Previous Article | Next Article ![]()
Journal of Bacteriology, August 2008, p. 5291-5299, Vol. 190, No. 15
0021-9193/08/$08.00+0 doi:10.1128/JB.00288-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Department of Microbiology and Immunology and Center for Oral Biology, University of Rochester Medical Center, Rochester, New York 14642,1 Department of Oral Biology, University of Florida College of Dentistry, Gainesville, Florida 326102
Received 26 February 2008/ Accepted 16 May 2008
|
|
|---|
relAPQ) does not grow in minimal medium lacking the branched-chain amino acids (BCAA) leucine or valine but grows well if isoleucine is also omitted. Here, we investigated whether there was a correlation between growth in the absence of leucine and valine with (p)ppGpp pools and the activation of CodY. By using a combination of single, double, and triple mutants lacking the (p)ppGpp synthetase enzymes, we demonstrated that the ability to grow in the absence of leucine or valine required basal levels of (p)ppGpp production by RelP and RelQ. The introduction of a codY mutation into the
relAPQ strain fully restored growth in medium lacking leucine or valine, revealing that the growth-defective phenotype of
relAPQ was directly linked to CodY. Lowering GTP levels through the addition of decoyinine did not alleviate CodY repression or affect the expression of genes involved in BCAA biosynthesis, suggesting that S. mutans CodY is not activated by GTP. The results of phenotypic studies revealed that the codY mutant had a reduced capacity to form biofilms and that its growth was more sensitive to low pH, showing a role for CodY in two key virulence properties of S. mutans. Microarray results revealed the extent of the CodY regulon. Notably, the identification of putative CodY-binding boxes upstream of genes that were downregulated in the codY mutant indicates that CodY may also function as a transcriptional activator in S. mutans. |
|
|---|
The "stringent response" is a widely distributed bacterial adaptation system that allows for global adjustments in gene expression in response to nutrient limitation and certain environmental stresses. The stringent response is mediated by the nutritional alarmones guanosine 3'-diphosphate 5'-triphosphate and guanosine 3',5'-bispyrophosphate, generally referred to as (p)ppGpp (8). During nutrient starvation, (p)ppGpp is produced at higher levels by enzymatic phosphorylation of GDP and GTP by ATP, resulting in the downregulation of genes for macromolecular biosynthesis and upregulation of genes involved in amino acid biosynthesis and stress tolerance (8, 22).
Until recently, the results of functional studies supported the idea that only two closely related enzymes were responsible for (p)ppGpp production and degradation in bacteria. In the paradigmatic gram-negative bacterium Escherichia coli and related enteric bacteria, relA encodes a potent (p)ppGpp synthetase and spoT encodes a bifunctional enzyme with both hydrolase and (weak) synthetase activities (8). In GPB, a bifunctional Rel/Spo ortholog, herein designated RelA, was shown to harbor both degradation and synthesis activities (25, 27, 46). More recently, we identified two novel (p)ppGpp synthetases in S. mutans, designated RelP and RelQ, that shared very limited homology with Rel/Spo enzymes (20). In S. mutans, RelA has retained the functions generally ascribed to Rel/Spo-like enzymes and is the major enzyme controlling the stringent response (30), whereas RelP appears to be the major source of (p)ppGpp during growth under nonstressed conditions (20). The contribution of RelQ to (p)ppGpp pools and stress tolerance has not yet been established. Phenotypic characterization and transcription profiling of an RelA-deletion strain revealed that RelA coordinates the expression of genes and phenotypes that contribute to the pathogenic potential of S. mutans, such as biofilm formation, acid tolerance, and sugar metabolism (19, 20). More recently, apparent homologues of RelP and RelQ have been discovered and shown to be functional in Bacillus subtilis (29). Multiple (p)ppGpp synthases have also been found in rice (44), suggesting that the original findings with S. mutans have broad biological relevance.
