we have previously demonstrated that it is essential for systemic infection with serovar Typhimurium in mice (39).
Pseudomonas aeruginosa is an opportunistic human pathogen that tends to infect individuals with cystic fibrosis or immunocompromised patients, such as those suffering burns or undergoing cytotoxic chemotherapy (24). A variety of virulence factors have been reported in P. aeruginosa, e.g., proteases, including elastase, alkaline protease, LasA protease, protease IV, and membrane protease (25). They interfere with the host immune response by degrading target cell components. In addition, extracellular virulence factors, such as pyocyanin, exotoxin, hemolycin, and rhamnolipids, are involved in the expression of P. aeruginosa virulence (5). In most cases, synthesis of these factors is controlled by a quorum-sensing (QS) system.
A QS system is a regulatory mechanism that allows bacteria to monitor their population size by responding to the extracellular concentration of a signal molecule. P. aeruginosa has two QS systems mediated by acyl-homoserine lactone (HSL) as the signal molecule. They are encoded by the lasR-lasI and rhlR-rhlI gene pairs. lasI and rhlI encode HSL synthases (LasI and RhlI), which are responsible for the synthesis of 3-oxo-C12-HSL and C4-HSL, respectively. lasR and rhlR encode the transcriptional activators (LasR and RhlR) that respond to their cognate signal molecules and activate transcription of lasI and rhlI, respectively. The two systems function sequentially: the RhlR/RhlI system is subordinate to the LasR/LasI system, because rhlI and rhlR are among the genes activated by LasR and LasI. The QS systems control over 200 genes, including those for the pathogenesis of P. aeruginosa infections (36, 44). The P. aeruginosa QS system is connected in complicated ways with other cellular regulatory networks. For instance, it is regulated by functions such as Vfr (1), GacA (32), RpoS (46), and RpoN (40).
In this study, we provide the first evidence that the Lon protease of P. aeruginosa is involved in negative regulation of the LasR/LasI and RhlR/RhlI QS systems. We identified a lon homologue in P. aeruginosa PAO1 and constructed a lon insertion mutant and characterized it. By these means, we have found that lon disruption results in LasR/LasI-dependent activation of the RhlR/RhlI system. We demonstrate that Lon regulates the expression of LasR/LasI by posttranslational control of LasI. It also regulates the RhlR level independently of LasR/LasI. We also suggest that Lon is involved in the regulation of RhlR through modulation of RhlI.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains used in this study
|
|
View this table: [in a new window] |
TABLE 2. Plasmids used in this study
|
Plasmid pTKY805 for complementation analysis of lon was constructed by cloning in pME6032 a 2,676-bp PCR fragment, bp –196 to +2480 relative to the lon translational start site.
Construction of
lon::Gm,
rhlR,
lon::Gm
rhlR,
lasR,
lon::Gm
lasR,
lasI,
rhlI,
lasI
rhlI, and
lon::Gm
lasI
rhlI mutants.
To construct the
rhlR mutant CS9011, the plasmid pTKY714 was cleaved at the two NruI sites to eliminate the 214-bp central fragment of rhlR. The resultant plasmid, pTKY762, was cleaved at the EcoRI and HindIII sites in the vector, and the rhlR-disrupted fragment was ligated to the vector pEX18, a transferable suicide vector (14), yielding pTKY763. This plasmid was then used in a marker exchange experiment in P. aeruginosa PAO1.
The
lasR mutant CS9013 was constructed as follows. We generated the plasmid pTKY764 by cloning in pHSG399 a 1,936-bp PCR fragment flanking bp –622 to +1215 relative to the lasR translational start site. This plasmid was cleaved at two PstI sites to eliminate the 408-bp central fragment of lasR, generating pTKY765. The lasR-disrupted fragment in this plasmid was ligated to the vector pEX18. The resultant plasmid, pTKY766, was used in a marker replacement experiment in strain PAO1.
The
lasI mutant CS9038 was constructed as follows. The plasmid pTKY788 was generated by cloning in pHSG399 a 1,080-bp PCR fragment, bp –99 to +981 relative to the lasI translational start site. This plasmid was cleaved at two BssHII sites to eliminate the 138-bp central fragment of lasI, yielding the plasmid pTKY789. The lasI-disrupted fragment in this plasmid was ligated to the vector pEX18. The resultant plasmid, pTKY790, was used in a marker exchange experiment in strain PAO1.
