Previous Article | Next Article ![]()
Journal of Bacteriology, June 2008, p. 4313-4320, Vol. 190, No. 12
0021-9193/08/$08.00+0 doi:10.1128/JB.01963-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Departments of Pediatrics,1 Molecular Genetics and Microbiology,2 Pathology, Duke University Medical Center, Children's Health Center, Durham, North Carolina 277103
Received 17 December 2007/ Accepted 8 April 2008
|
|
|---|
|
|
|---|
Colonization of the genital tract is a necessary prerequisite for the development of Haemophilus cryptic genospecies urogenital infections, including urethritis, vaginitis, cervicitis, salpingitis, endometritis, and Bartholin's abscess, among others (33, 43, 51). Infected neonates likely acquire the Haemophilus cryptic genospecies during passage through the birth canal, leading to colonization of the respiratory tract and then respiratory distress and sepsis, typically within hours of birth (7, 33, 39, 52). Neonatal disease occurs most commonly in premature infants (14, 52).
Previous studies have reported a correlation between the appearance of peritrichous pilus-like structures in Haemophilus cryptic genospecies strains and an ability to adhere to HeLa cells and, to a lesser extent, Hep-2 cells (17, 33, 38). Initial work suggested that these fibers might be related to H. influenzae hemagglutinating pili, which are encoded by the hif gene cluster, which consists of five genes designated hifA, hifB, hifC, hifD, and hifE. In particular, PCR analysis has demonstrated that a subset of Haemophilus cryptic genospecies isolates contain hif-like genes (4, 9, 17). However, antisera against the H. influenzae HifA and HifE proteins are nonreactive with these isolates (9). Furthermore, the short, thin surface fibers observed in the Haemophilus cryptic genospecies differ in appearance from H. influenzae hemagglutinating pili, which are longer and thicker (4). Taken together, these observations (i) suggest that Haemophilus cryptic genospecies surface fibers are distinct from H. influenzae hemagglutinating Hif pili and (ii) raise the possibility that a novel molecule accounts for Haemophilus cryptic genospecies adherence.
In this study, we sought to elucidate the genetic determinants of Haemophilus cryptic genospecies adherence. By transposon mutagenesis, we identified a new locus that encodes a trimeric autotransporter adhesin which we designated Cha. Disruption of this locus resulted in loss of adherence. Further analysis confirmed that the Cha C terminus trimerizes in the outer membrane and is both necessary and sufficient for the surface presentation of a heterologous passenger domain. Of note, the Cha-encoding locus appears to be uniformly conserved among isolates that belong to the Haemophilus cryptic genospecies, perhaps accounting for their tissue tropism and distinctive disease associations.
|
|
|---|
Bacterial strains and plasmid construction. The bacterial strains and plasmids used in this study are described in Table 1. Haemophilus cryptic genospecies strain 1595 exhibits phase-variable adherence, allowing enrichment of adherent variants for loss of adherence and enrichment of nonadherent variants for reacquisition of adherence with epithelial cell monolayers. In the process of screening revertant adherent variants for loss of adherence, we identified a clone designated 1595-A9 that is stably adherent to Chang cells and refractory to further phase variation.
|
View this table: [in a new window] |
TABLE 1. Strains and plasmids used in this study
|
Plasmid pHAT::HiaSS contains the Hia promoter and signal peptide coding sequence (amino acids 1 to 49) fused to the HAT epitope tag and was generated previously (49). Plasmid pHAT::Hia(P-49/50-779) (also called pHiaPD) encodes the HAT-tagged Hia signal peptide (amino acids 1 to 49) fused to residues 50 to 779 of the passenger domain of Hia (containing both Hia binding domains). To generate this plasmid, pHAT::HiaSS was digested with SalI and BamHI and ligated to a SalI/BamHI-digested fragment amplified from H. influenzae strain 11 that encodes Hia residues 50 to 779. Plasmid pHAT::Hia(P-49/50-779/977-1098) (also called pHiaPD-HiaC') encodes the Hia signal peptide and passenger domain (amino acids 50 to 779) fused to the Hia translocator domain (amino acids 977 to 1098). To generate this plasmid, pHAT::Hia(P-49/50-779) was digested with SacI and EcoRI and ligated to a SacI/EcoRI-digested fragment that encodes the C-terminal 122 residues of Hia (amino acids 977 to 1098). Chimeric plasmid pHAT::Hia(P-49/50-779)-Cha(1491-1610) (also called pHiaPD-ChaC') encodes a chimeric protein containing the Hia signal peptide and passenger domain fused to the Cha C terminus. To generate this plasmid, pHAT::Hia(P-49/50-779) was digested with SacI and EcoRI and ligated to a SacI/EcoRI-digested fragment that encodes the C-terminal 120 residues of Cha (amino acids 1491 to 1610) amplified by PCR from pTOPO::Cha with primers GGGAGCTCATCGGTTCACAAGGTAATGAACGTCGA and GGAATTCTTACCATTGGTAACCAATACCAGCACC containing SacI and EcoRI restriction sites, respectively. Plasmid pHAT::ChaC' encodes the C-terminal 120 amino acids and was generated by ligating the SacI/EcoRI-digested Cha fragment that encodes Cha amino acids 1491 to 1610 to SacI/EcoRI-digested pHAT::HiaSS.