Based on what is currently known about the genetic and physiologic behaviors of strains of S. mutans lacking one or more of the relAPQ genes, our working hypothesis is that RelA synthesizes (p)ppGpp as part of a classic stringent response to severe nutrient limitation and perhaps other stresses and RelP and RelQ synthesize (p)ppGpp in response to yet-to-be-determined stimuli to optimize the balance between growth and persistence. In support of this idea, an RelA-deficient strain has growth requirements similar to those of wild-type S. mutans, but an
relAPQ strain, which lacks all three synthetases, cannot grow in the absence of leucine or valine (20). The triple-deletion strain can, however, grow well in the absence of isoleucine or when the lack of leucine and/or valine is coupled with the removal of isoleucine. In S. mutans, the biosynthesis of branched-chain amino acids (BCAA; isoleucine, leucine, and valine) appears to occur via the ilv-leu pathway (4) and is apparently regulated by the DNA binding protein CodY.
CodY is a global nutritional repressor that is highly conserved in low-G+C GPB, including S. mutans (4, 41). In Bacillus subtilis, the GTP-sensing protein CodY regulates BCAA operon expression (41), and the results presented in recent reports have demonstrated a connection between (p)ppGpp levels and CodY activity (7, 16, 24). DNA binding by CodY is activated by two different effectors, GTP and isoleucine, and this activation was shown to be independent and additive (38). However, the results of several studies indicate that DNA binding by the CodY proteins of Streptococcus pneumoniae and Lactococcus lactis is unresponsive to GTP pools but strongly activated by isoleucine (10, 14, 34). Given our previous observations showing that the removal of isoleucine restored the growth of an
relAPQ mutant of S. mutans in medium lacking leucine and/or valine (20) and that the production of (p)ppGpp results in a marked reduction of GTP levels (20), we speculated that the inability of the
relAPQ strain to grow in the absence of leucine or valine was related to the repression of the ilv and leu genes by CodY (20). In this report, we demonstrate that growth in the absence of leucine or valine is linked to basal levels of (p)ppGpp that are synthesized by the newly discovered RelP and RelQ enzymes. Strains lacking CodY and various alarmone synthases were constructed and used to establish a relationship of (p)ppGpp pools with CodY activity. Microarray results proved that CodY does indeed function as a global regulator of gene expression in S. mutans, and the results of phenotypic studies revealed that CodY plays a significant role in biofilm maturation and acid tolerance, two major virulence attributes of S. mutans.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. S. mutans strains used in this study
|
codY strain were grown in FMC (complete or lacking leucine or valine) in the presence of 500 µg ml–1 decoyinine (dissolved in dimethyl sulfoxide) and treated with 500 µg ml–1 or 1.5 mg ml–1 decoyinine or 500 ng ml–1 mupirocin for different times. An equal amount of dimethyl sulfoxide was added to control cultures. At various time intervals, samples were harvested and assayed for gene expression and to determine the intracellular concentrations of GTP and (p)ppGpp by thin-layer chromatography (TLC). Nucleotide pool extractions and TLC were carried out as described elsewhere (20).
Construction of codY and
relAPQ
codY mutants.
To evaluate the role of CodY in the impaired growth of the
relAPQ strain in the absence of BCAAs, the entire codY gene was replaced by a tetracycline resistance (Tcr) marker in S. mutans UA159 by using a PCR ligation mutagenesis approach (17). To make the deletion, the Tcr marker was obtained as a BamHI fragment and ligated to two PCR fragments flanking codY that were also digested with BamHI. The PCR fragments flanking codY were obtained by using the following primers: 5'codY arm1 (CCAAAGATGTATTAGAAG), 3'codY arm1 (ATTAGCCATGGGATCCAATCGTATTAT), 5'codY arm2 (CTATAGTTAAGGATCCTAAAGCACTG), and 3'codY arm2 (CCAATCCATAATTTCC). The underlined bases correspond to the BamHI restriction site included to aid in the subsequent ligation. The ligation mix was used to transform S. mutans UA159, and putative codY mutants were selected on BHI agar containing 10 µg ml–1 of tetracycline. The deletion was confirmed as correct by PCR sequencing of the insertion site and flanking sequences. Subsequently, a quadruple mutant was constructed by transforming the
relAPQ strain (20) with chromosomal DNA isolated from the
codY strain (JLcodY) to give an
relAPQ
codY strain (JLQ1).