The
rhlI mutant CS9044 was constructed as follows. The plasmid pTKY715 was cleaved at PvuII and NruI sites to eliminate the 147-bp central fragment of rhlI, yielding the plasmid pTKY791. The rhlI-disrupted fragment in this plasmid was ligated to the vector pEX18. The resultant plasmid, pTKY792, was used in a gene replacement experiment in strain PAO1.
To construct the
rhlI
lasR double mutant CS9051, the plasmid pTKY792 was mobilized into the strain CS9013 (
lasR). The transconjugants were selected by resistance to carbenicillin based on a single-crossover event. A double-crossover event in the
lasR mutant was then assessed by its resistance to sucrose and sensitivity to carbenicillin.
To construct the
lon::Gm (CS9008),
lon::Gm
lasR (CS9027),
lon::Gm
rhlR (CS9028), and
lon::Gm
lasR
rhlI (CS9062) mutants, the DNA fragment between nucleotides 814 and 2484 in the lon coding region was initially amplified from the chromosome of strain PAO1 by PCR. The 1,659-bp fragment generated was cleaved with HindIII at the 5' end and EcoRI at the 3' end and then cloned into the vector pUC18. The resultant plasmid, pTKY613, was cleaved at the two HincII sites to eliminate the 370-bp central fragment of lon and then ligated to the fragment encoding the gentamicin resistance gene generated from SmaI-digested pMS255. The
lon::Gm fragment obtained by digestion of the resultant plasmid, pTKY614, with HindIII and EcoRI was ligated to the vector pEX18. The resultant plasmid, pTKY713, was used to replace
lon::Gm in strains PAO1, CS9011, CS9013, and CS9051.
Generation of the anti-RhlR, anti-RhlI and anti-LasI antisera.
To purify the N-terminally His-tagged RhlR and His-tagged RhlI, which had formed inclusion bodies, 3-liter cultures of the E. coli DH5
Z1 derivative harboring pTKY714 or pTKY715 were incubated at 37°C until the cell density reached an optical density at 600 nm (OD600) of 0.8. IPTG (isopropyl-β-D-thiogalactopyranoside) was added to a final concentration of 1 mM for 3 h, and the cells were collected by centrifugation. After one freeze-thaw cycle, the wet cell pastes were resuspended in lysis buffer (100 mM NaH2PO4, 10 mM Tris base, 8 M urea, pH 8.0) and sonicated. After centrifugation, the pellets were washed twice with 1% Triton X-100 and once with 0.1% sodium dodecyl sulfate (SDS). After further centrifugation, the precipitates were suspended in SDS sample buffer, following by SDS-polyacrylamide gel electrophoresis (PAGE). The eluates from the gel corresponding to each protein band were used to immunize a rabbit. To generate anti-LasI antiserum, the purified LasI
G protein (12) (provided by M. Churchill) was used to immunize a rabbit. The resultant antisera were verified by reaction with the purified antigen proteins.
Comparative analysis of C4-HSL. The detection of C4-HSL was based on the method of Shaw et al. (37). Bacterial cells were grown in L broth to stationary phase at 37°C and removed by centrifugation. Samples (80 ml) of the supernatants were filtered through a Millex-GV filter (Millipore) and extracted twice with 50 ml of ethyl acetate. HSL developed on the TLC plate was detected using an indicator bacterium, Chromobacterium violaceum mutant CV026, by the method of Latifi et al. (23).
SDS-PAGE and immunoblotting. Gel electrophoresis was carried out according to the method of Laemmli (21) using 15% SDS-polyacrylamide gels. The separated proteins were transferred onto Immun-BlotPVDF membranes (Bio-Rad) and then incubated with anti-E.coli Lon serum (1:12,500), anti-Pseudomonas LasI and anti-RhlR sera (1:25,000), or anti-Pseudomonas RhlR serum (1:25,000), followed by alkaline phosphatase-conjugated anti-rabbit immunoglobulin G. The enzymatic reactions were performed in the presence of 0.3 mg ml–1 lysozyme nitroblue tetrazolium (Wako) and 0.15 mg ml–1 5-bromo-4-chloro-3-indolylphosphate (Sigma).
