Previous Article | Next Article 
Journal of Bacteriology, July 2008, p. 4624-4631, Vol. 190, No. 13
0021-9193/08/$08.00+0 doi:10.1128/JB.01957-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Signal Pathway in Salt-Activated Expression of the Salmonella Pathogenicity Island 1 Type III Secretion System in Salmonella enterica Serovar Typhimurium 
Hideaki Mizusaki,1,2
Akiko Takaya,3
Tomoko Yamamoto,3 and
Shin-Ichi Aizawa1,2*
Department of Life Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan,1
CREST, Japan Science & Technology Agency (JST), 3-10-23 Kagamiyama, Higashi-Hiroshima 739-0046, Japan,2
Department of Microbiology & Molecular Genetics, Graduate School of Pharmaceutical Sciences, Chiba University, 1-33 Yayoi, Inage, Chiba 263-8522, Japan3
Received 17 December 2007/
Accepted 11 April 2008

ABSTRACT
Salmonella enterica serovar Typhimurium secretes virulence factors
for invasion called Sip proteins or Sips into its hosts through
a type III secretion system (T3SS). In the absence of a host,
S. enterica induces Sip secretion in response to sucrose or
simple salts, such as NaCl. We analyzed induction of host-independent
Sip secretion by monitoring protein secretion by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), assembly
of needle complexes by electron microscopy, and transcription
of virulence regulatory genes by quantitative reverse transcriptase
PCR (real-time PCR). SDS-PAGE showed that addition of sucrose
or simple salts, such as NaCl, to the growth medium induced
Sip secretion without altering flagellar protein secretion,
which requires a distinct T3SS. Electron microscopy confirmed
that the amount of secreted Sips increased as the number of
assembled needle complexes increased. Real-time PCR revealed
that added sucrose or NaCl enhanced transcription of
hilA,
hilC,
and
hilD, which encode known regulators of
Salmonella virulence.
However, epistasis analysis implicated HilD and HilA, but not
HilC, in the direct pathway from the salt stimulus to the Sip
secretion response. Further analyses showed that the BarA/SirA
two-component signal transduction pathway, but not the two-component
sensor kinase EnvZ, directly activated
hilD and
hilA transcription
and thus Sip secretion in response to either sucrose or NaCl.
Finally, real-time PCR showed that salt does not influence transcription
of the BarA/SirA-dependent
csrB and
csrC genes. A model is proposed
for the major pathway in which sucrose or salt signals to enhance
virulence gene expression.

INTRODUCTION
Animal pathogens, such as
Salmonella, pathogenic
Escherichia coli,
Shigella, or
Yersinia spp., secrete virulence proteins
into hosts using specialized protein secretion systems called
type III secretion systems (T3SS) (
21). Different species regulate
T3SS differently. For instance, the level of type III secretion
from
Shigella spp. remains low until secretion is triggered
by close contact with host tissues in vivo, a process that can
be mimicked by low-speed centrifugation of a mixture of bacterial
and host cells (
50) or by addition of Congo red to bacterial
cells (
6,
36). On the other hand, type III secretion from
Salmonella enterica serovar Typhimurium is triggered by interaction with
a host or by manipulation of the growth conditions (
14). Under
physiological conditions,
S. enterica serovar Typhimurium cells
spontaneously secrete significant amounts of proteins into the
medium. In one study, for example, 80% of the secreted proteins
(called Sip proteins or Sips) were found in the infection medium
(
13). Among these secreted proteins, five flagellar proteins
(flagellin, hook protein, and three hook-associated proteins)
and five virulence factors (SipA, SipB, SipC, SipD, and InvJ)
are abundant enough to stain with Coomassie brilliant blue (
29).
Secretion of these two groups of proteins is facilitated by
a subset of the flagellar genes (
2,
37) and by a subset of
Salmonella pathogenicity island 1 (SPI1) genes (
24), respectively. Each
subset of genes encodes a distinct T3SS that has common structural
features (
1,
22).
The regulatory network responsible for ensuring proper expression, assembly, and function of the flagellar T3SS has been well established (2, 35). In contrast, the network responsible for controlling expression, assembly, and function of the SPI1 T3SS is still being actively investigated. It is quite clear that HilA is the proximal activator of SPI1 genes (4, 7, 8, 26, 33, 34, 43, 49) and that hilA transcription is controlled by two other regulators, HilD and HilC (3, 9, 10, 11, 19, 37, 39, 41, 42, 47, 52). These regulators, in turn, have been reported to be controlled by four two-component signal transduction pathways. PhoQ-PhoP and PhoR-PhoB both activate hilE, which encodes an inhibitor of hilD (9); EnvZ-OmpR activates hilD (32, 38); and BarA-SirA activates hilD, hilC, and hilA (31, 48). How the BarA-SirA pathway activates SPI1 is controversial; it has been proposed that BarA-SirA acts directly on hilC and hilA but indirectly through the Csr system to activate hilD (30) (Fig. 1).