Microarray experiments. Transcriptome analysis was performed as previously described (1, 3, 30) using S. mutans UA159 microarrays provided by The Institute for Genomic Research (TIGR). RNA was isolated from exponential-phase cells (OD600 = 0.3) grown in FMC medium, as described previously (1). All samples were digested with DNase I (Ambion, Austin, TX) and purified by using an RNeasy mini kit column (Qiagen, Inc., Chatsworth, CA). The RNA concentrations were determined spectrophotometrically in triplicate, and 1 µg of RNA was run in a formaldehyde gel to verify RNA quality. Reverse-transcription (RT) reactions were performed with 10 µg of RNA as described elsewhere (1). The microarrays consisted of 1,948 70-mer oligonucleotides representing 1,960 open reading frames printed four times on the surface of each microarray slide. A reference RNA prepared from a large-scale culture of S. mutans UA159 cells that had been grown in BHI broth to an OD600 of 0.5 was used in every experiment (1). The benefits and analytical methods associated with the utilization of a reference RNA as a normalization tool in microarray experiments are discussed elsewhere (36). Labeling of cDNA was performed according to TIGR protocols (http://pfgrc.tigr.org/protocols/protocols.shtml), with minor modifications (1). Four cDNA samples originating from four independent cultures of S. mutans strains UA159 and JLcodY were hybridized to the arrays along with the reference cDNA, generating a total of eight slides. Hybridizations were performed in a Maui hybridization chamber (BioMicro Systems, Salt Lake City, UT). Additional details regarding array protocols are available at http://pfgrc.tigr.org/protocols/protocols.shtml. Data from all individual experiments were analyzed by using Spotfinder software and normalized by using Midas according to TIGR specifications (http://www.tigr.org/software/). Statistical analysis was carried out by using BRB-Array Tools (http://linus.nci.nih.gov/BRB-ArrayTools.html) with a P value of 0.005.
Real-time quantitative PCR.
A subset of genes was selected to validate the microarray data with real-time quantitative PCR. Also, real-time quantitative PCR was used to assess the effects of decoyinine and mupirocin on the expression of ilvB and ilvE and to compare pncA mRNA levels in the wild type and the
codY strain. Gene-specific primers were designed by using Beacon Designer 2.0 software (Premier Biosoft International, Palo Alto, CA). To obtain cDNA, 1 µg of three independent RNA samples and an iScript kit containing random primers (Bio-Rad, Hercules, CA) were used. RT and quantitative real-time RT-PCR were carried out by following protocols described elsewhere (2). Student's t test was performed to verify the significance of the real-time RT-PCR quantifications.
Microarray data accession number. DNA microarray data have been deposited in NCBI Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo) and are accessible through GEO Series accession number GSE9641.
|
|
|---|
relAPQ strain.
Strains of E. coli that produce no (p)ppGpp require multiple amino acids for growth, including arginine, glycine, histidine, leucine, methionine, phenylalanine, serine, threonine, and valine (47). This multiple auxotrophy has been linked directly to the role played by (p)ppGpp in the activation of genes for amino acid biosynthesis (47). Previously, we showed that an
relAPQ strain, which lacks all three S. mutans (p)ppGpp synthetases and produces no detectable (p)ppGpp, was unable to grow in the absence of leucine or valine but grew in the absence of the third BCAA, isoleucine (20). Here, we assessed the requirements of UA159 and the
relAPQ strain for single amino acids. For this purpose, growth curves were conducted in the chemically defined medium FMC, removing 1 of the 20 essential amino acids at a time. To discriminate relA-dependent from relA-independent phenotypes, growth curves were also conducted using an otherwise-isogenic
relA mutant (19). As demonstrated previously, the
relA strain grew more slowly than the parent in complete FMC, with doubling times of 100 and 60 min, respectively, but the growth rate of the
relAPQ strain was nearly identical to that of S. mutans UA159 (20). Because
relAPQ lacks all (p)ppGpp synthetases and since RelA is the only enzyme with predicted (p)ppGpp hydrolase activity, we attributed the slow-growth phenotype of the
relA single mutant to an inability to convert (p)ppGpp, produced by RelP and RelQ, into GDP and GTP. Therefore, the ability of strains to grow in FMC in the absence of a particular amino acid was compared with the growth behavior of the same strains in complete FMC. Although all amino acid biosynthetic pathways are present in the genome of S. mutans UA159 (4) and despite previously reported results showing that most S. mutans strains can grow in vitro on chemically defined medium supplemented with few amino acids, the wild-type UA159 strain and its derivatives could not grow in FMC lacking phenylalanine (Table 2). In the original study describing FMC medium, Terleckyj and Shockman (42) found that all S. mutans strains that were tested required cystine (or cysteine) as a nutrient but failed to identify a strain that required phenylalanine for growth. However, the work by Terleckyj and Shockman, as well as the results of a study using another chemically defined medium, have revealed that amino acid requirements for S. mutans are strain specific and can be influenced by the incubation atmosphere (9, 42).