Molecular biology techniques. DNA ligations, restriction endonuclease digestions, and gel electrophoresis were performed according to standard techniques (40). Plasmids were introduced into E. coli by electroporation (12). In H. influenzae, transformation was performed by the MII/MIV method of Herriott et al. (21). In the Haemophilus cryptic genospecies, transformation was accomplished by incubating a 500-µl suspension of bacteria in Schaedler broth with approximately 1 µg of transforming DNA at room temperature for 30 min, supplementing it with clarified horse blood and 2 µg/ml NAD, and then incubating it for 1 h at 37°C with aeration. Ultimately, transformation reaction mixtures were plated onto chocolate agar containing appropriate antibiotics to select for transformants.
Generation of Cha antiserum.
A 1,212-bp fragment of the cha gene that encodes residues 70 to 473 from the N-terminal region of Cha was amplified by PCR with primers CAGAATTCGCCTCTTTTACAGATAACTACACTGAGGGT and GAGAATCCCTAACCTGTCGCTGTCTTGCCTTTATTACC. This fragment was digested with EcoRI and BamHI and then ligated to EcoRI/BamHI-digested pGEX-6P-1 (GE Healthcare, Piscataway, NJ), generating pGEX::Cha70-473, which was transformed into E. coli DH5
. Cultures of DH5
/pGEX::Cha70-473 were incubated at 37°C to an optical density of 0.4 to 0.5, and then expression of the glutathione S-transferase (GST)-Cha fusion protein was induced with 0.1 mM isopropyl-β-D thiogalactopyranoside at 30°C for 4 h. Purification of the GST-Cha protein was performed as described previously, with minor modifications (53). Briefly, cells were harvested and lysed by sonication in lysis buffer (5 mM EDTA and 1 mM Pefabloc SC [Roche] in phosphate-buffered saline, pH 7.4), and the protein was isolated from clarified supernatant by affinity chromatography with glutathione-Sepharose beads (Pierce) according to the manufacturer's instructions. Following extensive washing with phosphate-buffered saline, the Cha fragment was cleaved from the GST moiety with 80 U/ml PreScission Protease (Amersham Pharmacia Biotech) in cleavage buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, pH 7.5) and injected into a guinea pig to raise a polyclonal antiserum that is reactive with formic acid-denatured Cha (Cocalico Biologicals, Inc.).
Transposon library construction.
To create a transposon library in Haemophilus cryptic genospecies strain 1595, chromosomal DNA was prepared from a stably adherent variant of strain 1595 (designated 1595-A9) with a Wizard genomic DNA kit (Promega, Madison, WI) according to the manufacturer's instructions and mutagenized as described by Hendrixson et al. (20), with modifications as described by Kehl-Fie and St. Geme (23). Briefly, DNA was mutagenized with Himar1 transposase and pFalcon2, a plasmid that contains a minitransposon derivative called solo, which carries the aphA3 kanamycin resistance gene. In preparation for transformation, bacteria were grown for 16 h on chocolate agar and resuspended to an optical density at 600 nm of 0.8 in Schaedler broth (BD Biosciences). Aliquots of bacteria and mutagenized DNA were mixed in Eppendorf tubes, incubated while standing for 30 min at room temperature, supplemented with 2% horse plasma and NAD, then incubated for 1 h at 37°C with aeration. Transformants were recovered by plating on chocolate agar containing 50 µg/ml kanamycin. Mutants obtained after transformation with DNA from each of 10 transposition reactions were combined to create a library of
20,000 individual random transposon mutants. To assess the randomness of transposon insertion, chromosomal DNA was extracted from individual transformants, digested with BglII, and examined by Southern hybridization with the aphA3 cassette from pFalcon2 as a probe.