Although the flagellar and SPI1 regulatory networks are generally
independent of each other, evidence showing some coordinated
expression has accumulated. In
S. enterica serovar Typhimurium,
for example, expression of virulence genes is regulated by
fliZ,
which encodes a flagellar activator (
25). In
S. enterica serovar
Typhi, SPI1 gene expression depends on the flagellar sigma factor
FliA (
16). Moreover, flagellar and SPI1 genes are reciprocally
regulated by the
rtsA and
rtsB genes (
17,
18). Fis, a DNA binding
protein, is required for full expression of both SPI1 genes
and flagellar genes (
28,
52). Finally, the ATP-dependent protease
Lon cleaves the SPI1 regulators HilC and HilD and the flagellar
master regulator FlhC-FlhD, resulting in suppression of both
systems (
11,
12,
45,
46,
47).
Many environmental factors have been reported to influence SPI1 gene expression and/or Sip secretion, including low oxygen tension, neutral pH, acetate and other short-chain fatty acids, cationic peptides, and bile (4). To the best of our knowledge, only two reports have directly addressed the effect of osmolarity on SPI1 gene expression. Galan and Curtiss (23) explored the effect of high concentrations of salt (300 mM and higher) and concluded that the osmoinducibility of invA depends on changes in DNA supercoiling but not on the osmoregulator ompR, while Bajaj and coworkers (8) showed that osmolarity indirectly activates SPI1 gene expression and that the process is mediated by HilA.
In this paper, we carefully document enhanced Sip secretion in response to exposure to diverse salts and sucrose and a wide range of NaCl concentrations. In the process, we identify two distinct responses, one response that occurs upon exposure to high concentrations of salt and appears to involve DNA supercoiling and another response that occurs upon exposure to lower concentrations. We further demonstrate that the latter response requires several of the known SPI1 regulators, most notably HilA and HilD. We also show that this response requires the BarA-SirA two-component signal transduction pathway system. We propose a simple model that can serve as a firm foundation upon which to base further studies of SPI1 regulation.

MATERIALS AND METHODS
Strains and growth conditions.
The strains used in this study are listed in Table
1. Mutant
strains were derived mainly from SJW1103, a wild-type strain
of
S. enterica serovar Typhimurium. DW269 (NK182
envZ::Cm) was
a kind gift from Linda Kenny. The
envZ,
barA, and
sirA mutations
were transferred into SJW1103 by P1 transduction (
44).
Except where indicated otherwise, cells were grown for 4 h at
37°C in 5 ml of salt-free TY medium (1% [wt/vol] tryptone
and 0.5% [wt/vol] yeast extract) or TY medium supplemented with
salts or sucrose at the indicated concentrations.
SDS-PAGE.
The proteins secreted into media were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After the cells were removed by low-speed centrifugation (13,200 x g for 20 min), 1 ml of each supernatant was placed into an Eppendorf tube, mixed with prechilled 25% (wt/vol) trichloroacetic acid (TCA) (final concentration, 6%), chilled on ice for 15 min, and centrifuged at 10,000 x g for 10 min. The pellets were suspended with 0.3 ml of acetone and centrifuged at 10,000 x g for 10 min. Acetone washing was repeated twice to remove all of the TCA from the precipitates. Dry pellets were dissolved in SDS sample buffer. SDS-PAGE was carried out using a mini-gel kit from Bio-Rad Laboratories, Inc. The acrylamide concentration of the gels was 12.5%. Gels were stained with Coomassie brilliant blue.
Observation of osmotically shocked cells by electron microscopy.
Cells collected from 5 ml of culture were resuspended in 100 µl of a sucrose solution (20% [wt/vol] sucrose, 5 mM EDTA; pH 7). After 5 min of incubation at room temperature, the suspension was abruptly diluted with 10 ml prechilled water. Intact cells were removed by low-speed centrifugation, and the osmotically shocked cells that remained in the supernatant were collected by high-speed centrifugation (15,000 x g, 20 min). Samples were negatively stained with 2% (wt/vol) phosphotungstic acid (pH 7.0) and observed with a JEM-1200EXII electron microscope (JEOL, Tokyo, Japan). Micrographs were taken at an accelerating voltage of 80 kV.
Quantitative reverse transcriptase PCR (real-time PCR) and calculation of relative expression levels.
All PCRs were performed using an Mx3000P quantitative PCR system (Stratagene) by following the manufacturer's instructions. For each PCR, the reaction mixture (total volume, 25 µl) was prepared using FullVelocity SYBR green quantitative reverse transcriptase PCR master mixture (Stratagene) with 0.1 µg/µl total RNA, 10 pmol of the PCR forward primer, 10 pmol of the PCR reverse primer, and the supplied ROX reference dye (Stratagene). The PCR cycling conditions were an initial denaturation step of 30 s at 95°C, followed by 40 PCR cycles of denaturation for 10 s at 95°C and annealing/extension for 30 s at 60°C. The relative amplification for expression of the genes in the presence of salt compared to that in a salt-free culture was automatically calculated.