|
View this table: [in a new window] |
TABLE 2. Amino acid requirements of S. mutans UA159 and its derivatives
|
relAPQ strain showed a weak requirement for aspartic acid, glycine, proline, or serine; it displayed an extended lag period (12 to 16 h) before entering logarithmic growth phase and had final growth yields comparable to those achieved by UA159 and the
relA strain (Table 2).
The ability to grow in the absence of leucine or valine is linked to basal levels of (p)ppGpp produced by RelP and RelQ.
In order to better assess the specific contributions of RelA, RelP, and RelQ to growth in medium lacking leucine or valine, we tested the capacity of the
relP and
relQ single mutants, as well as the capacity of the
relAP,
relAQ, and
relPQ double mutants, to grow in the absence of BCAA. Here we found that, similar to the results for the
relA strain, the growth of the
relP and
relQ single mutants was not altered when leucine or valine was removed from the medium (data not shown), indicating that the growth defect of the
relAPQ triple mutant was, in fact, due to the loss of all capacity for (p)ppGpp synthesis. The results of growth curves performed using the
relAP,
relAQ, and
relPQ double mutants revealed that the growth of the
relAP strain was severely impaired, but not completely abolished, in FMC medium lacking leucine, whereas the
relAQ and
relPQ strains grew well (Table 3). Similar to our observations of the
relAPQ triple mutant strain, the removal of isoleucine allowed the
relAP mutant to grow in the absence of leucine (data not shown). Interestingly, the
relAP mutant grew fairly well in the absence of valine, and only the
relAQ mutant grew more slowly than the parent under this particular condition (Table 3), albeit the growth rates of the double mutants were comparable to those previously observed in the
relA single mutant grown under the same condition (20). The results of our previous work indicated that the (p)ppGpp-mediated stringent response is primarily governed by RelA and that RelP and RelQ act by maintaining low basal levels of (p)ppGpp, required for optimal growth (20, 30). The growth characteristics and amino acid auxotrophies of the mutants analyzed here confirm the importance of basal levels of (p)ppGpp for growth in the absence of leucine or valine. Based on the growth behavior of the
relAP mutant and because RelP appears to contribute more significantly to (p)ppGpp pools than RelQ (20), these results also suggest a stronger requirement for (p)ppGpp in medium lacking leucine. As is demonstrated below, these growth defects are directly associated with the activity of the CodY repressor, but a role of (p)ppGpp in the induction of BCAA synthesis should not be overlooked.
|
View this table: [in a new window] |
TABLE 3. Growth of S. mutans UA159 and its derivatives in FMC lacking leucine or valine
|
relAPQ strain in medium lacking leucine or valine.
The transcriptional regulator CodY was first identified in B. subtilis as a repressor of the dipeptidase permease operon (dpp) (40) and was later shown to negatively regulate the expression of more than 100 genes, many of which were involved in sporulation or adaptation to stationary phase (35). Several studies have revealed that this regulatory protein is highly conserved in low-G+C GPB and functions mainly as a global nutritional regulator. Among the direct targets of CodY repression were the genes for the biosynthesis of BCAA (28, 39, 41). In B. subtilis, DNA binding by CodY is activated by GTP and plays a key role in physiologic homeostasis by monitoring the general nutritional state of the cell through sensing of intracellular levels of GTP (35). B. subtilis CodY is also activated by BCAA, particularly isoleucine, and it was demonstrated that the activation of CodY by GTP and isoleucine is independent and additive (13, 38).