Pulse-labeling and coimmunoprecipitation. Bacterial cells of strains PAO1 and CS9008 were grown in L broth at 37°C until the cell density reached an OD600 of 0.5. The cells were collected by centrifugation and were resuspended in M9 medium supplemented with 0.25% glucose, 40 µg ml–1 (each) of 18 amino acids (methionine and cysteine were excluded), and 2 µg ml–1 thiamine. They were then incubated at 37°C for 30 min, labeled with 3.7 Mbq ml–1 [35S]Met and [35S]Cys (Protein Labeling Mix; >37 Tbq mmol–1; GE Health Science) for 1 min, and chased with 200 µg ml–1 unlabeled methionine and cysteine. Aliquots of the cells were taken at appropriate intervals and mixed with trichloroacetic acid (final concentration, 5%), chilled on ice for 15 min, and centrifuged at 16,000 x g for 2 min. The pellets were washed with acetone and resuspended in 100 µl of SDS buffer (10% SDS, 1 mM EDTA, 50 mM Tris-HCl, pH 8.0). One milliliter of RIPA buffer (1% Triton X-100, 1% Na-deoxycholate, 0.1% SDS, 0.15 M NaCl, 50 mM Tris-HCl, pH 8.0, 0.1 mM EDTA) was added to each resuspended pellet, and the mixture was centrifuged. The supernatants were used for immunoprecipitation with anti-LasI and anti-RhlR sera by incubation overnight on ice. To collect the immunocomplexes, protein A-Sepharose beads (GE Health Science) were added, and the mixtures were incubated for 1 h at 4°C. After centrifugation, the pellets were washed twice with RIPA buffer and once with 10 mM Tris-HCl, pH 8.0, and finally dissolved in 40 µl of SDS sample buffer (21). A portion of each sample was analyzed by 15% SDS-PAGE. The radioactivity incorporated into LasI was visualized using Molecular Imager FX (Bio-Rad).
RNA extraction and quantitative, real-time reverse transcription (RT)-PCR. Bacterial cells were grown in L broth at 37°C to mid-exponential phase (OD600, 1.0 to 1.4) and for 24 h. A 0.4-ml aliquot of these cultures was added to 0.8 ml of RNAprotect bacterial reagent (Qiagen). Total RNA was isolated by using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Residual DNA was removed from the RNase-Free DNase Set (Qiagen).
Differential expression of genes was examined by quantitative, real-time RT-PCR using a QuantiTect Probe RT-PCR kit (Qiagen) according to the manufacturer's instructions with TaqMan probes and primer pairs designed with the Primer Express software package (ABI). The following probe and primer sequences were used: for lasI, sense primer, 5'-GCCCCTACATGCTGAAGAACA-3', antisense primer, 5'-CGAGCAAGGCGCTTCCT-3', and probe 5'-(6-carboxyfluorescein [FAM])CTTCCCGGAGCTTCTGCACGGC(6-carboxytetramethylrhodamine [TAMRA])-3'; for rhlI, sense primer, 5'-GCAGCTGGCGATGAAGATATTC-3', antisense primer, 5'-CGAACGAAATAGCGCTCCAT-3', and probe, 5'-(FAM)AGCCTGCAATGCGCCTGGTACCT(TAMRA)-3'; for rhlR, sense primer, 5'-AACGCGAGATCCTGCAATG-3', antisense primer, 5'-GCGCGTCGAACTTCTTCTG-3', and probe 5'-(FAM)TGAGCATCTCCGAGAGCACGGT(TAMRA)-3'; and for rplU, sense primer, 5'-TCACCGAAGGCGAATTCCT-3', antisense primer, 5'-TTCACGTCTTCGCCATTGG-3', and probe, 5'-(VIC)ATTTCGACCGCGTCCTGCTGGTT(TAMRA)-3'. To check for residual contaminating genomic DNA, control reactions without the reverse transcriptase mixture were analyzed in the same way. Prior to comparative analysis, the relative efficiency of each probe and primer pair was tested and compared with that of the probe and primer pair for ribosomal rplU (referred to as the normalizer gene) to ensure that the threshold cycle (CT) data analysis approach could be employed. The absolute value of the slope of the log input amount versus
CT was less than 0.1 for all comparisons, which allowed us to use the 
CT calculation to determine the relative levels of gene expression in all experimental cultures compared to the levels in controls. All reactions were performed in duplicate with an Mx3000P QPCR system (Stratagene), and the experiments were replicated at least three times.