The following primers were used: for the 16S rRNA gene, forward primer TGTAGCGGTGAAATGCGTAG and reverse primer CAAGGGCACAACCTCCAAG (predicted length of the transcript, 161 bp); for hilA, forward primer CATGGCTGGTCAGTTGGAG and reverse primer CGTAATTCATCGCCTAAACG (predicted length of the transcript, 150 bp); for hilC, forward primer GGACTTGTTGCCAGGGATG and reverse primer TGACCATTTGCGGGTGAG (predicted length of the transcript, 241 bp); for hilD, forward primer ACTCGAGATACCGACGCAAC and reverse primer CTTCTGGCAGGAAAGTCAGG (predicted length of the transcript, 129 bp); for hilE, forward primer CAGAGACACCAACGAAATGG and reverse primer AAACCTTTGATCCGGCTTTC (predicted length of the transcript, 159 bp); for sipC, forward primer CTGTGGCTTTCAGTGGTCAG and reverse primer TGCGTTGTCCGGTAGTATTTC (predicted length of the transcript, 150 bp); for csrA, forward primer CTGGACTGCTGGGATTTTTC and reverse primer CATGATTGGCGATGAGGTC (predicted length of the transcript, 144 bp); for csrB, forward primer GCGTTAAAGGACACCTCCAG and reverse primer ACCTTACGGCCTGTTCATCC (predicted length of the transcript, 146 bp); and for csrC, forward primer GAAGACAAACGTCCGGAGAC and reverse primer CCTTAACGGGTTCCACCATC (predicted length of the transcript, 116 bp).

RESULTS
Rationale for in vitro assay of T3SS.
The complex interaction between bacterial cells and host cells
may involve both unknown chemicals and variable physical stimuli.
This makes it difficult to dissect the signaling networks that
control interaction-dependent behavior, such as the biogenesis
of the T3SS, which bacteria use to secrete virulence proteins
(Sips) into host cells. It is known, however, that cells of
S. enterica serovar Typhimurium grown in LB medium secrete Sips
even in the absence of host cells (
14,
29). Thus, we can study
the regulation of secretion in a host-independent manner. In
such a system, we can control the nature and amount of chemicals
and/or stimuli added exogenously. We propose that results from
such in vitro experiments can reveal fundamental properties
of the secretion system.
In this study, we investigated the effect of osmolarity on the expression of the SPI1 T3SS and dissected the pathway through which osmolarity exerts this effect. In practice, we first analyzed secretion proteins by SDS-PAGE. If Sip proteins were secreted as expected, we assumed that SPI1 genes were expressed normally and that the T3SS had formed successfully. When Sip secretion was abnormal, we analyzed SPI1 gene expression by real-time PCR and observed T3SS by electron microscopy.
Increased osmolarity induces Sip secretion. (i) Sip secretion is NaCl dependent.
We routinely recovered secreted proteins from cell-free spent media that had been harvested following 4 h of incubation by TCA precipitation and analyzed these proteins by SDS-PAGE. Protein bands were blotted on a polyvinylidene fluoride membrane and analyzed by N-terminal amino acid sequencing (29). When wild-type cells were grown in TY medium supplemented with 100 mM NaCl, the major proteins in each band were either flagellar proteins (FlgK, FliC, FlgE, and FlgL) or Sip proteins (SipA, SipB, SipC, SipD, and InvJ) (Fig. 2A). In contrast, when cells were grown in the absence of salt, they secreted only the flagellar proteins (Fig. 2A). The bands containing FlgE or SipC and the bands containing InvJ or SipD overlapped; thus, band assignments were made cautiously. The amount of flagellar protein secreted into the media varied from one protein to another and was not necessarily proportional to the amount required for formation of a structure. We concluded that NaCl induces Sip secretion.
To optimize conditions for the study of NaCl-induced Sip secretion,
we performed a dose dependence experiment. The effect of NaCl
was biphasic with respect to concentration (Fig.
2B). In the
absence of NaCl, low levels of Sips were secreted. As the NaCl
concentration was increased up to 100 mM, the amounts of secreted
Sips gradually increased (Fig.
2B and data not shown). At an
NaCl concentration of 400 mM or higher, Sip secretion decreased
gradually. In contrast, the amounts of secreted flagellar proteins
remained relatively constant at NaCl concentrations between
0 and 500 mM. These results are consistent with the hypothesis
that in
S. enterica serovar Typhimurium the flagellum-specific
and SPI1-specific T3SS systems are regulated independently,
at least with regard to salt concentration.
In the presence of an NaCl concentration of 600 mM or higher, the intensities of the bands of both the Sip and flagellar proteins decreased, while many minor background bands appeared. These results are consistent with global damage to secretion induced by high salt concentrations. Such concentrations clearly inhibited growth (data not shown), and microscopic examination revealed that the cells were motile but elongated like snakes. We also observed similar abnormal secretion when cells were grown in the presence of 100 mM NaCl if a DNA gyrase inhibitor (novobiocin or coumermycin A1) was also added; growth was impaired, microscopic examination revealed elongated cells (data not shown), and SDS-PAGE analysis revealed many minor background bands (Fig. 3). The presence of 20 µg/ml novobiocin resulted in a secreted protein profile similar to that observed with cells grown in the presence of 700 mM NaCl (compare Fig. 3A and 2B). Coumermycin A1 was more effective, resulting in a similar secreted protein profile at concentrations as low as 2 µg/ml (Fig. 3B). These results are consistent with the hypothesis that high concentrations of NaCl hamper the normal function of DNA gyrase and thus reduce DNA superhelicity, as suggested previously (43).
(ii) Simple salts induce Sip secretion.
We next surveyed the effects of various salts on Sip secretion.
Cells were precultured in TY medium and inoculated into TY media
containing the following salts at a concentration of 100 mM:
NaCl, KCl, KBr, NH
4Cl, CaCl
2, MgCl
2, MgSO
4, Na
2SO
4, and (NH
4)
2SO
4.
With one exception, these salts yielded a secreted protein profile
that resembled the pattern produced in the presence of NaCl
(Fig.