Following the stringent response, the intracellular levels of GTP suffer a significant drop due to two mechanisms: the conversion of GTP into (p)ppGpp and the inhibition of IMP dehydrogenase, an enzyme for de novo guanine nucleotide biosynthesis, by (p)ppGpp (16, 31). As a result of the decrease in intracellular levels of GTP, CodY loses its repressing activity and transcription of the CodY regulon occurs (41). However, it is important to note that sensing of GTP levels may not be a general property of CodY orthologs, as the proteins from Lactococcus lactis and Streptococcus pneumoniae were unresponsive to GTP (10, 14, 34). The results of gel retardation experiments with purified CodY of these organisms have indicated that, in addition to being unresponsive to GTP, isoleucine markedly enhanced the affinity of CodY for its targets, whereas the effects of adding leucine or valine were less or insignificant, respectively (12). The fact that the removal of isoleucine restored the growth of the
relAPQ mutant of S. mutans in medium lacking leucine and/or valine led us to test whether the inability of the
relAPQ strain to grow in the absence of leucine or valine was linked to CodY.
In the S. mutans UA159 genome, codY is followed by and apparently cotranscribed with a gene encoding a putative pyrazinamidase/nicotinamidase (pncA) involved in nicotinate and nicotinamide metabolism. To ensure that polar effects did not affect pncA expression, the codY mutant was obtained by using a tet cassette that has an outward-reading promoter (K. A. Clancy and R. A. Burne, unpublished data). Real-time PCR analysis was used to confirm that the expression of the pncA gene was not significantly altered in the
codY mutant strain (data not shown). To evaluate the role of CodY in the impaired growth of the
relAPQ strain in medium lacking leucine or valine, an
relAPQ
codY quadruple mutant strain (JLQ1) was isolated. Our first step was to evaluate the growth behavior of the
codY and
relAPQ
codY strains in BHI medium and chemically defined FMC medium. No significant differences in growth were observed among the mutants grown in BHI broth (data not shown). However, in complete FMC medium, the
codY strain grew slightly more slowly (doubling time approximately 70 min), whereas the
relAPQ
codY mutant and the wild-type UA159 strains displayed identical doubling times (approximately 60 min) (data not shown). Next, we tested the capacity of the
relAPQ
codY strain to grow in the absence of leucine or valine. For control purposes, UA159 and the
relAPQ strain were included in the growth curve experiments. As hypothesized, the inactivation of codY in the
relAPQ strain fully restored growth in medium lacking leucine or valine (Fig. 1), indicating that the growth-defective phenotype of the
relAPQ strain was, in fact, due to CodY repression.
![]() View larger version (18K): [in a new window] |
FIG. 1. Growth curves of S. mutans UA159 (wild type), JLT1 ( relAPQ), and JLQ1 ( relAPQ codY) in FMC lacking leucine (A) or valine (B). The results are representative of those of at least four independent experiments.
|
relAPQ mutant.
The results of studies with L. lactis and S. pneumoniae fostered the idea that the absence of response to GTP by CodY may be a general feature of this related family of low-G+C gram-positive cocci (10, 14, 34). However, because (p)ppGpp accumulation occurs at the expense of intracellular GTP pools, the growth behavior of the
relAPQ and
relAPQ
codY mutants lacking (p)ppGpp in medium lacking leucine and/or valine also raises the possibility that reductions in GTP levels or increases in (p)ppGpp pools, individually or in concert, influence CodY activity in S. mutans. To evaluate whether GTP pools play a role in the activation of the S. mutans CodY, we used decoyinine to reduce GTP levels. Decoyinine is an analog of adenosine that causes a decrease in intracellular GTP levels by inhibiting GMP synthetase (26). In B. subtilis and L. lactis, the intracellular GTP levels were significantly lowered by the addition of 500 µg ml–1 decoyinine (34, 35). Thus, we used 500 µg ml–1 as a starting point for our experiments. The addition of decoyinine to the growth medium reduced the growth rates of S. mutans strains (data not shown) and decreased GTP levels by approximately 70% in the wild-type strain, as assessed by TLC (Fig. 2A). The addition of inhibitory concentrations of decoyinine (1.5 mg ml–1) to exponentially growing cells resulted in a slightly greater reduction in GTP levels (approximately 80%) that was comparable to the reductions in GTP pools that were observed during mupirocin treatment, a condition that strongly induces (p)ppGpp production at the expense of GTP and GDP (Fig. 2A).
