Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jeong, J.-H. Articles by Choy, H. E. Search for Related Content PubMed PubMed Citation Articles by Jeong, J.-H. Articles by Choy, H. E.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 2008, p. 6340-6350, Vol. 190, No. 19
0021-9193/08/$08.00+0     doi:10.1128/JB.00385-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Salmonella enterica Serovar Gallinarum Requires ppGpp for Internalization and Survival in Animal Cells

Jae-Ho Jeong,^1,2 Miryoung Song,^1,2 Sang-Ik Park,^1,3 Kyoung-Oh Cho,^1,3 Joon Haeng Rhee,^1,2 and Hyon E. Choy^1,2*

Center for Host Defense against Enteropathogenic Bacteria Infection and Research Institute of Vibrio Infection,¹ Department of Microbiology, Chonnam National University Medical College, Gwangju 501-746, South Korea,² Biotherapy Human Resources Center, College of Veterinary Medicine, Chonnam National University, Gwangju 500-757, South Korea³

Received 17 March 2008/ Accepted 30 June 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
To elucidate the pathogenic mechanism of Salmonella enterica serovar Gallinarum, we examined the expression of the genes encoded primarily in Salmonella pathogenicity island 1 (SPI-1) and SPI-2. These genes were found to be induced as cultures entered stationary phase under high- and low-oxygen growth conditions, as also observed for Salmonella serovar Typhimurium. In contrast, Salmonella serovar Gallinarum in the exponential growth phase most efficiently internalized cultured animal cells. Analysis of mutants defective in SPI-1 genes, SPI-2 genes, and others implicated in early stages of infection revealed that SPI-1 genes were not involved in the internalization of animal cells by Salmonella serovar Gallinarum. Following entry, however, Salmonella serovar Gallinarum was found to reside in LAMP1-positive vacuoles in both phagocytic and nonphagocytic cells, although internalization was independent of SPI-1. A mutation that conferred defects in ppGpp synthesis was the only one found to affect animal cell internalization by Salmonella serovar Gallinarum. It was concluded that Salmonella serovar Gallinarum internalizes animal cells by a mechanism independent of SPI-1 genes but dependent on ppGpp. Intracellular growth also required ppGpp for the transcription of genes encoded in SPI-2.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Salmonella enterica serovar Gallinarum is a fowl-adapted pathogen causing typhoid fever in chickens, often with a high mortality rate. (59). Most western countries have succeeded in the elimination of the diseases by improving the surveillance and slaughter practices. However, in South America and Asia, outbreaks of fowl typhoid have seriously threatened the poultry industry (60).

In contrast to other Salmonella serotypes, little is known about the genetic basis of Salmonella serovar Gallinarum virulence and the molecular mechanisms involved in systemic infection and the development of fowl typhoid. The 85-kb serovar Gallinarum plasmid is known to be essential for virulence (6). Two pathogenicity islands, Salmonella pathogenicity island 1 (SPI-1) and SPI-2, which play key roles in mediating disease by Salmonella enterica through their respective type III secretion systems (TTSS) (36), have been described. The TTSS mediates the translocation of various virulence-associated effector proteins from bacteria into the host cells (33). Based on studies of the cellular and molecular mechanisms of typhoid-like disease in S. enterica serovar Typhimurium-infected mice, SPI-1 is considered to be essential for the invasion of animal cells by Salmonella, and SPI-2 is required for intracellular proliferation and survival (16, 29). Several of the other SPIs have also been identified in serovar Gallinarum, and these SPIs share significant homology with those from other serovars, although their functional role has yet to be confirmed (56, 67).

In the case of serovar Typhimurium, the SPI-1-encoded TTSS translocates bacterial effector proteins into the host cell cytosol to reorganize the cytoskeleton during invasion, resulting in membrane ruffling and eventual bacterial uptake, in which bacteria are enclosed in a membrane-bound vacuole, the Salmonella-containing vacuole (SCV) (26). The survival of bacteria within the SCV has been attributed to the incomplete fusion of this phagosome with the prelysosomal and lysosomal compartments (27, 52). Phagocytes normally incorporate microorganisms into a membrane-bound compartment or phagosome, which matures by sequential fusion with a series of endomembrane compartments (21). The resulting changes in its composition and luminal pH confer its characteristic bactericidal properties to the phagosome. The survival of Salmonella can be attributed to its seclusion within SCVs, rendering it inaccessible to most host defense mechanisms (21, 27, 52, 68).

It has been well documented that the expression of the SPI-1 secretion system and the expression of its secreted effectors in serovar Typhimurium are coordinately regulated by SPI-1-encoded HilA, a member of the OmpR/ToxR family of transcriptional regulators (42). Other SPI-1 genes regulated by HilA include invF and sicA (15, 17, 18). InvF, a member of the AraC/XylS family of transcriptional regulators, in conjunction with SicA, a TTSS chaperone, takes part in the coordinated regulation of all SPI-1-encoded genes. It was previously shown that SPI-1-encoded genes in serovar Typhimurium, including hilA, are induced at the onset of stationary phase (late exponential phase) under physiologically well-defined standard growth conditions (LB with vigorous aeration) (63) and that stationary-phase induction requires the stringent signal molecule ppGpp (7). A recent study revealed that the expression of SPI-2 genes is also ppGpp dependent (66). ppGpp is synthesized by two synthetases, PSI and PSII, which are encoded by the relA and spoT genes, respectively. Enteric bacteria exert a stringent control over ribosome production that is mediated by ppGpp during the transition from exponential growth to stationary phase (54, 65). The accumulation of ppGpp at the end of the exponential phase has been considered to result in a reduction of stable RNA synthesis and the activation of those genes involved in the maintenance of growth-arrested physiology and the survival of environmental stresses (7, 11).