Adherence assays. Quantitative adherence assays were performed with epithelial cells as previously described (47). Percent adherence was calculated by dividing the number of adherent CFU per epithelial cell monolayer by the number of inoculated CFU. Each strain was examined in triplicate in a given assay, and each assay was performed a minimum of three times. For qualitative adherence analysis, epithelial cell monolayers with associated bacteria were stained with Giemsa stain and examined by light microscopy (46). Tissue culture cells included Chang cells (human conjunctiva, Wong-Kilbourne derivative, clone 1-5c-4; ATCC CCL-20.2), Detroit 562 cells (human pharyngeal carcinoma; ATCC CCL-138), HeLa cells (human cervical epidermoid carcinoma; ATCC CCL-2), and HEC-1-B cells (human endometrium; ATCC HTB-113). Chang cells were maintained in modified Eagle medium with Earle's salts and nonessential amino acids. Detroit 562, HeLa, and HEC-1-B cells were maintained in the same medium with addition of 1 mM sodium pyruvate. All media were supplemented with 10% fetal bovine serum.
Identification of nonadherent transposon mutants. The transposon mutant library of Haemophilus cryptic genospecies strain 1595 was resuspended in Schaedler broth to a density of approximately 3 x 1010 CFU/ml. A 10-µl volume of this bacterial suspension was inoculated onto confluent Chang epithelial cell monolayers in 24-well plates. To facilitate bacterial contact with the epithelial cell monolayers, plates were centrifuged at 165 x g for 5 min. After a 25-min incubation at 37°C in 5% CO2, the supernatant (containing nonadherent bacteria) was transferred to a new confluent Chang cell monolayer. Passage of supernatant bacteria over confluent monolayers was repeated six times to enrich for nonadherent mutants, and then dilutions of the supernatant were plated to yield individual colonies (15). To confirm that the loss of adherence in individual mutants was due to the transposon insertion, chromosomal DNA was extracted from these mutants and retransformed into parent strain 1595-A9. The resulting transformants were then screened for the ability to adhere to Chang cells.
Localization of Mariner insertion by arbitrary PCR. Localization of the solo insertion among the stably nonadherent mutants was achieved by arbitrary PCR as described previously (23). The sequence flanking the aphA3 gene (solo) insertion was examined for homology with the genomic sequence of strain 1595 (E. Mardis, R. Fulton, A. J. Sheets, and J. W. St. Geme III, unpublished data) by BLAST analysis.
Protein analysis. Western blot analysis of outer membrane proteins was performed as described previously (10). Outer membrane fractions of whole-cell bacterial sonicates were prepared on the basis of Sarkosyl insolubility as described by Carlone et al. (8). Where noted, outer membrane fractions were treated with 95% formic acid overnight (48). Proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Western blots were probed with a guinea pig polyclonal antiserum raised against an N-terminal fragment of Cha or a rabbit polyclonal antiserum raised against the HAT epitope (Clontech).
Southern hybridization. Approximately 1 µg of chromosomal DNA from each strain was digested with BglII, separated by agarose gel electrophoresis, and transferred to nitrocellulose. The DNA probe was generated by PCR amplification of the cha locus from Haemophilus cryptic genospecies strain 1595 with primers TATGGCAAAATACCATACGCCACTCC and AAGAGCCATATGTTTACCAAATAAATGACAAAAATACCGCTC. The probe was labeled with the ECL nucleic acid labeling system (GE Healthcare, Piscataway, NJ) and incubated with the UV-cross-linked membrane at 42°C in blocking solution. The membrane was washed twice with 0.5x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate, pH 7.4) containing 0.4% sodium dodecyl sulfate at 55°C for 10 min and rinsed twice with 2x SSC at room temperature for 5 min. Hybridization was detected with Supersignal West Pico (Pierce, Rockford, IL).