![]() View larger version (39K): [in a new window] |
FIG. 2. Effects of decoyinine and mupirocin on GTP/(p)ppGpp ratios and ilvE gene expression. (A) TLC depicting GTP and (p)ppGpp pools in S. mutans UA159 (wild type) grown in the presence of decoyinine (DEC) or treated for 30 min with 500 µg ml–1 decoyinine (0.5 DEC), 1.5 mg ml–1 decoyinine (1.5 DEC) or 500 ng ml–1 mupirocin (MUP). (B) Real-time PCR was used to quantify ilvE mRNA in S. mutans strain UA159 and the codY strain treated for 30 min with decoyinine or mupirocin (500 µg ml–1 and 500 ng ml–1, respectively). The data represent the means and standard deviations (error bars) of the results of four independent experiments. Differences that were found to be statistically significant (Student's t test) are indicated by brackets.
|
relAPQ strain when leucine or valine was removed from the growth medium (data not shown). Next, we tested whether the addition of decoyinine (500 µg ml–1 or 1.5 mg ml–1) to exponentially grown cultures would alleviate the repression of ilvE, a well-known target of CodY repression. The results of real-time PCR analysis indicated that lowering GTP pools through decoyinine did not affect ilvE expression, whether growth-inhibitory (Fig. 2B) or -noninhibitory concentrations of decoyinine were used (data not shown). Comparison of the absolute amounts of ilvE mRNA observed in the wild-type and
codY strains clearly indicated that CodY acts as a repressor of ilvE expression (Fig. 2B). Unexpectedly, a small but significant induction of ilvE was observed in the codY mutant when it was grown in the presence of decoyinine. We also assessed the expression of ilvE in cells treated with mupirocin and found that ilvE is strongly induced by this analog of isoleucine (Fig. 2B). Because a similar pattern of induction was observed in both the parental and codY mutant strains, it appears that the effects of mupirocin, which increases (p)ppGpp pools and lowers GTP levels, are independent of functional CodY. We also assessed the expression patterns of ilvB in the wild-type and
codY strains treated with decoyinine or mupirocin. The results obtained for ilvB were nearly identical to the results obtained for ilvE (data not shown). Based on the results described above, it is tempting to speculate that (p)ppGpp positively regulates ilv gene expression. Of note, (p)ppGpp has been shown to exert a positive effect on transcription from promoters controlling amino acid biosynthetic operons in E. coli (33). Collectively, the results presented above provided strong evidence that S. mutans CodY is not activated by GTP, consistent with the results of studies of L. lactis and S. pneumoniae CodY. Based on the consensus sequence of the putative GTP-binding motifs G1, G3, and G4 of CodY proteins (35), L. lactis, S. pneumoniae, and S. mutans each have multiple amino acid substitutions at normally conserved residues. Notably, a single amino acid change in G1 was shown to cause loss of CodY-mediated repression in B. subtilis (35, 40).
Effects of codY inactivation on biofilm formation and acid tolerance.
The pathogenic potential of S. mutans is directly related to the organism's ability to adhere and form biofilms on the tooth surface and to survive large and rapid changes in environmental pH (18). To evaluate the physiological consequences of loss of CodY in S. mutans and to better understand the relationship of (p)ppGpp/GTP ratios with CodY activation in controlling critical virulence attributes of S. mutans, biofilm and stress susceptibility assays were carried out with the
codY (JLcodY),
relAPQ (JLT1), and
relAPQ
codY (JLQ1) strains.
In S. mutans, there are two distinct mechanisms to colonize tooth surfaces: sucrose-independent adherence that is important for the initial attachment to the salivary constituents in enamel pellicle and a sucrose-dependent pathway involving the production of glucans, extracellular homopolymers of glucose which are formed through the action of glucosyltransferase enzymes and bound by glucan binding proteins (5, 32). Biofilm assays were conducted by using semidefined BM medium containing either glucose or sucrose as the supplemental carbohydrate sources. The ability of the
codY and
relAPQ
codY strains to form biofilms in the presence of glucose or sucrose was significantly reduced in comparison to that of the parental strain (Fig. 3). The results of recent studies have demonstrated the involvement of CodY in biofilm maturation in other GPB. In Bacillus cereus, the disruption of codY resulted in a biofilm-defective phenotype (15). In an S. aureus clinical isolate, transposon mutagenesis identified CodY as important for proper biofilm formation (45). However, the results in a more-recent report suggested the opposite and showed that the production of the polysaccharide intercellular adhesin was enhanced in a codY mutant (23). Notably, the
relAPQ strain did not show altered biofilm accumulation in either glucose or sucrose. This latter finding was somewhat unexpected because a strain lacking RelA alone showed significant reductions in biofilm formation when grown in glucose (19). However, as noted above, the RelA enzyme is the only protein in S. mutans that contains the conserved (p)ppGpp hydrolase domain, and we have shown that the
relA strain accumulates (p)ppGpp in vitro (19). Thus, the biofilm-deficient phenotype of the
relA strain could be a result of unregulated accumulation of (p)ppGpp generated by the RelP and RelQ enzymes, which could affect the expression of adhesins or genes required for intercellular interactions.