In an attempt to elucidate the pathogenic mechanism of serovar Gallinarum, we have examined various serovar Gallinarum mutants defective in SPI-1- or SPI-2-encoded genes and found that SPI-1-encoded genes are not involved in the uptake of bacteria into animal cells, although they were induced and secreted in a manner similar to that seen for serovar Typhimurium at the onset of stationary phase during growth under standard conditions. Microscopic observation revealed that serovar Gallinarum resides in SCVs following entry into both phagocytic and nonphagocytic cells. We thus conjectured that an alternative route independent of SPI-1 is responsible for the uptake of serovar Gallinarum into animal cells. Here, we demonstrate that among various serovar Gallinarum mutants, only ppGpp-defective serovar Gallinarum showed significantly reduced entry into several types of animal cells, suggesting that the factor(s) involved in animal cell entry is under the control of ppGpp.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bacterial strains. The serovar Gallinarum strains, all derived from wild-type SG3001, used in this study are listed in Table 1. All bacterial strains were constructed according to the method developed by Datsenko and Wanner (19). The gene(s) carrying either kan or cat in the place of its open reading frame(s) was generated by PCR amplification using the respective pair of 60-nucleotide (nt) primers that included 40-nt homology extensions and 20-nt priming sequences with pKD13 as a template (Table 2). The PCR products were purified and transformed into bacteria carrying a Red helper plasmid (pKD46) by electroporation. The electrocompetent cells were grown in LB broth with ampicillin and L-arabinose (1 mM) at 30°C to an optical density at 600 nm of 0.5. The mutants were confirmed by PCR using original and common test primers: k1 (CAGTCATAGCCGAATAGCCT) and k2 (CGGCCACAGTCGATGAATCC) for kan or C1 (TTATACGCAAGGCGACAAGG) and C2 (GATCTTCCGTCACAGGTAGG) for cat. Serovar Typhimurium strains carrying lacZ genes transcriptionally fused to the hilA or ssrAB promoter on the chromosome adjacent to putA gene were constructed by the modification of the method developed previously (19, 61). Briefly, we cloned the hilA (positions –200 to +100) or ssrB (positions –200 to +100) promoter region into a plasmid derived from pRS415 (61), which carried a lacZ structural gene and a cat gene in the place of lacYA in pRS415 (data not shown). Test promoter::lacZ::cat was amplified with primers that contain sequences for the putA site of S. enterica serovar Typhimurium: 5' primer GAAATCGCCTGTTAATGGTACCAATAGCCTTGACGCAATAGAGTAATGACCGAGGCCCTTTCGTCTTCAAGAATT and 3' primer CGTCAT TGTCAGTCTCTTACAGAAAGATTACACGATTATTTCATCGGCAGGAGACGTGTGTAGGCTGGAGCTGCTTC, which consisted of 50 or 55 nt of putA (putA sequences are underlined) and 25- or 22-nt sequences flaking pro-moter::lacZ::cat in the above-described plasmids. The 5-kbp PCR products were purified and transformed into bacteria carrying a Red helper plasmid (pKD46) by electroporation. This putA::test promoter::lacZ::cat construct was confirmed by PCR.

View this table: [in this window] [in a new window]

TABLE 1. Salmonella strains used in this study

View this table: [in this window] [in a new window]

TABLE 2. Oligonucleotide primers used to generate gene knockout strains

Growth conditions. Except when indicated otherwise, cultures were grown in LB medium (Difco Laboratories) containing 1% NaCl with vigorous aeration at 37°C. For solid support medium, 1.5% granulated agar (Difco Laboratories) was included. Nutrient broth and brain heart infusion medium were purchased from Difco Laboratories. Antibiotics were obtained from Sigma Chemical. When present, antibiotics were added at the following concentrations: 50 µg/ml ampicillin, 50 µg/ml kanamycin, 15 µg/ml chloramphenicol, and 15 µg/ml tetracycline.

Protein analysis of culture supernatants. Cultures were grown in 5 ml LB broth with antibiotics and vigorous aeration overnight and then harvested. Bacteria were pelleted at 8,000 x g for 15 min, and supernatants were immediately transferred into clean tubes. The supernatants were filtered through a 0.45-µm-pore-size syringe filter (Sartorius), and proteins were precipitated with cold trichloroacetic acid at a final concentration of 10%. The proteins were collected by centrifugation at 8,000 x g at 4°C for 15 min and resuspended in 1 ml cold acetone. These mixtures were centrifuged for 15 min at 8,000 rpm at 4°C, and pellets were resuspended in 20 µl 1x phosphate-buffered saline (PBS). Protein sample buffer containing β-mercaptoethanol was added to the samples, which were boiled for 5 min, and proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (7.5%). Proteins were visualized with silver stain (63). Protein markers were obtained from Bio-Rad.

β-Galactosidase assay. β-Galactosidase assays were performed essentially as described previously by Miller (45) except that cells were permeabilized with Koch's lysis solution (51). For determinations of β-galactosidase levels in bacteria at different stages of growth, bacteria cultured overnight were diluted 1:50 into medium with or without antibiotics as described in the text. Cultures were incubated further at 37°C to stationary phase. Samples were taken for enzyme assays at regular time intervals. Each strain was assayed in triplicate, and average enzyme activities were plotted as a function of time.

Primer extension analysis. Total RNA was obtained from Salmonella serovar Gallinarum strains using Trizol reagent according to the manufacturer's instructions (Invitrogen). Approximately 50 µg total RNA was isolated from 50 ml cell culture. The primers used to detect the hilA and ssrB transcripts were SGhilApx (5'-TAATCACAGTTAGTTATAACAATATTATTA-3') and SGssrBpx (5'-CGCGAGGGCAGCAAAATCAAAGAATATAAG-3'), respectively. The ³²P-labeled primers (50,000 cpm) were coprecipitated with 50 µg total RNA. Primer extension reactions were performed as described previously by Shin et al. (58).

Infection assay. Infection (gentamicin protection) assays were performed essentially as described previously (40). Mouse peritoneal macrophages (MPM) from specific-pathogen-free BALB/c mice and chicken peritoneal exudate macrophages (CPM) and chicken embryo fibroblasts (CEF) from specific-pathogen-free inbred Salmonella-susceptible White Leghorn chickens (8 to 12 weeks old) (Hy-Vac, IA) (68, 69) were prepared as previously described (8). RAW264.7 cells and HEp-2 cells were grown in Dulbecco's modified Eagle's medium (Gibco BRL) with 10% fetal bovine serum (Gibco BRL) at 37°C under 5% CO₂. Bacteria were grown to the early stationary phase and resuspended at the appropriate dilution in cell culture medium for the infection of cell monolayers. Bacteria were added to MPM, CPM, RAW264.7, CEF, and HEp-2 cells at the ratios indicated in the text, and the mixtures were incubated at 37°C under 5% CO₂ for 30 min. Infected cells were washed three times with PBS (pH 7.4), Dulbecco's modified Eagle's medium containing gentamicin (20 µg/ml; Sigma) was added, and the mixtures were incubated for the indicated time period. Intracellular bacteria were harvested by extraction with lysis buffer (0.05% Triton X-100 in PBS [pH 7.4]) and replica plated for colony counting on brain heart infusion agar plates.