Nucleotide sequence accession number. The sequence corresponding to the Haemophilus cryptic genospecies strain 1595 cha gene has been deposited in the GenBank database and assigned accession number EU309721.
|
|
|---|
![]() View larger version (17K): [in a new window] |
FIG. 1. Adherence of Haemophilus cryptic genospecies strains 420, 422, 1595, and 1673 to Chang, Detroit 562, HEC-1-B, and HeLa epithelial cells. Adherence was measured after incubating bacteria with epithelial cell monolayers for 30 min and calculated by dividing the number of adherent CFU per epithelial cell monolayer by the number of inoculated CFU. Adherence values represent the mean of measurements from representative experiments performed in triplicate. Error bars represent standard errors.
|
Identification of Mariner transposon mutants defective in adherence. To define the molecular determinants of adherence by the Haemophilus cryptic genospecies, we focused on strain 1595 on the basis of genomic sequence availability and the adherence properties of this isolate. With a stably adherent variant called strain 1595-A9 (Mardis et al., unpublished), we constructed a Mariner transposon library. Southern hybridization analysis of 11 mutants revealed that the solo transposon was inserted randomly into the chromosome (data not shown). To identify nonadherent mutants, we enriched the library for nonadherence by passing the library over Chang epithelial cell monolayers a total of six times. Following enrichment, we picked 32 individual colonies and screened these clones individually for adherence to Chang cells as assessed by Giemsa staining and light microscopy. Among these 32 colonies, 16 were nonadherent. To confirm that the lack by adherence by these 16 mutants was a consequence of the solo transposon insertion, chromosomal DNA was extracted from each of these mutants and transformed into parent strain 1595-A9 to select for kanamycin-resistant transformants resulting from a double-crossover event. In all cases, the retransformants were nonadherent.
To localize the solo transposon insertions in the nonadherent mutants, we began by performing arbitrary PCR on two of the mutants and then sequencing the transposon junctions. The sequences were used to scan the genome sequence of strain 1595 for associated open reading frames, and the insertions in both mutants were localized to the same novel open reading frame. With this sequence information, we performed directed PCR on the remaining 14 mutants and observed that all of the insertions localized to eight distinct positions either within or immediately upstream of the same open reading frame, suggesting that some mutants represented siblings. On the basis of the strain 1595 genome sequence, the single disrupted open reading frame is flanked upstream by a putative thioredoxin gene and a cytochrome oxidase gene and downstream by two genes with unknown homology or function. We designated the disrupted gene cha for cryptic haemophilus adhesin (Fig. 2A).
![]() View larger version (17K): [in a new window] |
FIG. 2. Genomic organization of the cha locus and domain architecture of the Cha protein. (A) Arrows indicate the locations of transposon insertions among the nonadherent mutants (1595cha). The disrupted open reading frame, which was designated cha for cryptic haemophilus adhesin, is flanked upstream by putative thioredoxin and cytochrome oxidase genes and is flanked downstream by two genes of unknown function. (B) The domain organization of Cha from strain 1595 was evaluated with SignalP (3) and Pfam (2) analyses.
|
Confirmation that Cha is essential for Haemophilus cryptic genospecies adherence. To verify that Cha is essential for the broad-range adherence of the Haemophilus cryptic genospecies, we examined the level of adherence of a representative transposon mutant (1595cha) to each of the genital and respiratory cell lines used in this study. As shown in Table 2, the mutant demonstrated negligible adherence levels compared to the parent strain (1595-A9). To confirm that Cha is an adhesin, we cloned the cha gene into plasmid pLS88P and then introduced the resulting plasmid into both a nonadherent laboratory strain of H. influenzae called DB117 and Haemophilus cryptic genospecies strain 420, which is stably nonadherent. (The cha gene in this recombinant plasmid contains a spontaneous internal deletion of the coding sequence for residues 1138 to 1389.) As shown in Fig. 3, Western analysis with an antiserum against an N-terminal fragment of Cha demonstrated reactivity with formic acid-denatured outer membrane fractions from 1595-A9, 420/pCha, and DB117/pCha and no reactivity with 1595cha, 420, and DB117/pLS88P. The size difference of the monomeric Cha protein among 1595-A9 (lane 1), 420/pCha (lane 4), and DB117/pCha (lane 6) is likely due to the absence of repeats in the recombinant strains. As shown in Table 2, both DB117/pCha and 420/pCha were capable of efficient adherence to Chang and HeLa cells, similar to adherence by strain 1595 and demonstrating that Cha is adhesive in spite of the deletion of the nine contiguous 28-residue repeats.