![]() View larger version (13K): [in a new window] |
FIG. 3. Biofilm formation by S. mutans UA159 (wild type) and its derivatives. Cultures were grown in a microtiter plate containing BM supplemented with glucose (A) or sucrose (B) at 37°C for 24 h. The graph shows the averages and standard deviations (error bars) of the results of three independent experiments. Asterisks indicate results that differ significantly from the results for UA159 (P 0.05; Student's t test).
|
codY and
relAPQ
codY strains, were more sensitive to low pH, whereas the
relAPQ strain grew as well as the wild type (Fig. 4). All strains grew equally well in plates adjusted to pH 7.0. In addition to sudden and abrupt changes in pH, organisms in the oral cavity also have to cope with other environmental stress, including oxidative and osmotic shock (18). Thus, we used a disk diffusion assay to test the susceptibility of the strains to H2O2 and NaCl. For this purpose, filter paper disks were saturated with either 0.5% H2O2 or 0.5 M NaCl and placed on the surface of agar plates that contained a uniform layer of an exponentially grown bacterial culture. Based on the diameters of the zones of inhibition, no differences in sensitivity to H2O2 or NaCl were observed among the wild type and all knockout strains tested (data not shown).
![]() View larger version (27K): [in a new window] |
FIG. 4. Growth of S. mutans UA159 and its derivatives on BHI plates adjusted to pH 7.0 or 5.0. Strains were grown in BHI to an OD600 of 0.3 and serially diluted in PBS, and 5-µl aliquots were spotted onto plates that were incubated at 37°C for 72 h. Numbers correspond to the dilution factors for each individual culture, and images representative of the results of three individual experiments are shown.
|
codY mutant.
Given that CodY affects biofilm formation and acid tolerance, which are two critical virulence attributes of S. mutans, and that there is considerable support for the idea that the evolution of the role of CodY in this oral pathogen may be substantively different than in some other bacteria, we assessed the scope of the CodY regulon of S. mutans by transcription profiling. RNA was isolated from mid-exponential-phase (OD600 = 0.3) cultures of UA159 and the
codY strain grown in complete FMC medium, and microarray analysis was performed as previously described, with the modifications noted in Materials and Methods. A total of 79 genes were differentially transcribed at an assigned P value of
0.005, with 63% (n = 50) upregulated and 37% (n = 29) downregulated (see Table S1 in the supplemental material). For simplicity, the 79 differentially expressed genes were grouped into eight functional categories (Fig. 5). The higher number of upregulated genes was consistent with the finding that CodY functions as a repressor. In contrast, the number of downregulated genes in the S. mutans codY mutant was surprisingly high in comparison with the results of previous microarray analysis of
codY strains of other GPB (11, 12, 14, 28). The elevated number of downregulated genes may be a result of indirect effects of CodY inactivation but, as is discussed below, may also indicate that CodY can function both as a repressor and an activator. To validate the microarray data, real-time quantitative RT-PCR was performed on 11 genes found to be differentially expressed in the mutant, and all genes displayed the same trends observed in the microarrays (see Table S1 in the supplemental material).
![]() View larger version (11K): [in a new window] |
FIG. 5. Number of genes, grouped in functional categories, that were differentially expressed in strain JLcodY ( codY) relative to their levels of expression in UA159 (wild type). Gene annotations are based on information provided by the Los Alamos National Laboratory (www.oralgen.lanl.gov) or by published literature available at the same website.
|
codY strain. Notably, three putative transcriptional regulators (smu112c, smu1287, and smu2027) were upregulated in the mutant, indicating that other regulators potentially amplify the effect of CodY inactivation in the transcriptome. Of the 50 genes found to be upregulated in the
codY strain, 66% encoded hypothetical proteins of unknown function (Fig. 5). The fact that the codY mutant has impaired capacity to form biofilms and displays an acid-sensitive phenotype suggests that some of these hypothetical proteins may contribute to the pathogenic potential of this organism, making those genes attractive targets for future studies.