Immunostaining and fluorescence microscopy. HEp-2 and RAW264.7 cells were plated onto eight-well LabTec Chamber slides (Nunc). These cells were washed twice with PBS and placed into Dulbecco's modified Eagle's medium (with 5% fetal bovine serum). A bacterial culture grown overnight was subcultured into LB broth, grown to early stationary phase, and used for invasion. The animal cells were infected with bacteria at a multiplicity of infection (MOI) of 10 and incubated for 8 h in the presence of 20 µg/ml gentamicin. After incubation, the animal cells infected with serovar Gallinarum were fixed with formaldehyde (3.7%) and stained with anti-LAMP1 mouse monoclonal antibody (H4A3; Santa Cruz Biotech), Texas Red-conjugated goat anti-mouse immunoglobulin G (IgG) (Molecular Probes), and DAPI (4',6'-diamidino-2-phenylindole) according to the protocol described previously by Scott et al. (55). Salmonella serovar Gallinarum was detected by rabbit anti-salmonella IgG and fluorescein isothiocyanate-conjugated donkey anti-rabbit IgG (Serotec). Colocalization of intracellular serovar Gallinarum with SCV markers (LAMP1) was determined using an Olympus BX51 microscope and an imaging program (analySIS LS starter) (55).

PCR amplification and analysis of SPI-encoded genes. For PCR analysis of serovar Gallinarum isolate used in this study, oligonucleotide primers (Genotech, Daejon, South Korea) targeting the genes in SPI-1 to SPI-5 of serotype Typhimurium were used (Table 2) (1). PCRs were performed in a total volume of 50 µl containing 1x PCR buffer without MgCl₂, 2.5 mM MgCl₂, 1 µg DNA/ml, 0.3 µM each primer, 0.25 mM each deoxynucleoside triphosphate, and 1 U Taq DNA polymerase (Takara). PCRs were carried out using a Bio-Rad thermocycler. Species-specific amplification consisted of 30 cycles of 1 min at 94°C, 45 s of an annealing step, and 45 s at 72°C. The first cycle of the amplification program was preceded by incubation for 5 min at 94°C and followed by a final 5-min extension step at 72°C. Negative controls containing no DNA template were included in parallel. Five-microliter samples of the PCR products were analyzed by electrophoresis in a 0.7% agarose gel in Tris-acetate-EDTA buffer and visualized by UV illumination after ethidium bromide staining.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Analysis of SPIs in Salmonella serovar Gallinarum. In an attempt to elucidate the pathogenic mechanism of serovar Gallinarum, we carried out comparative studies between serovar Gallinarum and a better-characterized serovar, serovar Typhimurium. The representative serovar Gallinarum used in this study was isolated from the chicken liver with fowl typhoid in a South Korean broiler farm and identified by the modified rapid slide agglutination test in 2001 (53). The natural serovar Gallinarum isolate used in this study was found to be fully infectious, suggesting that the strain contains all virulence components necessary for fowl infection (see below) (31). The genetic organization of this serovar Gallinarum isolate was investigated by determining sizes of the genes amplified by PCR using the primer sets specific to DNA sequences within SPI-1 to SPI-5, previously employed to analyze the variation between serovars of S. enterica within SPIs (Table 3) (1). PCR amplification was performed with chromosomal DNA isolated from serovar Gallinarum. The PCR products, a total of 14 amplicons, were found to be exactly the same size as those predicted for serovar Typhimurium (Fig. 1). All the SPI loci from different serovars share approximately the same distribution of similarities as the genomes as a whole (varying between 97.7% and 98.6% identity), which suggested that they were acquired soon after the divergence of Salmonella from E. coli (22, 44, 46, 48). Thus, we speculated that the genetic structure of the serovar Gallinarum isolate, at least that of the SPI loci, does not differ significantly from that of serovar Typhimurium, implying that the roles of these genes in serovar Gallinarum and serovar Typhimurium may be similar.

View this table: [in this window] [in a new window]

TABLE 3. Oligonucleotide primers for PCR amplification of SPI-encoded gene fragmentsa

View larger version (38K): [in this window] [in a new window]

FIG. 1. Analysis of gene fragments encoded by SPIs (SPI-1 to SPI-5) in Salmonella serovar Gallinarum. The PCR product in each lane (lanes 1 to 14) was obtained using the respective primer sets shown in Table 3. The primer sets specific to sequences flanking the indicated SPI genes were the same as those previously described (1).

Expression from major promoters in SPI-1 and -2 in Salmonella serovar Gallinarum. It was previously shown that SPI-1-encoded genes in serovar Typhimurium are expressed at the onset of stationary phase when bacteria are grown under standard laboratory conditions, in LB with vigorous aeration, and that early-stationary-phase cultures are therefore most invasive (63). This was found to be due to the selective expression of the master regulator hilA upon entry into stationary phase. Similarly, it was previously reported that SPI-2-encoded genes are also activated at entry into stationary phase under the same aerobic growth conditions (66). We therefore monitored the levels of expression of hilAp and ssrABp (located in SPI-2) in serovar Gallinarum under standard growth conditions. First, transcription from these promoters was verified in serovar Gallinarum. Total RNA was extracted from serovar Gallinarum cells grown to early stationary phase, and specific transcripts generated from hilAp and ssrABp were analyzed by the primer extension method (Fig. 2). This analysis revealed that the DNA sequences surrounding the two promoters (between positions –200 and +100) and the transcription start sites were the same, suggesting that a similar mechanism governs these promoters. Next, hilAp and ssrABp activities were determined in serovar Gallinarum cells carrying these promoters fused to lacZ. To avoid possible complications due to changes in the copy number of plasmid-borne test promoters during growth to stationary phase, we placed the promoter::lacZ constructs on the serovar Gallinarum chromosome near the putA site using a modified linear DNA transformation method (19, 24). We found that both promoters were activated at the onset of stationary phase when serovar Gallinarum was grown under standard conditions, as determined by the β-galactosidase assay (Fig. 3), further supporting the possibility that at least SPI-1 and SPI-2 in serovar Gallinarum function similarly as in serovar Typhimurium.

View larger version (60K): [in this window] [in a new window]

FIG. 2. Identification of the hilA and ssrB transcriptional start sites by primer extension. The right panel shows the hilA transcript (arrow) and the left panel shows the ssrB transcript (arrow) next to DNA sequencing ladders. The circled letter indicates the transcriptional start site, +1.

View larger version (14K): [in this window] [in a new window]

FIG. 3. Expression of hilAp::lacZ (left) and ssrABp::lacZ (right) in Salmonella serovar Gallinarum growing under standard conditions. The curves with open circles represent growth (A600), and the curves with filled circles represent promoter activities as determined by β-galactosidase assay (Miller units).