|
View this table: [in a new window] |
TABLE 2. Cha-mediated adherence of Haemophilus cryptic genospecies and H. influenzae to genital and respiratory epithelial cells
|
|
View larger version (14K): [in a new window] |
FIG. 3. Western analysis of Haemophilus cryptic genospecies strains 1595-A9. 1595cha, 420, and 420/pCha and H. influenzae strains DB117/pLS88P and DB117/pCha for expression of Cha. Outer membrane samples were denatured with formic acid and examined by Western analysis with an antiserum that was raised against Cha residues 70 to 473 and diluted 1:1,000. Samples were loaded as follows: lane 1, 1595-A9; lane 2, 1595cha; lane 3, 420; lane 4, 420/pCha; lane 5, DB117/pLS88P; lane 6, DB117/pCha. Arrowheads indicate monomeric Cha protein.
|
. Outer membrane fractions of DH5
/pChaC' were examined by Western blot analysis with antiserum against the HAT epitope tag. As shown in Fig. 4A, under standard denaturing conditions, the Cha C terminus migrated at
48 kDa, approximately three times the predicted molecular mass. Following more stringent denaturation with formic acid, the protein migrated at
16 kDa, the predicted molecular mass. This result demonstrated that the final 120 amino acids of Cha are capable of forming a trimeric structure in the bacterial outer membrane, characteristic of trimeric autotransporters.
![]() View larger version (15K): [in a new window] |
FIG. 4. Evidence that Cha is a trimeric autotransporter. (A) Western blot assay of outer membrane fractions of E. coli DH5 /pChaC' without (–) or with (+) formic acid denaturation by probing with anti-HAT antibody. (B) Quantitative adherence assay with Chang cells examining the ability of the Cha C terminus to present the Hia passenger domain on the bacterial cell surface in a functional form. Plasmid pHiaPD-HiaC' encodes the Hia passenger domain fused to the Hia C terminus, plasmid pHiaPD-ChaC' encodes a chimeric protein with the Hia passenger domain fused to the Cha C terminus, plasmid pChaC' encodes only the C terminus of Cha, and plasmid pHiaPD encodes only the passenger domain of Hia. Error bars represent standard errors.
|
(DH5
/pHiaPD-ChaC'). As shown in Fig. 4B, DH5
/pHiaPD-ChaC' was capable of high-level adherence to Chang cells, similar to the adherence of a control strain expressing the Hia passenger domain fused to the Hia C terminus (DH5
/pHiaPD-HiaC'). E. coli expressing either the Hia passenger domain (DH5
/pHiaPD) or the Cha C terminus (DH5
/pCha') alone did not adhere to Chang cells. Evidence of adherence by DH5
/pHiaPD-ChaC' demonstrates that the Cha C terminus was able to present the Hia passenger domain stably on the bacterial cell surface in a functional form. Considered together, these data demonstrate that Cha is a member of the trimeric autotransporter family. The adhesin is conserved among isolates that belong to the cryptic genospecies. To assess the prevalence of cha among Haemophilus cryptic genospecies isolates, we examined a collection of nine clinical isolates by Southern hybridization, probing with the PCR-amplified cha gene from strain 1595. As shown in Fig. 5, all nine strains had hybridizing fragments. In contrast, H. influenzae strains 11 and 12 failed to hybridize.
![]() View larger version (27K): [in a new window] |
FIG. 5. Southern hybridization analysis by probing for the cha gene among Haemophilus cryptic genospecies isolates. Chromosomal DNA was isolated from nine cryptic genospecies strains and two H. influenzae strains and digested to completion with BglII. An ECL-labeled probe consisting of the full-length cha PCR amplicon from strain 1595 was used for hybridization.
|
|
|
|---|
Adhesins classified as trimeric autotransporters have a characteristic head-stalk-anchor domain architecture and are composed of an N-terminal signal peptide, an internal passenger domain that harbors adhesive activity, and a short C-terminal autotransport domain that anchors the protein in the membrane (24, 25). On the basis of studies of YadA and Hia, it appears that stable trimer formation is required for normal folding, stability, and adhesive activity of trimeric autotransporters (10). The highly conserved C-terminal anchor domain is important for oligomerization and contains 4 transmembrane β strands, which assemble into a 12-stranded β barrel that is filled by the C-terminal end of the passenger domain (22, 25). In this study, we demonstrated that the Cha C-terminal region encompassing residues 1491 to 1610 is inserted into the bacterial outer membrane in a trimeric form. This trimer is stable when exposed to heat and detergent and requires formic acid denaturation for dissociation into individual monomers. Consistent with studies of other trimeric autotransporters, we found that the Cha C terminus was capable of presenting a heterologous passenger domain on the bacterial surface in a functional form. In particular, we demonstrated that E. coli expressing a chimeric protein containing the Hia passenger domain fused to the Cha C terminus was capable of adherence to cultured epithelial cells.