(ii) Downregulated genes.
In comparison to results for other GPB, a large number of genes were found to be downregulated in the S. mutans codY mutant. A recent study of S. pneumoniae and two independent studies of L. lactis revealed a very limited number of genes that depend on CodY for optimal expression. For example, Guédon and colleagues identified 110 genes that were differentially expressed in an L. lactis codY mutant in comparison to their levels of expression in the parental strain, but only 6 genes were found to be downregulated (12). In S. pneumoniae, 43 of 47 genes that were differentially expressed in the codY mutant were upregulated (14). Among the 29 genes found to be downregulated in the S. mutans
codY mutant, almost half of the genes (n = 13) encode products involved in transport and binding processes. Among those genes, 11 encode subunits of ABC transporters predicted to participate in amino acid uptake. In addition to ABC transporters, a gene encoding a putative ferrous ion transport protein (feoA) and a putative sodium/amino acid symporter (smu1175) were repressed in the codY mutant. This finding was unexpected because CodY has been shown to repress genes involved in amino acid transport in B. subtilis and L. lactis (11, 41). Among the genes found to be downregulated, many appear to be cotranscribed. For example, an entire five-gene operon (smu932-smu936) predicted to encode proteins for an ABC transporter and a six-gene cluster encoding hypothetical proteins of unknown function (smu277-smu285) were found to be downregulated in the
codY mutant. Moreover, many genes that appear to be cotranscribed with genes identified at a P value of
0.005 were often found to show the same trend at a P value of
0.01 (data not shown). Altogether, the 29 genes found to be downregulated in the
codY strain are organized in 16 transcriptional units.
Identification of CodY boxes upstream of genes affected by the codY mutation.
In L. lactis, a conserved 15-bp palindromic sequence (AATTTTCWGAAAATT) was shown to serve as a high-affinity binding site for CodY (11, 12). This "so-called" CodY box was found predominantly upstream of genes involved in amino acid transport and metabolism. Interestingly, this motif is also found in the upstream region of codY, suggesting that CodY could be autoregulated. The CodY box is also present in other GPB, including S. mutans, and probably serves as an operator site for CodY proteins in general (12). In an attempt to distinguish direct and indirect effects of the loss of CodY on gene expression in our microarray data, we searched for the CodY box in the upstream regions of the 79 differentially expressed genes. The criteria for assigning CodY-binding boxes included five or fewer mismatches with the consensus sequence and location within 100 bp of the start codon. Of the 50 genes that were upregulated in the
codY strain, 17 genes were shown to contain a putative CodY box in the region proximal to the start codon. Interestingly, our searches revealed the presence of putative CodY boxes in at least six genes that were downregulated in the
codY strain, emphasizing the possibility that CodY may also be able to function as a transcriptional activator in S. mutans. Previously, the gene encoding acetate kinase (ack) in B. subtilis was shown to be positively regulated by CodY and CcpA (37). Work is under way to evaluate whether CodY can specifically bind to the regulatory regions of the genes identified in the microarray experiments that contain a putative CodY box.
By searching for the CodY box in the genomes of GPB, Guédon and colleagues identified 13 genes in S. mutans that contain the CodY motif (12). Among those were genes involved in BCAA biosynthesis (ilvB, ilvE, and leuA), additional genes involved in amino acid metabolism (akh, hom, hisC, serC, and thrC), the oligopeptide ABC transporter operon (opp), and codY itself. Figure 6 displays an alignment of CodY motifs identified in this study and previously (12) which confirms the presence of consensus CodY-binding sequences in S. mutans.
![]() View larger version (104K): [in a new window] |
FIG. 6. ClustalW alignment of putative CodY-binding boxes in upstream regions of S. mutans genes. Conserved regions are in shaded boxes, and a consensus sequence is shown below the alignments. Symbols: *, gene was flagged on microarray experiments with codY strain (JLcodY); **, gene was identified by Guédon et al. (12); #, gene was downregulated in JLcodY.
|
Published ahead of print on 6 June 2008. ![]()
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»