To further validate the functional expression of SPI-1 genes in serovar Gallinarum, we determined the presence of secreted effector proteins (35) in the culture medium at the onset of stationary phase (Fig. 4). Total supernatant was collected, precipitated, and analyzed by SDS-PAGE. The secreted proteins SipA (89 kDa), SipB (67 kDa), SipD (62 kDa), and SipC (42 kDa) were clearly detected in the supernatant of the serovar Gallinarum culture, similar to what was seen for the serovar Typhimurium culture (63). These proteins were not observed in mutants lacking the hilA or sipADCB gene block, validating the positive role of hilA in the expression of SPI-1 genes. It should be noted that these effector proteins were also undetected in a serovar Gallinarum mutant defective in ppGpp synthesis (relA spoT) (see below). Analysis of the DNA region encompassing SPI-1 in serovar Gallinarum by pulsed-field gel electrophoresis/long-range PCR (71) or comparative genomic hybridization (10, 50) revealed that it is not markedly different from that in serovar Typhimurium, suggesting that a mechanism similar to that in serovar Typhimurium would govern the expression of those SPI-1 genes in serovar Gallinarum.

View larger version (28K): [in this window] [in a new window]

FIG. 4. Expression of secreted TTSS components by various Salmonella strains. Proteins excreted into the media were analyzed on a 7.5% SDS-PAGE gel. The secreted proteins SipA (89 kDa), SipB (67 kDa), SipD (62 kDa), and SipC (42 kDa) were identified by their sizes as described previously (63). Protein markers are shown in the far left lane. MW, molecular weight marker (in thousands).

Entry of Salmonella serovar Gallinarum into cultured animal cells. To monitor the entry of animal cells and intracellular replication by serovar Gallinarum, we first determined its internalization capability using various animal cells including MPM, HEp-2, RAW264.7, CPM (peritoneal exudates), and CEF cells (Fig. 5). Human pharyngeal epithelial HEp-2 cells and murine macrophage-like RAW264.7 cells are the most commonly used cell lines to assay for infection by serovar Typhimurium. MPM and chicken-derived cells (CEM and CEF) were extracted from BALB/c mice and Salmonella-susceptible White Leghorn chickens, respectively (8, 69). Serovar Gallinarum has been shown to proliferate in macrophages from the susceptible line due to the inefficient expression of proinflammatory chemokines and cytokines (68, 69). Serovar Gallinarum cells grown under the standard conditions were mixed with the animal cells at an MOI of 10 for 30 min, and intracellular bacteria were counted. Serovar Typhimurium was included as a control. The number of intracellular bacteria varied depending on the cell type. However, it was clear that serovar Gallinarum inefficiently entered each of these cell types, at about 10% of the frequency of that observed for serovar Typhimurium (ST), which might be due to a different antigenicity (O9) or a lack of motility (4, 68). This result is consistent with reports that serovar Gallinarum poorly internalizes and survives in animal cells, even those of chicken origin (3, 14).

View larger version (24K): [in this window] [in a new window]

FIG. 5. Internalization capability of serovar Gallinarum (black bars) in comparison with that of serovar Typhimurium (gray bars) using various animal cells including RAW264.7, MPM, HEp-2, CEF, and CPM cells.

We then analyzed the entry of serovar Gallinarum at different phases of growth cultured under standard conditions (LB with aeration) into phagocytic (RAW264.7) and nonphagocytic (HEp-2) cells (Fig. 6, black bars). Most interestingly, the internalization capability of serovar Gallinarum during exponential growth (2 h) was significantly greater than that at early (4 h) or late (8 h) stationary phase and overnight culture in both cell types. Clearly, this finding is inconsistent with the hilAp activity measured under standard growth conditions (Fig. 3). It was previously reported that the expression of SPI-1-encoded genes including TTSS components is activated during growth under specific culture conditions (2). Specifically, anaerobiosis was shown to increase the internalization of serovar Typhimurium by HEp-2 cells (2, 25, 39). We therefore grew serovar Gallinarum in low oxygen and measured its invasiveness using the same animal cells (Fig. 6, gray bars). In contrast to what was seen for serovar Typhimurium (63), serovar Gallinarum grown in low oxygen was more invasive than when grown under standard conditions. Moreover, exponential-phase serovar Gallinarum grown in low oxygen was consistently most invasive for both types of animal cells. We therefore determined the levels of expression from hilAp in serovar Gallinarum and serovar Typhimurium grown in low oxygen using hilAp::lacZ fusion strains and found that hilAp was activated at the onset of stationary phase, similar to what was found under standard growth conditions (Fig. 7). Note that the degree of induction was much greater in serovar Gallinarum than in serovar Typhimurium. This set of results revealed a discrepancy: the early-exponential-phase culture was most readily internalized, while hilA and, therefore, those SPI-1 genes under its control were highly expressed later at the onset of stationary phase irrespective of growth conditions. These results suggested that for serovar Gallinarum, SPI-1 genes might not be involved in the uptake into animal cells.

View larger version (11K): [in this window] [in a new window]

FIG. 6. Internalization of animal cells by Salmonella serovar Gallinarum at different growth phases under low-oxygen (gray bars) and high-oxygen (black bars) conditions. RAW264.7 (right) and HEp-2 (left) cells were infected with serovar Gallinarum harvested at the indicated time at an MOI of 10, and intracellular gentamicin-resistant bacteria were counted by a standard method (38). The fractions of intracellular bacteria (percent) are plotted.

View larger version (21K): [in this window] [in a new window]

FIG. 7. Expression of hilAp::lacZ in serovar Typhimurium (circles) or in serovar Gallinarum (triangles) grown under low-oxygen conditions. The curves with open symbols represent growth (A600), and the curves with closed symbols represent hilAp activity, as determined by a β-galactosidase assay (Miller units).

Intracellular localization of Salmonella serovar Gallinarum. SPI-1-encoded TTSS in serovar Typhimurium are essential for the internalization of bacteria into both phagocytic and nonphagocytic cells, and they function by actively reorganizing the host cell actin cytoskeleton. Once inside the host, the bacteria reside in large SCVs that selectively interact with elements of the endocytic pathway (64). We therefore examined whether internalized serovar Gallinarum was associated with the SCV despite the apparent absence of a functional role for SPI-1-encoded genes in internalization, as indicated by the above-described results. LAMP1, a lysosomal glycoprotein known to be recruited to mature SCVs within 30 min of infection (52), was visualized together with serovar Gallinarum by microscopy. Phagocytic (RAW264.7) (Fig. 8, top) and nonphagocytic (HEp-2) (Fig. 8, bottom) cells were infected with serovar Gallinarum at an MOI of 10 and incubated for 8 h before staining for LAMP1 and bacteria with specific antibodies and nuclei with DAPI. In both cell types, we could visualize SCV by staining for LAMP1 in cytosolic compartments following serovar Gallinarum infection. Serovar Gallinarum colocalized with LAMP1 in SCVs only in the infected cells (Fig. 8A and B). Note that LAMP1 in uninfected cells was distributed evenly in the cytosolic compartments (Fig. 8C). It appears that serovar Gallinarum as well as serovar Typhimurium can generate SCVs, although its SPI-1-encoded TTSS and effector proteins may not play an obvious role during the internalization into animal cells.