4). The intensity of the bands produced in the presence
of KCl, KBr, or MgCl
2 was generally similar to the intensity
of the bands produced in the presence of NaCl. The profile was
generally less intense in the presence of NH
4Cl, MgSO
4, Na
2SO
4,
or (NH
4)
2SO
4. In contrast, CaCl
2 did not induce Sip secretion.
Thus, it appears that with the exception of CaCl
2, the halogenated
salts exerted a stronger effect than the sulfated salts. For
all further studies, we employed NaCl.
(iii) Sucrose induces Sip secretion.
To determine if the salt effect results from changes in medium
osmolarity, we examined Sip secretion in the presence of 200
mM sucrose. The secretion profile (Fig.
2A) was similar but
not identical to the profiles observed with NaCl (Fig.
2A).
Whereas sucrose induced secretion of SipA and SipD/InvJ at levels
that were similar to those observed in the presence of NaCl,
the secretion of SipB and SipC was not nearly as strong. We
concluded that increased osmolarity induces SPI1-dependent secretion.
NaCl induces needle complex assembly.
The SPI1 T3SS secretes Sips through a needle complex (24, 27) that can be seen by electron microscopy. We therefore employed electron microscopy to determine if salt influences the assembly of needle complexes. Wild-type cells were grown in TY medium supplemented or not supplemented with 100 mM NaCl; the final cell densities under the two conditions were similar, and microscopic examination revealed no obvious morphological defects. For electron microscopy, the cells were harvested from culture media, suspended in a sucrose solution, and shocked osmotically. When cells were grown in the presence of 100 mM NaCl, about 70% of the cells had about 50 to 100 needle complexes on the cell surface (Fig. 5A). In contrast, when they were grown in the absence of NaCl, the majority of the cells displayed only a few needle complexes (Fig. 5B). These data are consistent with the hypothesis that the amount of secreted Sips correlates with the number of needle complexes per cell.
Increased osmolarity induces transcription of SPI1 regulators.
To identify the part of the proposed regulatory network (Fig.
1) that controls needle complex assembly and Sip secretion in
response to increased osmolarity, we used quantitative reverse
transcriptase PCR (real-time PCR) to monitor transcription of
known regulators of SPI1 genes. We first examined transcription
of the
hilA gene, which directly regulates SPI1 gene expression
(
7,
8,
33,
34), and transcription of the
hilC and
hilD genes,
which are known to positively regulate
hilA (
8,
33).
The presence of 100 mM NaCl increased the expression of hilA, hilC, and hilD nearly sixfold, threefold, and nearly fivefold, respectively. In contrast, salt had little effect on hilE transcription (Table 2). Similar results were observed when 100 mM NaCl was replaced with 200 mM sucrose (data not shown). These results are consistent with previous reports indicating that HilA, HilC, and HilD regulate SPI1 gene transcription and that HilC and HilD activate hilA transcription equally (3, 7, 8, 9, 10, 11, 19, 33, 34, 37, 40, 41, 47, 49). To determine if the salt response required HilC and HilD equally, we performed an epistasis analysis. We compared the wild-type Sip secretion profile to the secretion profile of mutant cells defective for hilA, defective for either hilC or hilD, or defective for both hiC and hilD (Fig. 6). The hilA, hilD, and hilC hilD mutants did not secrete Sips. In contrast, the hilC mutant secreted Sip proteins about as well as its wild-type parent. Accordingly, hilA, hilC, and hilD transcripts were barely detectable in hilD and hilC hilD mutants even in the presence of NaCl (Table 3). In contrast, salt-activated transcription of the hilA and hilD genes was observed in the hilC mutant, although the levels were lower than those in the wild-type parent. Electron microscopy showed that there were many needle complexes in the hilC mutant but few needle complexes in the hilA, hilD, and hilC hilD mutants (data not shown). We therefore propose that the salt signal passes through HilD to HilA and that HilC exerts a modulating effect on hilD and hilA transcription, but this modulating effect is not enough to influence the Sip secretion profile.
View this table:
[in this window]
[in a new window]
|
TABLE 2. Real-time PCR for expression of T3SS-related regulatory genes: hilA, hilC, hilD, and hilE gene expression in the wild-type strain in the presence or absence of 100 mM NaCl
|
View this table:
[in this window]
[in a new window]
|
TABLE 3. Real-time PCR for expression of T3SS-related regulatory genes: hilA, hilC, and hilD gene expression in hilC, hilD, and hilC hilD deletion mutants
|
To test this model, we transformed a
hilD mutant with a multicopy
plasmid that carries the wild-type allele of
hilA. As a control,
we also transformed a
hilA mutant. We then exposed the strains
to salt and monitored
hilA,
hilD, and
sipC transcription. Relative
to the wild type, the presence of the
hilA plasmid increased
hilA transcription 40- and 70-fold and
sipC transcription 20-
and 30-fold in the
hilA and
hilD mutants, respectively, even
in the absence of salt (Table
4). Overexpression of HilA enhanced
hilD transcription, as reported previously (
15,
49). In the
hilA mutant, which expressed HilD, exposure to salt increased
hilA,
hilD, and
sipC transcription. In the
hilD mutant, exposure
to salt had no effect on
sipC transcription and caused a significant
decrease in
hilA transcription. On the basis of these observations,
we concluded that the salt signal acts on
hilA transcription
and thus transcription of SPI1 genes (e.g.,
sipC) via HilD.