While the anchor domains of trimeric autotransporters are highly homologous, the passenger domains are diverse and frequently have repetitive domains in various combinations. Repetitive sequences within the passenger domains are believed to facilitate recombination of domains, thereby altering the specificity of bacterial adherence to host epithelium, extracellular matrix proteins, and in some cases circulating complement factors or immunoglobulins. In YadA, four Hep_Hag repeats (composed of degenerate 14-residue repeats sometimes referred to as NSVAIGXXS motifs) in the amino-terminal half of the passenger domain form a β-roll head domain (30). The head domain is linked to the coiled-coil stalk by a neck adaptor domain composed of a HIM sequence motif (30). The association of Hep_Hag repeats and HIM motifs is common to a number of bacterial adhesins, including the Moraxella Hag (5) and UspA1 proteins (22), Xanthomonas XadA (35), Burkholderia BuHA (50), and Bartonella BadA (36). Interestingly, the Hep_Hag repeats present in YadA are required for binding to collagen (30) while the Hep_Hag repeats in Hag are not important for Hag-mediated adherence to either collagen or epithelial cells (5). Additionally, the role of a single HIM motif as a head-to-stalk adaptor domain seems be unique to the YadA and UspA1 proteins. The XadA, Hag, and BuHA proteins contain scattered clusters of Hep_Hag repeats and multiple noncontiguous HIM motifs throughout the passenger domain. Similar to these proteins, the Haemophilus cryptic genospecies Cha protein contains 17 clustered Hep_Hag repeats and four scattered HIM motifs, including two HIM motifs that are linked to unique 14-residue repeats.
Cha is also characterized by contiguous unique 28-amino-acid repeats. On the basis of the size and location of this alanine-rich repeat region in the passenger domain and the characteristic architecture of trimeric autotransporters, it is likely that this region forms the stalk domain and is responsible for extending binding domains away from the bacterial cell surface. The genomic sequence of strain 1595 suggests that nine full repeats plus a 10-residue partial repeat represent the wild-type number of repeats. However, it is likely that the number of repeat units varies, perhaps explaining the small size differences of the cha-hybridizing genomic fragments among cryptic genospecies strains (Fig. 5). Changes in repeat number may alter the adhesive activity of Cha, although among our isolates we did not observe a clear correlation between a capacity for adherence to Chang cells and fragment size in our Southern analysis. Changes in the repeat domain may play an additional role in antigenic variation as a means for evading the immune system during invasive systemic disease, a phenomenon observed with the alpha C protein in group B streptococci (18, 19).
We found that the cha locus was uniformly conserved among our collection of nine strains that belong to the cryptic genospecies. In contrast, a cha-hybridizing genomic fragment was not detected in either H. influenzae strain 11 or 12. The absence of cha among five additional H. influenzae strains (86-028NP, Rd KW20, R2866, PittEE, and PittGG) for which genomic sequencing has been completed suggests that cha is uniformly lacking among H. influenzae strains and may be unique to the cryptic genospecies. With this information in mind, we speculate that the cha locus was acquired after H. influenzae and the Haemophilus cryptic genospecies diverged from each other evolutionarily and contributes to the apparent adaptation of the Haemophilus cryptic genospecies to the urogenital tract.
It is unclear if Cha corresponds to the peritrichous fibers that have been detected on the surface of some strains of the Haemophilus cryptic genospecies. On the one hand, a variety of investigators have observed a correlation between the presence of fibers and the capacity for adherence among diverse isolates of the Haemophilus cryptic genospecies. On the other hand, we have recovered one variant of Haemophilus cryptic genospecies strain 1595 that possesses fibers and lacks Cha and another variant that lacks fibers and expresses Cha (Sheets and St. Geme, unpublished). In addition, examination of strains DB117/pCha and 420/pCha by transmission electron microscopy revealed no fibers (data not shown). In future work, we will attempt to address this question definitively.
In this paper, we report the identification of Cha, a trimeric autotransporter protein that is the major adhesin of the Haemophilus cryptic genospecies and presumably plays a critical role in the colonization of the maternal genital tract and the neonatal respiratory tract. In ongoing work, we are examining whether Cha has adhesive activity that extends beyond adherence to epithelial cells, perhaps mediating binding to extracellular matrix proteins and facilitating binding of circulating host proteins, as observed with other members of the trimeric autotransporter family.
Published ahead of print on 18 April 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»