View larger version (19K): [in this window] [in a new window]

FIG. 8. Colocalization of Salmonella serovar Gallinarum with SCV in animal cells as shown by immunofluorescence staining. RAW264.7 (top) and HEp-2 (bottom) cells were infected with serovar Gallinarum and incubated for 8 h in the presence of gentamicin (20 µg/ml). The cells were then fixed, permeabilized, and immunostained for LAMP1 (red) (b) and salmonellae (green) (c). Animal cell nuclei were stained with DAPI (blue) (a). (d) Merged images. Arrows mark the colocalization of intracellular Salmonella serovar Gallinarum and LAMP1. (A and B) Essentially the same Salmonella serovar Gallinarum-infected cells, except that A is shown at high magnification to show cytosolic details. (C) Uninfected cells for negative control.

A Salmonella serovar Gallinarum mutation affecting entry and intracellular survival. Finally, to identify the gene or gene block involved in the internalization of animal cells by serovar Gallinarum, we created a series of mutations at serovar Gallinarum loci reported to be implicated in early stages of pathogenesis by various Salmonella serotypes. These included hilA, invF, and the sipADCB gene block in SPI-1; ssrAB in SPI-2; the sef gene block in SPI-10; siiE in SPI-4; and the pilV gene block (23, 30, 72). SsrA and/or SsrB, a sensor kinase, in serovar Typhimurium is required for the expression of SPI-2 genes (12, 20, 34, 47, 57). A gentamicin protection assay (38) was employed to enumerate the intracellular bacteria after incubation of serovar Gallinarum mutants and nonphagocytic HEp2 cells for 30 min (Fig. 9). Only a mutant defective in ppGpp synthesis (relA spoT) exhibited a strikingly reduced level of internalization (>90%).

View larger version (29K): [in this window] [in a new window]

FIG. 9. Internalization of Hep-2 cells by wild-type (SG3001), hilA (SG3004), sipADCB (SG3021), invF (SG3022), ssrAB(SG3005), sefABCDR (SG3025), siiE (SG3023), pilV (SG3024), and relA spoT (SG3003) strains of Salmonella serovar Gallinarum. Bacteria were incubated with HEp-2 cells for 30 min at an MOI of 10. After removing excess bacteria by washing, internalized bacteria were counted by a standard plating method.

Subsequently, we determined the entry and intracellular replication capacities of ppGpp-defective mutants in various animal cells including RAW264.7, MPM, CPM, CEF, and HEp-2 cells (Fig. 10). Serovar Gallinarum derivatives with mutations in hilA in SPI-1 or in ssrAB in SPI-2 were also included. Wild-type serovar Gallinarum was internalized by these cells at a rate of about 0.1% at an MOI of 1 (10⁶ cells and 10⁶ bacteria) irrespective of cell type. The number of intracellular wild-type serovar Gallinarum cells increased 10³-fold during 24 h of incubation in all cell types. The hilA mutant internalized and replicated like wild-type serovar Gallinarum, and the ssrAB mutant invaded as well as the wild type but replicated poorly in all cell types tested. The ppGpp-defective mutant internalized much less efficiently than the wild type (10-fold less) and failed to replicate intracellularly in all cell types. We therefore determined the expression of SPI-2 genes in serovar Gallinarum using the strain carrying the ssrABp::lacZ construct inserted near the chromosomal putA locus under standard growth conditions (Fig. 11). ssrABp was found to be activated in wild-type serovar Gallinarum as the culture entered stationary phase but not in the ppGpp-defective mutant. It was suggested that ppGpp was required for the activation of ssrAB, which in turn allowed the expression of the SPI-2 genes necessary for the intracellular replication of serovar Gallinarum. Taken together, we concluded that serovar Gallinarum internalizes animal cells through a route independent of SPI-1 but dependent on ppGpp and that SPI-2-encoded proteins under ppGpp control are essential for intracellular replication.

View larger version (20K): [in this window] [in a new window]

FIG. 10. Internalization and intracellular replication of wild-type and mutant Salmonella serovar Gallinarum strains in various animal cells (A) RAW264.7 cells. (B) MPM. (C) CPM. (D) CEF. (E) HEp-2 cells. Bacteria were incubated with the animal cells for 30 min at an MOI of 10. After removing excess bacteria by washing, the cells were incubated in the presence of gentamicin (20 µg/ml) for the duration of experiment, and the intracellular bacteria were counted by the standard plating method. Open circles represent wild-type (SG3001), closed circles represent hilA (SG3004), open triangles represent ssrAB (SG3005), and closed triangles represent relA spoT (SG3003) strains of Salmonella serovar Gallinarum.

View larger version (13K): [in this window] [in a new window]

FIG. 11. ppGpp-dependent expression of SPI-2 genes. Shown are data for the expression of ssrABp::lacZ in wild-type (left) (SG3017) and relA spoT (right) (SG3018) strains of Salmonella serovar Gallinarum cultures grown under standard growth conditions. The curves with open circles represent growth (A600), and closed circles represent ssrABp activity as determined by the β-galactosidase assay (Miller units).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In this study, using a clinical strain of Salmonella serovar Gallinarum isolated from a chicken liver with typical fowl typhoid, we found that (i) serovar Gallinarum was capable of invading and replicating in animal cells within SCVs (Fig. 8); (ii) serovar Gallinarum at the exponential phase grown under low-oxygen conditions was most readily internalized (Fig. 6); (iii) SPI-1 was not required for internalization, although it was functionally expressed and excreted similarly as in serovar Typhimurium at the onset of stationary phase in a ppGpp-dependent manner (Fig. 3, 4, 7, and 10); (iv) an unidentified gene(s) under the control of ppGpp was involved in internalization (Fig. 9 and 10); and (v) SPI-2, also expressed at the onset of stationary phase in a ppGpp-dependent manner, was required for the intracellular replication of serovar Gallinarum (Fig. 10 and 11).