|
|
|---|
A genetically defined lon mutant was constructed by inserting a gentamicin resistance gene into lon. The disruption in the resultant mutant strain, CS9008, was confirmed by immunoblotting; an antiserum specific for the E. coli Lon protein failed to react with a cell lysate from the mutant strain, whereas a band corresponding to approximately 89 kDa was detected in a cell lysate from the wild-type strain (data not shown). Disruption of the lon gene did not affect the increase in OD used to monitor bacterial growth (data not shown). However, the numbers of viable cells were always lower for the lon-disrupted mutant than for the wild-type cells. The lon-disrupted mutant exhibited a long-filament phenotype. Because filamentous cells have larger volumes than normal cells, the lon-disrupted cells gave ODs similar to those of the wild-type cells despite their lower viability.
During further phenotypic characterization of the lon-disrupted mutant, we found that the mutant overproduced a blue-green phenazine pigment, pyocyanin. At 24 h of incubation, the level of pyocyanin in the lon-disrupted cells was 4.4-fold higher than in the wild-type cells (data not shown). Pyocyanin is a synthesized by-product of the phzA1-phzG1 operon, expression of which is under the control of the RhlR/RhlI circuit of the QS system. Many genes are regulated by the RhlR/RhlI system. One of them, rpoS, was also more highly expressed in the lon-disrupted cells than in the wild-type cells (data not shown). These findings suggest that Lon protease may be involved in the expression of the RhlR/RhlI circuit.
Effect of lon disruption on the RhlR/RhlI system. To determine whether Lon protease is involved in regulating the RhlR/RhlI system, we initially compared C4-HSL production directed by RhlI in the wild-type and lon-disrupted mutant strains. The lactones were extracted with ethyl acetate and detected by a bioassay that depended on the induction of violacein in the C. violaceum mutant CV026 (47). Besides C4-HSL, P. aeruginosa produces C6-HSL, which is also synthesized by RhlI and is involved in the induction of violacein in CV026 (47). These molecules were separated by C18 reversed-phase thin-layer chromatography. Whereas, only a trace of C4-HSL was detected in the wild-type strain, the amount of C4-HSL was dramatically increased in the lon-disrupted mutant (Fig. 1); also, more C6-HSL was detected.
![]() View larger version (30K): [in a new window] |
FIG. 1. Effect of lon disruption on C4-HSL production by P. aeruginosa. The extracts from the supernatants of cultures of bacterial strains PAO1 (lon+) and CS9008 ( lon) were applied to C18 reversed-phase thin-layer plates and then developed with methanol/water (60:40 [vol/vol]). The spots were visualized with the C. violaceum reporter strain. C4-HSL (0.125 µmol) and C6-HSL (0.0125 µmol) were applied as HSL standards.
|
![]() View larger version (15K): [in a new window] |
FIG. 2. Expression of rhlI (A) and rhlR (B) in wild-type and lon-disrupted cells. Total RNAs were prepared from strains PAO1 (lon+), CS9008 ( lon), and CS9053 ( lon plon+) grown in L broth for 24 h 37°C. The levels of rhlI and rhlR transcripts were measured by quantitative, real-time RT-PCR and then normalized to rplU expression. The values represent the means and standard deviations of changes in comparison with the transcription level in PAO1.
|
![]() View larger version (15K): [in a new window] |
FIG. 3. Cellular levels and in vivo stabilities of RhlR. (A) Whole-cell extracts were prepared from strains PAO1 (lon+ rhlR+), CS9008 ( lon rhlR+), CS9011 (lon+ rhlR), and CS9053 ( lon plon+) grown in L broth for 24 h at 37°C and then separated on 15% SDS-polyacrylamide gels. The separated proteins were transferred to polyvinylidene difluoride membranes and then immunostained with anti-RhlR serum. (B) Cells of strains PAO1 (lon+) and CS9008 ( lon) were grown to exponential phase. They were pulse-labeled with [35S]methionine and [35S]cysteine for 1 min at 37°C and chased with unlabeled methionine and cysteine. Samples were taken at the times indicated, followed by immunoprecipitation of RhlR. (C) Quantification of the precipitated RhlR protein relative to the value at 1 min. Mean values and standard deviations of at least three independent experiments are given.
|
G protein provided by M. Churchill (12) was injected into a rabbit. The immunoblotting result is shown in Fig. 4A. Whereas a little LasI was present in the wild-type cells (lon+ lasR+), a large amount was detected in the lon-disrupted cells (
lon lasR+), suggesting that Lon modulates the cellular level of LasI. The accumulation of LasI in the lon-disrupted cells was completely suppressed by providing a functional lon gene in trans (data not shown). Therefore, it is possible that Lon modulates the LasR/LasI system.