View this table:
[in this window]
[in a new window]
|
TABLE 4. Real-time PCR for expression of T3SS-related regulatory genes: hilA, hilD, and sipC gene expression in a hilA mutant and a hilD mutant transformed with a plasmid expressing the hilA gene
|
The BarA-SirA two-component system mediates the response to high osmolarity.
The following four two-component signal transduction systems
could affect
hil gene expression: PhoQ-PhoP, PhoR-PhoB, EnvZ-OmpR,
and BarA-SirA. We could eliminate the PhoQ-PhoP pathway because
these proteins activate
hilE (
9) and the presence of either
100 mM NaCl or 200 mM sucrose had no effect on the expression
of
hilE (Table
2 and data not shown). To test the involvement
of the EnvZ-OmpR and BarA-SirA pathways, we compared the secretion
profiles of
barA and
envZ mutants to the profile of their isogenic
wild-type parent. The
barA and
sirA mutants did not secrete
Sips even in the presence of 100 mM NaCl (Fig.
7) or 200 mM
sucrose (data not shown). In contrast, the
envZ mutant exhibited
a secretion profile indistinguishable from that of the wild-type
parent (Fig.
7 and data not shown). Consistent with these data,
100 mM NaCl induced
hilA and
hilD transcription in the
envZ mutant but not in the
barA and
sirA mutants (Table
5). Furthermore,
electron microscopy revealed numerous needle complexes on the
surface of the
envZ mutant but not on the surface of the
barA mutant (data not shown). These data are consistent with the
hypothesis that the BarA/SirA pathway, but not EnvZ, is intimately
involved in salt-activated Sip secretion.
View this table:
[in this window]
[in a new window]
|
TABLE 5. Real-time PCR for expression of T3SS-related regulatory genes: hilA and hilD gene expression in mutants deficient for barA, sirA, or envZ
|
It is known that the BarA-SirA pathway activates transcription
of the small
csrB and
csrC RNAs. These small RNAs bind the protein
CsrA (
5,
30). CsrA has been shown to inhibit
hilD expression
(
30). We therefore tested if salt influences the transcription
of
csrA,
csrB, and
csrC (Table
6). In contrast to
hilA transcription,
which exhibited a BarA-SirA-dependent response to 100 mM NaCl,
csrA,
csrB, and
csrC transcription did not respond to salt even
though transcription of
csrB and
csrC did depend on the BarA-SirA
pathway, as reported previously (
20,
30). We concluded that
the salt stimulus acts via the BarA-SirA pathway but not through
the Csr system.
View this table:
[in this window]
[in a new window]
|
TABLE 6. Real-time PCR for expression of T3SS-related regulatory genes: hilA, csrA, csrB, and csrC gene expression in mutants deficient for barA, sirA, or envZ
|
Second effect of salt.
The data presented thus far are consistent with a simple linear
pathway in which BarA senses the salt/sucrose stimulus and transduces
the information to SirA, which informs HilD, which activates
hilA transcription, which permits HilA-dependent activation
of SPI1 genes, including the T3SS and its Sips. Alternatively,
however, salt/sucrose may directly affect the conformation of
intermediate regulatory proteins and thus modify their function.
Because plasmid-borne
hilA in the
hilA mutant induced
hilA,
hilD, and
sipC transcription independent of salt (Table
4),
we reasoned that this strain could allow us to observe any transcription-independent
salt effects. Indeed, Sip secretion, which was completely inhibited
in the
hilA mutant, recovered in the presence of plasmid-borne
HilA (Fig.
8). Intriguingly, in the absence of salt, the secretion
profile of this transformant resembled that of wild-type cells
exposed to 200 mM sucrose; the amount of secreted SipB and SipC
was reduced in the absence of NaCl relative to the amount in
the presence of NaCl (Fig.
8). We propose that NaCl impacts
Sip secretion in two distinct ways: (i) like sucrose, it induces
SPI1 transcription via a pathway that includes BarA, SirA, HilD,
and HilA; and (ii) unlike sucrose, it enhances secretion of
SipB and SipC.

DISCUSSION
In this study, we showed that exposure to simple salts (100
mM) and sucrose (200 mM) specifically induces expression and
assembly of the SPI1-encoded T3SS and its associated needle
complex and expression and secretion of SPI1-encoded Sips. Because
Sip secretion occurred in response to a variety of salts and
to sucrose, we propose that elevated osmolarity is the relevant
environmental stimulus. This response may explain why
Salmonella infection of animal tissues is most effective in saline solutions
(
23).
Osmolarity response pathway: a simple model.
To understand how cells respond to relatively low concentrations of salt (100 mM) and sucrose (200 mM), we used genetic analyses to track the pathway through which salt activates Sip secretion. On the basis of these studies, we propose the following model (Fig. 9). In response to salt, the sensor kinase BarA autophosphorylates and donates its phosphoryl group to its cognate response regulator, SirA. Phosphorylated SirA then activates transcription of a factor X, which is not the small csr RNAs. Factor X activates hilD, which activates hilA. The evidence for this simple model is as follows. Exposure to salt or sucrose activated hilD, hilC, and hilA transcription (Table 2). hilD, hilC, and hilA mutants did not secrete Sips in response to salt (Fig. 6). This response depended on hilD and hilA but not on hilC (Table 3), supporting the hypothesis that HilC has an accessory role. The barA and sirA mutants did not secrete Sips in response to either salt or sucrose, and hilA and hilD transcription depended on barA (Fig. 7 and Table 5). In contrast, the envZ mutant secreted Sips and transcribed hilA and hilD as well as its wild-type parent; thus, EnvZ plays a minor role in this pathway (Fig. 7 and Table 5). Because exposure to salt or sucrose had no effect on hilE transcription (Table 2), it is unlikely that the salt/sucrose response involves the PhoQP and PhoRB pathways.