It should be noted that serovar Gallinarum internalized animal cells, even those extracted from Salmonella-susceptible White Leghorn chickens, at a rate about 10% of that of serovar Typhimurium (Fig. 5). But following entry, the intracellular serovar Gallinarum level increased by roughly 1,000- to 10,000-fold during a 24-h incubation (10³ to 10⁷), as estimated by the gentamicin protection assay (Fig. 10). It was previously reported that serovar Gallinarum is phagocytosed by macrophages of both avian and murine hosts at a rate of <10% of that of serovar Typhimurium (9, 49). The reduced level of invasion by serovar Gallinarum, especially in vitro, has been ascribed to its poor motility (4, 68) and the absence of mannose-sensitive hemagglutination type 1 fimbriae (70). Type 2 fimbriae expressed by serovar Gallinarum play no role in adherence and invasion of bacteria in animal cells (32). Based on the lack of evidence of membrane ruffling or macropinocytosis during serovar Gallinarum entry, as examined by transmission electron microscopy, it has been suggested that serovar Gallinarum is taken up by murine phagocytic cells by a mechanism different from that for serovar Typhimurium (49). It is, however, not the scope of this study to elucidate the difference between serovar Gallinarum and serovar Typhimurium for the invasion of animal cells. Nevertheless, we could localize serovar Gallinarum in LAMP1-positive vacuoles in both phagocytic (RAW264.7) and nonphagocytic (HEp2) cells (Fig. 8). Irrespective of the mechanism of invasion, the serovar Gallinarum employed in this study seems to be as capable as serovar Typhimurium in proliferating in SCVs.

We found that serovar Gallinarum carries all SPI loci found in serovar Typhimurium, as determined by analysis of the gene fragments in SPIs and partial DNA sequencing (hilA and ssrAB promoter regions) (Fig. 1 and 2). It was previously reported that all the SPI loci from different serovars are not significantly different enough to account for genomic changes that contribute to a serovar's degree of host adaptation (22, 44, 46, 48). In the case of serovar Gallinarum, no obvious alternation has been reported, especially in the SPI-1 region in serovar Gallinarum, as assessed by multilocus enzyme electrophoresis or whole-genome microarray. These methods, however, would not allow one to monitor the differences on a minor scale, like transcriptional changes due to point mutations, silencing of genes, and small deletions (10, 22, 44, 46, 48, 50, 71). Note that we could generate various deletion mutants of serovar Gallinarum based on serovar Typhimurium sequences by homologous recombination using the lambda Red system (19). In addition, some of the mutants (hilA and sipADCB) displayed the expected defects of the secreted protein profiles (Fig. 4). This suggests that there are no major genetic rearrangements between serovar Typhimurium and serovar Gallinarum, at least in these regions of the genome.

It was interesting that SPI-1 genes in serovar Gallinarum seemed to play no role in animal cell internalization, as examined using MPM, CPM, CEF, HEp-2, and RAW264.7 cells (Fig. 9 and 10). No obvious defect in the internalization of these cells was noted with serovar Gallinarum derivatives carrying mutations in hilA or invF, which are responsible for the coordinated expression of SPI-1 genes (15, 17, 18, 42) and in the sipADCB gene block, which encodes the proteins involved in effector translocation mediated by SPI-1-encoded TTSS (Fig. 4) (13). It was previously reported that the internalization frequency of serovar Typhimurium was severely impaired by the mutation in hilA, invF, or sipADCB genes (15, 16, 73). Taken together, it was perceived that the pathogenesis of fowl typhoid by serovar Gallinarum would be different from that of murine typhoid by serovar Typhimurium, as suggested previously (59, 60). It was previously shown that serovar Gallinarum preferentially invaded the cecal tonsil and Peyer's patch in chicken lacking peripheral or mesenteric lymph (5, 41). It is therefore possible that the uptake of serovar Gallinarum may not require SPI-1 genes even though these were clearly expressed (Fig. 3, 4, and 7). However, this interpretation would be inconsistent with a previous study that reported the role of the SPI-1 and SPI-2 TTSS on the virulence, uptake, distribution, and pathology of serovar Gallinarum infections in the chicken through experimental infections with functional knockout mutations in either the SPI-1 TTSS (spaS) or the SPI-2 TTSS (ssaU) (37). The SpaS^– mutant was found to be less invasive, as determined in vitro using primary chick kidney cells while fully persistent within chicken macrophage-like cells. In contrast, the SsaU^– mutant was fully invasive in chick kidney cells but failed to persist in macrophages. This discrepancy may also be due to differences in our clinical strain isolated from a South Korean broiler farm and the previously described strain SG9 (62). However, we also found with the inbred Salmonella-susceptible White Leghorn chicken that the SPI-1 mutant was fully virulent, while the SPI-2 mutant was not (data not shown).

In an attempt to identify the protein(s) involved in animal cell internalization, if any, we examined those genes known to play roles during early stages of Salmonella pathogenesis (28). Among many candidates identified from the literature, three gene blocks on pathogenicity islands were identified in serovar Gallinarum by PCR amplification using the primer sets specific to DNA sequences within their respective SPIs (data not shown). These include the sef operon in SPI-10, implicated in uptake and survival in macrophages (23); siiE in SPI-4, implicated in adhesion to eukaryotic cells (30); and the pilV gene block, implicated in type IV pilus-mediated intestinal cell attachment by Salmonella enterica serovar Typhi (72). However, none of these genes was found to be involved in the internalization of animal cells by serovar Gallinarum (Fig. 8). Instead, we observed that a ppGpp-defective serovar Gallinarum strain entered animal cells at 10% or less of the wild-type invasion frequency and did not persist within vacuoles as judged by bacterial survival and direct microscopic visualization (data not shown). A simple explanation is that ppGpp is required for the expression of the protein(s) involved in the internalization of animal cells by serovar Gallinarum. Under standard laboratory growth conditions, the transition from the exponential phase to the stationary phase presumably represents a stress condition that is sensed and translated to the intracellular signal ppGpp. Based on a microarray analysis of serovar Typhimurium gene expression, we found that roughly 7.1% of open reading frames were increased upon entry into the stationary phase (data not shown). Interestingly, most SPI genes, if not all, were induced at entry into the stationary phase. All this stationary-phase gene induction required ppGpp. Thus, the protein(s) responsible for the internalization of serovar Gallinarum might also be induced at the stationary phase in a ppGpp-dependent manner. Confirmation of this idea awaits the identification of the protein(s). Nevertheless, our findings suggest that virulence-associated genes are induced under the stress conditions that Salmonella encounters in the intestinal lumen and inside various host cells during the course of animal infection (43).

 
This work was supported by Korea Health 21 R&D (01-PJ10-PG6-01GM02-002), the Ministry of Health and Welfare, a Korea Science and Engineering Foundation grant funded by MOST (no. 2007-04213), On-Site Cooperative Agriculture Research Project (20070401080077), RDA, a CNU specialization grant funded by Chonnam National University, the Brain Korea 21 Project, Center for Biomedical Human Resources, and the Biotherapy Human Recourses Center at Chonnam National University, Republic of Korea, in 2007. J.H.R. was supported by a grant (no. RT105-01-01) from the Regional Technology Innovation Program of the MOCIE, Republic of Korea.