![]() View larger version (17K): [in a new window] |
FIG. 4. Cellular levels of LasI (A) and relative levels of lasI expression (B). (A) Whole-cell extracts were prepared from strains PAO1 (lon+ lasR+), CS9008 ( lon lasR+), CS9013 (lon+ lasR), CS9027 ( lon lasR), and CS9038 (lon+ lasI) grown in L broth for 24 h at 37°C and then separated on 15% SDS-polyacrylamide gels. The separated proteins were transferred to polyvinylidene difluoride membranes and then immunostained with anti-LasI serum. (B) Total RNAs were prepared from strains PAO1 (lon+ lasR+), CS9008 ( lon lasR+), CS9013 (lon+ lasR), and CS9027 ( lon lasR) grown in L broth to exponential phase at 37°C. The levels of lasI transcript were measured by quantitative, real-time RT-PCR and then normalized to rplU expression. The values represent the means and standard deviations of changes in comparison with the transcription level in PAO1.
|
lasR cells. These results suggest that Lon may directly control the level of LasI by degrading it. To test whether Lon is involved in the turnover of LasI, we determined the in vivo half-life of this protein by pulse-labeling and chasing, followed by immunoprecipitation of LasI (Fig. 5A and B). Whereas LasI decayed with a half-life of 6.6 min in the wild-type cells, it did not seem to decay in the lon-disrupted cells even after a 20-min chase. The result indicates that Lon is involved in the turnover of LasI protein.
![]() View larger version (32K): [in a new window] |
FIG. 5. In vivo stabilities of LasI. (A) Cells of strains PAO1 (lon+) and CS9008 ( lon) were grown to exponential phase and pulse-labeled with [35S]methionine and [35S]cysteine for 1 min at 37°C and then chased with unlabeled methionine and cysteine. Samples were taken at the times indicated, followed by immunoprecipitation of LasI. (B) Quantification of the precipitated LasI protein relative to the value at 1 min. Mean values and standard deviations of at least three independent experiments are given.
|
![]() View larger version (32K): [in a new window] |
FIG. 6. Cellular levels of RhlR (A) and relative levels of rhlR expression (B) in the absence of a lasR and/or rhlI gene in cells. (A) Whole-cell extracts were prepared from strains PAO1 (lon+ lasR+ rhlI+), CS9008 ( lon lasR+ rhlI+), CS9013 (lon+ lasR rhlI+), CS9027 ( lon lasR rhlI+), CS9051 (lon+ lasR rhlI), and CS9062 ( lon lasR rhlI) grown in L broth for 24 h at 37°C and then separated on 15% SDS-polyacrylamide gel. The separated proteins were transferred to polyvinylidene difluoride membranes and then immunostained with anti-RhlR serum. (B) Total RNAs were prepared from strains PAO1 (lon+ lasR+ rhlI+), CS9008 ( lon lasR+ rhlI+), CS9013 (lon+ lasR rhlI+), CS9027 ( lon lasR rhlI+), CS9051 (lon+ lasR rhlI), and CS9062 ( lon lasR rhlI) grown in L broth to exponential phase at 37°C. The levels of lasI transcript were measured by quantitative real-time RT-PCR and then normalized to rplU expression. The values represent the means and standard deviations of changes in comparison with the transcription level in PAO1.