Second effect of salt.
Although sucrose and salt induced Sip secretion through the
same pathway, the secretion profiles induced by sucrose and
salt were not identical. Although exposure to sucrose and exposure
to salt resulted in detection of similar amounts of SipA and
SipD, only exposure to salt resulted in detection of significant
amounts of SipB and SipC (Fig.
2A). A possible reason for this
discrepancy became apparent when we overexpressed HilA in a
hilA mutant (Table
4). This genetic manipulation bypassed the
salt requirement for Sip secretion with two notable exceptions:
SipB and SipC. In the absence of salt, we detected small amounts
of these two proteins. In contrast, we detected substantial
amounts of both proteins upon exposure to salt. Since all four
proteins are encoded in a single operon in the order
sipBCDA,
it is quite likely that they are expressed at similar levels.
Indeed, regardless of treatment, all four Sip proteins could
be detected in the medium when they were harvested at earlier
time points (data not shown). We therefore propose that SipB
and SipC are expressed and secreted but are degraded during
prolonged exposure to the medium. Via a presently unknown mechanism,
100 mM NaCl, but not 200 mM sucrose, appears to protect SipB
and SipC from this degradation. One difference between the two
pairs of Sips is that SipB and SipC are escorted by the specific
chaperone SicA, while SipA and SipD are not (
51).

ACKNOWLEDGMENTS
We thank Masaomi Kanbe for his technical help, Linda Kenny for
her kind gift of
envZ/
ompR deletion mutants, and Alan Wolfe
for his indefatigable help in revising the manuscript.
We are also grateful to CREST programs of the Japan Science and Technology Agency for financial support.

FOOTNOTES
* Corresponding author. Mailing address: Department of Life Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan. Phone: 81-824-74-1759. Fax: 81-824-93-8767. E-mail:
aizawa{at}pu-hiroshima.ac.jp 
Published ahead of print on 25 April 2008. 

REFERENCES
1 - Aizawa, S.-I. 2001. Bacterial flagella and type III secretion systems. FEMS Microbiol. Lett. 202:157-164.[CrossRef][Medline]
2 - Aizawa, S.-I. 2004. Flagella, p. 470-479. In M. Schaechter (ed.), The desk encyclopedia of microbiology. Academic Press, New York, NY.
3 - Akbar, S., L. M. Schechter, C. P. Lostroh, and C. A. Lee. 2003. AraC/XylS family members, HilD and HilC, directly activate virulence gene expression independently of HilA in Salmonella typhimurium. Mol. Microbiol. 47:715-728.[CrossRef][Medline]
4 - Altier, C. 2005. Genetic and environmental control of salmonella invasion. J. Microbiol. 43:85-92.[Medline]
5 - Altier, C., M. Suyemoto, and S. D. Lawhon. 2000. Regulation of Salmonella enterica serovar Typhimurium invasion genes by csrA. Infect. Immun. 68:6790-6797.[Abstract/Free Full Text]
6 - Bahrani, F. K., P. J. Sansonetti, and C. Parsot. 1997. Secretion of Ipa proteins by Shigella flexneri: inducer molecules and kinetics of activation. Infect. Immun. 65:4005-4010.[Abstract]
7 - Bajaj, V., C. Hwang, and C. A. Lee. 1995. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 18:715-727.[CrossRef][Medline]
8 - Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol. 22:703-714.[CrossRef][Medline]
9 - Baxter, M. A., T. F. Fahlen, R. L. Wilson, and B. D. Jones. 2003. HilE interacts with HilD and negatively regulates hilA transcription and expression of the Salmonella enterica serovar Typhimurium invasive phenotype. Infect. Immun. 71:1295-1305.[Abstract/Free Full Text]
10 - Boddicker, J. D., and B. D. Jones. 2004. Lon protease activity causes down-regulation of Salmonella pathogenicity island 1 invasion gene expression after infection of epithelial cells. Infect. Immun. 72:2002-2013.[Abstract/Free Full Text]
11 - Boddicker, J. D., B. M. Knosp, and B. D. Jones. 2003. Transcription of the Salmonella invasion gene activator, hilA, requires HilD activation in the absence of negative regulators. J. Bacteriol. 185:525-533.[Abstract/Free Full Text]
12 - Bretz, J., L. Losada, K. Lisboa, and S. W. Hutcheson. 2002. Lon protease functions as a negative regulator of type III protein secretion in Pseudomonas syringae. Mol. Microbiol. 45:397-409.[CrossRef][Medline]
13 - Collazo, C. M., and J. E. Galan. 1997. The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24:747-756.[CrossRef][Medline]
14 - Daefler, S. 1999. Type III secretion by Salmonella typhimurium does not require contact with a eukaryotic host. Mol. Microbiol. 31:45-51.[CrossRef][Medline]