 
* Corresponding author. Mailing address: Department of Microbiology, Chonnam National University Medical College, Gwangju 501-746, South Korea. Phone: 82 62 220 4137. Fax: 82 62 228 7294. E-mail hyonchoy{at}chonnam.ac.kr

Published ahead of print on 11 July 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Amavisit, P., D. Lightfoot, G. F. Browning, and P. F. Markham. 2003. Variation between pathogenic serovars within Salmonella pathogenicity islands. J. Bacteriol. 185:3624-3635.[Abstract/Free Full Text]
2
2. Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol. 22:703-714.[CrossRef][Medline]
3
3. Barrow, P. A., M. B. Huggins, and M. A. Lovell. 1994. Host specificity of Salmonella infection in chickens and mice is expressed in vivo primarily at the level of the reticuloendothelial system. Infect. Immun. 62:4602-4610.[Abstract/Free Full Text]
4
4. Barrow, P. A., and M. A. Lovell. 1989. Invasion of Vero cells by Salmonella species. J. Med. Microbiol. 28:59-67.[Abstract/Free Full Text]
5
5. Barrow, P. A., M. A. Lovell, and B. A. D. Stocker. 2000. Protection against experimental fowl typhoid by parenteral administration of live SL5828, an aroA-serC (aromatic dependent) mutant of a wild-type Salmonella gallinarum strain made lysogenic for P22 sie. Avian Pathol. 29:423-431.[CrossRef][Medline]
6
6. Barrow, P. A., J. M. Simpson, M. A. Lovell, and M. M. Binns. 1987. Contribution of Salmonella gallinarum large plasmid toward virulence in fowl typhoid. Infect. Immun. 55:388-392.[Abstract/Free Full Text]
7
7. Cashel, M., D. R. Gentry, V. J. Hernandez, and D. Vinella. 1996. Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. ASM Press, Washington, DC.
8
8. Chadfield, M., and J. Olsen. 2001. Determination of the oxidative burst chemiluminescent response of avian and murine-derived macrophages versus corresponding cell lines in relation to stimulation with Salmonella serotypes. Vet. Immunol. Immunopathol. 80:289-308.[CrossRef][Medline]
9
9. Chadfield, M. S., D. J. Brown, S. Aabo, J. P. Christensen, and J. E. Olsen. 2003. Comparison of intestinal invasion and macrophage response of Salmonella Gallinarum and other host-adapted Salmonella enterica serovars in the avian host. Vet. Microbiol. 92:49-64.[CrossRef][Medline]
10
10. Chan, K., S. Baker, C. C. Kim, C. S. Detweiler, G. Dougan, and S. Falkow. 2003. Genomic comparison of Salmonella enterica serovars and Salmonella bongori by use of an S. enterica serovar Typhimurium DNA microarray. J. Bacteriol. 185:553-563.[Abstract/Free Full Text]
11
11. Chang, D. E., D. J. Smalley, and T. Conway. 2002. Gene expression profiling of Escherichia coli growth transitions: an expanded stringent response model. Mol. Microbiol. 45:289-306.[CrossRef][Medline]
12
12. Cirillo, D. M., R. H. Valdivia, D. M. Monack, and S. Falkow. 1998. Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol. Microbiol. 30:175-188.[CrossRef][Medline]
13
13. Collazo, C. M., and J. E. Galan. 1997. The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24:747-756.[CrossRef][Medline]
14
14. Collins, F. M., and P. B. Carter. 1978. Growth of salmonellae in orally infected germfree mice. Infect. Immun. 21:41-47.[Abstract/Free Full Text]
15
15. Darwin, K. H., and V. L. Miller. 1999. InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium. J. Bacteriol. 181:4949-4954.[Abstract/Free Full Text]
16
16. Darwin, K. H., and V. L. Miller. 1999. Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin. Microbiol. Rev. 12:405-428.[Abstract/Free Full Text]
17
17. Darwin, K. H., and V. L. Miller. 2000. The putative invasion protein chaperone SicA acts together with InvF to activate the expression of Salmonella typhimurium virulence genes. Mol. Microbiol. 35:949-960.[CrossRef][Medline]
18
18. Darwin, K. H., and V. L. Miller. 2001. Type III secretion chaperone-dependent regulation: activation of virulence genes by SicA and InvF in Salmonella typhimurium. EMBO J. 20:1850-1862.[CrossRef][Medline]
19
19. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
20
20. Deiwick, J., T. Nikolaus, S. Erdogan, and M. Hensel. 1999. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol. Microbiol. 31:1759-1773.[CrossRef][Medline]
21
21. Desjardins, M., L. A. Huber, R. G. Parton, and G. Griffiths. 1994. Biogenesis of phagolysosomes proceeds through a sequential series of interactions with the endocytic apparatus. J. Cell Biol. 124:677-688.[Abstract/Free Full Text]
22
22. Edwards, R. A., G. J. Olsen, and S. R. Maloy. 2002. Comparative genomics of closely related salmonellae. Trends Microbiol. 10:94-99.[CrossRef][Medline]
23
23. Edwards, R. A., D. M. Schifferli, and S. R. Maloy. 2000. A role for Salmonella fimbriae in intraperitoneal infections. Proc. Natl. Acad. Sci. USA 97:1258-1262.[Abstract/Free Full Text]
24
24. Elliott, T. 1992. A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon. J. Bacteriol. 174:245-253.[Abstract/Free Full Text]
25
25. Ernst, R. K., D. M. Dombroski, and J. M. Merrick. 1990. Anaerobiosis, type 1 fimbriae, and growth phase are factors that affect invasion of HEp-2 cells by Salmonella typhimurium. Infect. Immun. 58:2014-2016.[Abstract/Free Full Text]
26
26. Galan, J. E. 2001. Salmonella interactions with host cells: type III secretion at work. Annu. Rev. Cell Dev. Biol. 17:53-86.[CrossRef][Medline]
27
27. Garcia-del Portillo, F., and B. B. Finlay. 1995. Targeting of Salmonella typhimurium to vesicles containing lysosomal membrane glycoproteins bypasses compartments with mannose 6-phosphate receptors. J. Cell Biol. 129:81-97.[Abstract/Free Full Text]
28
28. Gerlach, R. G., and M. Hensel. 2007. Protein secretion systems and adhesins: the molecular armory of gram-negative pathogens. Int. J. Med. Microbiol. 297:401-415.[CrossRef][Medline]
29