|
lon
lasR), even in the absence of lasR, compared to lon+ cells (lon+
lasR). Quantitative RT-PCR analysis of rhlR transcripts showed that the enhancement of rhlR transcription by lon disruption was not abolished by introducing the lasR-disrupted mutation (Fig. 6B). These results suggest that Lon may regulate expression of the RhlR/RhlI system via a LasR/LasI-independent pathway, in addition to the LasR/LasI-dependent pathway. We then looked for the LasR/LasI-independent pathway for controlling rhlR expression. Since the expression of rhlI is known to be autoregulated by the RhlR/RhlI system (13), it is possible that the accumulation of RhlR protein in lon-disrupted cells may depend on the RhlI protein. To evaluate this suggestion, we analyzed the effect of lon disruption on the cellular level of RhlR in both lasR- and rhlI-disrupted backgrounds. The result in Fig. 6A shows that the increase in the RhlR level caused by lon disruption was suppressed by additional disruption of rhlI. A double mutation in rhlI and lasR simultaneously abolished the increase of rhlR transcription by lon disruption (Fig. 6B). These results suggest that Lon also regulates the expression of rhlR by modulating RhlI, independently of the LasR/LasI system.
|
|
|---|
A previous report demonstrated that the expression of rhlR is mainly induced by the LasR/3-oxo-C12-HSL complex (31). However, the results in Fig. 6 show that the rhlR transcript and RhlR accumulate sufficiently even in lasR-disrupted cells after lon disruption. rhlR contains at least four transcription start sites, P1 to P4 (28). Expression from P1 and P4 is dependent on the LasR/3-oxo-C12-HSL complex, and that from P2 and P3 depends on other factors (28). It has been demonstrated that expression of rhlR starts from P2 in stationary-phase P. aeruginosa PAO1 in LB medium (28). For this reason, sufficient rhlR transcripts are produced to lead to the accumulation of RhlR protein in the lasR-disrupted background. The result in Fig. 6 also shows that the enhancement of rhlR expression by lon disruption is abolished by introducing an rhlI mutation, suggesting that RhlI possibly activates rhlR expression. The pathway through which RhlI is involved in the activation of rhlR transcription has not been elucidated. The previous transcriptome analysis demonstrated that the level of rhlR transcription activated by both C4-HSL and 3-oxo-C12-HSL was higher than that activated by 3-oxo-C12-HSL alone (36). Therefore, it can be assumed that the excess levels of C4-HSL synthesized by RhlI due to lon disruption could activate the transcription of rhlR.
HSL levels are crucial for controlling QS systems and are therefore subject to regulation by a number of additional mechanisms. For example, the expression of HSL synthase genes is affected by various regulatory factors. The transcription of lasI is activated by the LasR/3-oxo-C12-HSL complex, VqsR (20), and PprB (7) and is repressed by RsaL (6). The LasR/3-oxo-C12-HSL complex and PprB (7) regulate rhlI transcription positively, but RpoS (46), RpoN (40), and Dks (19) regulate it negatively. RsmA could be involved in the stability of lasI mRNA (33). In addition to transcriptional control, our present study indicates that posttranslational control of LasI is important in regulating the HSL level, leading to negative control of QS system expression in P. aeruginosa.
Very recently, Bertani et al. reported that P. putida Lon protease is involved in regulating the HSL-mediated QS system PpuR/PpuI (3). They assumed that Lon was involved in regulating ppuI expression via the degradation of a LuxR-type protein, PpuR, on the basis of a previous report in which Lon and another ATP-dependent protease, ClpXP, were shown to be involved in degrading TraR, a LuxR-type protein of A. tumefaciens, in the absence of HSL (48). However, Lon could not degrade TraR in the presence of HSL. In our results, lon disruption did not affect the stability of the LuxR-type protein RhlR in the presence (Fig. 3) or absence (data not shown) of HSL. Furthermore, another LuxR-type protein from Erwinia carotovora was shown to be more sensitive to trypsin in vitro in the absence of HSL (45), suggesting that this protein might be nonspecifically degraded by proteases. Since ppuI expression is involved in the positive-induction loop of the PpuR/PpuI system, Lon in P. putida might possibly regulate ppuI expression by degrading PpuI. All HSL-mediated QS systems in many gram-negative bacteria are constructed by LuxR/I-type proteins. Since Lon protease is conserved, it might be generally involved in regulating all HSL-mediated QS systems.
G protein, to N. Gotoh for supplying the plasmid pME6032, to Y. Tsuda for supplying plasmids pEX18 and pMS255, and to T. Ikeda for supplying the C. violaceum strain CV026 and C4-HSL. This research was supported in part by grants-in-aid for scientific research 16790252 and 19790313 to A.T. from the Ministry of Education, Culture, Sports, Science and Technology of the Japanese government.
Published ahead of print on 11 April 2008. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»