15 - De Keersmaecker, S. C., K. Marchal, T. L. Verhoeven, K. Engelen, J. Vanderleyden, and C. S. Detweiler. 2005. Microarray analysis and motif detection reveal new targets of the Salmonella enterica serovar Typhimurium HilA regulatory protein, including hilA itself. J. Bacteriol. 187:4381-4391.[Abstract/Free Full Text]
16 - Eichelberg, K., and J. E. Galan. 2000. The flagellar sigma factor FliA (
28) regulates the expression of Salmonella genes associated with the centisome 63 type III secretion system. Infect. Immun. 68:2735-2743.[Abstract/Free Full Text] 17 - Ellermeier, C. D., and J. M. Slauch. 2003. RtsA and RtsB coordinately regulate expression of the invasion and flagellar genes in Salmonella enterica serovar Typhimurium. J. Bacteriol. 185:5096-5108.[Abstract/Free Full Text]
18 - Ellermeier, C. D., and J. M. Slauch. 2004. RtsA coordinately regulates DsbA and the Salmonella pathogenicity island 1 type III secretion system. J. Bacteriol. 186:68-79.[Abstract/Free Full Text]
19 - Ellermeier, C. D., J. R. Ellermeier, and J. M. Slauch. 2005. HilD, HilC and RtsA constitute a feed forward loop that controls expression of the SPI1 type three secretion system regulator hilA in Salmonella enterica serovar Typhimurium. Mol. Microbiol. 57:691-705.[CrossRef][Medline]
20 - Fortune, D. R., M. Suyemoto, and C. Altier. 2006. Identification of CsrC and characterization of its role in epithelial cell invasion in Salmonella enterica serovar Typhimurium. Infect. Immun. 74:331-339.[Abstract/Free Full Text]
21 - Galan, J. E. 2001. Salmonella interactions with host cells: type III secretion at work. Annu. Rev. Cell Dev. Biol. 17:53-86.[CrossRef][Medline]
22 - Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284:1322-1328.[Abstract/Free Full Text]
23 - Galan, J. E., and R. Curtiss III. 1990. Expression of Salmonella typhimurium genes required for invasion is regulated by changes in DNA supercoiling. Infect. Immun. 58:1879-1885.[Abstract/Free Full Text]
24 - Gulig, P. A., and R. Curtiss III. 1988. Cloning and transposon insertion mutagenesis of virulence genes of the 100-kilobase plasmid of Salmonella typhimurium. Infect. Immun. 56:3262-3271.[Abstract/Free Full Text]
25 - Iyoda, S., T. Kamidoi, K. Hirose, K. Kutsukake, and H. Watanabe. 2001. A flagellar gene fliZ regulates the expression of invasion genes and virulence phenotype in Salmonella enterica serovar Typhimurium. Microb. Pathog. 30:81-90.[CrossRef][Medline]
26 - Jones, B. D. 2005. Salmonella invasion gene regulation: a story of environmental awareness. J. Microbiol. 43:110-117.[Medline]
27 - Kaniga, K., S. C. Tucker, D. Trollinger, and J. E. Galan. 1995. Homologues of the Shigella invasins IpaB and IpaC are required for Salmonella typhimurium entry into culture cells. J. Bacteriol. 177:3965-3971.[Abstract/Free Full Text]
28 - Kelly, A., M. D. Goldberg, R. K. Carroll, V. Danino, J. C. Hinton, and C. J. Dorman. 2004. A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enterica serovar Typhimurium. Microbiology 150:2037-2053.[Abstract/Free Full Text]
29 - Komoriya, K., N. Shibano, T. Higano, N. Azuma, S. Yamaguchi, and S.-I. Aizawa. 1999. Flagellar proteins and type III-exported virulence factors are the predominant proteins secreted into the culture media of Salmonella typhimurium. Mol. Microbiol. 34:767-779.[CrossRef][Medline]
30 - Lawhon, S. D., J. G. Frye, M. Suyemoto, S. Porwollik, M. McClelland, and C. Altier. 2003. Global regulation by CsrA in Salmonella typhimurium. Mol. Microbiol. 48:1633-1645.[CrossRef][Medline]
31 - Lawhon, S. D., R. Maurer, M. Suyemoto, and C. Altier. 2002. Intestinal short-chain fatty acids alter Salmonella typhimurium invasion gene expression and virulence through BarA/SirA. Mol. Microbiol. 46:1451-1464.[CrossRef][Medline]
32 - Lee, A. K., C. S. Detweiler, and S. Falkow. 2000. OmpR regulates the two-component system SsrA-ssrB in Salmonella pathogenicity island 2. J. Bacteriol. 182:771-781.[Abstract/Free Full Text]
33 - Lucas, R. L., and C. A. Lee. 2001. Roles of hilC and hilD in regulation of hilA expression in Salmonella enterica serovar Typhimurium. J. Bacteriol. 183:2733-2745.[Abstract/Free Full Text]
34 - Lucas, R. L., C. P. Lostroh, C. C. DiRusso, M. P. Spector, B. L. Wanner, and C. A. Lee. 2000. Multiple factors independently regulate hilA and invasion gene expression in Salmonella enterica serovar Typhimurium. J. Bacteriol. 182:1872-1882.[Abstract/Free Full Text]
35 - Macnab, R. M. 1996. Flagella and motility, p. 123-145. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, DC.
36 - Menard, R., P. Sansonetti, and C. Parsot. 1994. The secretion of the Shigella flexneri Ipa invasins is activated by epithelial cells and controlled by IpaB and IpaD. EMBO J. 13:5293-5302.[Medline]
37 - Olekhnovich, I. N., and R. J. Kadner. 2007. Role of nucleoid-associated proteins Hha and H-NS in expression of Salmonella enterica activators HilD, HilC, and RtsA required for cell invasion. J. Bacteriol. 189:6882-6890.[Abstract/Free Full Text]
38 - Pickard, D., J. Li, M. Roberts, D. Maskell, D. Hone, M. Levine, G. Dougan, and S. Chatfield. 1994. Characterization of defined ompR mutants of Salmonella typhi: ompR is involved in the regulation of Vi polysaccharide expression. Infect. Immun. 62:3984-3993.[Abstract/Free Full Text]
39 - Pizarro-Cerda, J., and K. Tedin. 2004. The bacterial signal molecule, ppGpp, regulates Salmonella virulence gene expression. Mol. Microbiol. 52:1827-1844.[CrossRef][Medline]
40 - Rodriguez, C. R., L. M. Schechter, and C. A. Lee. 2002. Detection and characterization of the S. typhimurium HilA protein. BMC Microbiol. 2:31.[CrossRef][Medline]
41 - Schechter, L. M., and C. A. Lee. 2001. AraC/XylS family members, HilC and HilD, directly bind and derepress the Salmonella typhimurium hilA promoter. Mol. Microbiol. 40:1289-1299.[CrossRef][Medline]
42 - Schechter, L. M., S. Jain, S. Akbar, and C. A. Lee. 2003. The small nucleoid-binding proteins H-NS, HU, and Fis affect hilA expression in Salmonella enterica serovar Typhimurium. Infect. Immun. 71:5432-5435.[Abstract/Free Full Text]
43 - Shi, W., C. Li, C. J. Louise, and J. Adler. 1993. Mechanism of adverse conditions causing lack of flagella in Escherichia coli. J. Bacteriol. 175:2236-2240.[Abstract/Free Full Text]
44 - Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Press, Cold Spring Harbor, NY.
45 - Takaya, A., T. Tomoyasu, A. Tokumitsu, M. Morioka, and T. Yamamoto. 2002. The ATP-dependent lon protease of Salmonella enterica serovar Typhimurium regulates invasion and expression of genes carried on Salmonella pathogenicity island 1. J. Bacteriol. 184:224-232.[Abstract/Free Full Text]
46 - Takaya, A., M. Suzuki, H. Matsui, T. Tomoyasu, H. Sashinami, A. Nakane, and T. Yamamoto. 2003. Lon, a stress-induced ATP-dependent protease, is critically important for systemic Salmonella enterica serovar Typhimurium infection of mice. Infect. Immun. 71:690-696.[Abstract/Free Full Text]
47 - Takaya, A., Y. Kubota, E. Isogai, and T. Yamamoto. 2005. Degradation of the HilC and HilD regulator proteins by ATP-dependent Lon protease leads to downregulation of Salmonella pathogenicity island 1 gene expression. Mol. Microbiol. 55:839-852.[CrossRef][Medline]
48 - Teplitski, M., R. I. Goodier, and B. M. Ahmer. 2003. Pathways leading from BarA/SirA to motility and virulence gene expression in Salmonella. J. Bacteriol. 185:7257-7265.[Abstract/Free Full Text]
49 - Thijs, I. M. V., S. C. J. De Keersmaecker, A. Fadda, K. Engelen, H. Zhao, M. McClelland, K. Marchal, and J. Vanderleyden. 2007. Delineation of the Salmonella enterica serovar Typhimurium HilA regulon through genome-wide location and transcript analysis. J. Bacteriol. 189:4587-4596.[Abstract/Free Full Text]
50 - Tomita, T., and S. Kanegasaki. 1982. Enhanced phagocytic response of macrophages to bacteria by physical impact caused by bacterial motility or centrifugation. Infect. Immun. 38:865-870.[Abstract/Free Full Text]
51 - Tucker, S. C., and J. E. Galan. 2000. Complex function for SicA, a Salmonella enterica serovar Typhimurium type III secretion-associated chaperone. J. Bacteriol. 182:2262-2268.[Abstract/Free Full Text]
52 - Wilson, R. L., S. J. Libby, A. M. Freet, J. D. Boddicker, T. F. Fahlen, and B. D. Jones. 2001. Fis, a DNA nucleoid-associated protein, is involved in Salmonella typhimurium SPI-1 invasion gene expression. Mol. Microbiol. 39:79-88.[CrossRef][Medline]
53 - Yamaguchi, S., H. Fujita, K. Sugata, T. Taira, and T. Iino. 1984. Genetic analysis of H2, the structural gene for phase-2 flagellin in Salmonella. J. Gen. Microbiol. 130:255-265.[Abstract/Free Full Text]
Journal of Bacteriology, July 2008, p. 4624-4631, Vol. 190, No. 13
0021-9193/08/$08.00+0 doi:10.1128/JB.01957-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Su, J., Gong, H., Lai, J., Main, A., Lu, S.
(2009). The Potassium Transporter Trk and External Potassium Modulate Salmonella enterica Protein Secretion and Virulence. Infect. Immun.
77: 667-675
[Abstract]
[Full Text]