29. Gerlach, R. G., and M. Hensel. 2007. Salmonella pathogenicity islands in host specificity, host pathogen-interactions and antibiotics resistance of Salmonella enterica. Berl. Munch. Tierarztl. Wochenschr. 120:317-327.[Medline]
30
30. Gerlach, R. G., D. Jackel, B. Stecher, C. Wagner, A. Lupas, W. D. Hardt, and M. Hensel. 2007. Salmonella pathogenicity island 4 encodes a giant non-fimbrial adhesin and the cognate type 1 secretion system. Cell. Microbiol. 9:1834-1850.[CrossRef][Medline]
31
31. Guiney, D. G., F. C. Fang, M. Krause, S. Libby, N. A. Buchmeier, and J. Fierer. 1995. Biology and clinical significance of virulence plasmids in Salmonella serovars. Clin. Infect. Dis. 21(Suppl. 2):S146-S151.[Medline]
32
32. Hancox, L. S., K. S. Yeh, and S. Clegg. 1997. Construction and characterization of type 1 non-fimbriate and non-adhesive mutants of Salmonella typhimurium. FEMS Immunol. Med. Microbiol. 19:289-296.[CrossRef][Medline]
33
33. Hensel, M. 2000. Salmonella pathogenicity island 2. Mol. Microbiol. 36:1015-1023.[CrossRef][Medline]
34
34. Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. Vazquez-Torres, C. Gleeson, F. C. Fang, and D. W. Holden. 1998. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol. Microbiol. 30:163-174.[CrossRef][Medline]
35
35. Hong, K. H., and V. L. Miller. 1998. Identification of a novel Salmonella invasion locus homologous to Shigella ipgDE. J. Bacteriol. 180:1793-1802.[Abstract/Free Full Text]
36
36. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433.[Abstract/Free Full Text]
37
37. Jones, M. A., P. Wigley, K. L. Page, S. D. Hulme, and P. A. Barrow. 2001. Salmonella enterica serovar Gallinarum requires the Salmonella pathogenicity island 2 type III secretion system but not the Salmonella pathogenicity island 1 type III secretion system for virulence in chickens. Infect. Immun. 69:5471-5476.[Abstract/Free Full Text]
38
38. Kim, H. J., E. Y. Kim, Y. Hong, J. H. Rhee, and H. E. Choy. 2006. Alternative methods to limit extracellular bacterial activity for enumeration of intracellular bacteria. J. Microbiol. Methods 64:17-26.[CrossRef][Medline]
39
39. Lee, C. A., and S. Falkow. 1990. The ability of Salmonella to enter mammalian cells is affected by bacterial growth state. Proc. Natl. Acad. Sci. USA 87:4304-4308.[Abstract/Free Full Text]
40
40. Lee, C. A., B. D. Jones, and S. Falkow. 1992. Identification of a Salmonella typhimurium invasion locus by selection for hyperinvasive mutants. Proc. Natl. Acad. Sci. USA 89:1847-1851.[Abstract/Free Full Text]
41
41. Lowry, V. K., G. I. Tellez, D. J. Nisbet, G. Garcia, O. Urquiza, L. H. Stanker, and M. H. Kogut. 1999. Efficacy of Salmonella enteritidis-immune lymphokines on horizontal transmission of S. arizonae in turkeys and S. gallinarum in chickens. Int. J. Food Microbiol. 48:139-148.[CrossRef][Medline]
42
42. Lucas, R. L., and C. A. Lee. 2000. Unravelling the mysteries of virulence gene regulation in Salmonella typhimurium. Mol. Microbiol. 36:1024-1033.[CrossRef][Medline]
43
43. Marcus, S. L., J. H. Brumell, C. G. Pfeifer, and B. B. Finlay. 2000. Salmonella pathogenicity islands: big virulence in small packages. Microbes Infect. 2:145-156.[CrossRef][Medline]
44
44. McClelland, M., L. Florea, K. Sanderson, S. W. Clifton, J. Parkhill, C. Churcher, G. Dougan, R. K. Wilson, and W. Miller. 2000. Comparison of the Escherichia coli K-12 genome with sampled genomes of a Klebsiella pneumoniae and three Salmonella enterica serovars, Typhimurium, Typhi and Paratyphi. Nucleic Acids Res. 28:4974-4986.[Abstract/Free Full Text]
45
45. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
46
46. Mirold, S., K. Ehrbar, A. Weissmuller, R. Prager, H. Tschape, H. Russmann, and W. D. Hardt. 2001. Salmonella host cell invasion emerged by acquisition of a mosaic of separate genetic elements, including Salmonella pathogenicity island 1 (SPI1), SPI5, and sopE2. J. Bacteriol. 183:2348-2358.[Abstract/Free Full Text]
47
47. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. Identification of a pathogenicity island required for Salmonella survival in host cells. Proc. Natl. Acad. Sci. USA 93:7800-7804.[Abstract/Free Full Text]
48
48. Parkhill, J., G. Dougan, K. D. James, N. R. Thomson, D. Pickard, J. Wain, C. Churcher, K. L. Mungall, S. D. Bentley, M. T. Holden, M. Sebaihia, S. Baker, D. Basham, K. Brooks, T. Chillingworth, P. Connerton, A. Cronin, P. Davis, R. M. Davies, L. Dowd, N. White, J. Farrar, T. Feltwell, N. Hamlin, A. Haque, T. T. Hien, S. Holroyd, K. Jagels, A. Krogh, T. S. Larsen, S. Leather, S. Moule, P. O'Gaora, C. Parry, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-852.[CrossRef][Medline]
49
49. Pascopella, L., B. Raupach, N. Ghori, D. Monack, S. Falkow, and P. L. Small. 1995. Host restriction phenotypes of Salmonella typhi and Salmonella gallinarum. Infect. Immun. 63:4329-4335.[Abstract]
50
50. Porwollik, S., C. A. Santiviago, P. Cheng, L. Florea, and M. McClelland. 2005. Differences in gene content between Salmonella enterica serovar Enteritidis isolates and comparison to closely related serovars Gallinarum and Dublin. J. Bacteriol. 187:6545-6555.[Abstract/Free Full Text]
51
51. Putnam, S. L., and A. L. Koch. 1975. Complications in the simplest cellular enzyme assay: lysis of Escherichia coli for the assay of beta-galactosidase. Anal. Biochem. 63:350-360.[CrossRef][Medline]
52
52. Rathman, M., L. P. Barker, and S. Falkow. 1997. The unique trafficking pattern of Salmonella typhimurium-containing phagosomes in murine macrophages is independent of the mechanism of bacterial entry. Infect. Immun. 65:1475-1485.[Abstract]
53
53. Runnells, R. A., C. J. Coon, H. Farley, and F. Thorp. 1927. An application of the rapid-method agglutination test to the diagnosis of bacillary white diarrhoea infection. J. Am. Vet. Med. Assoc. 70:660-662.
54
54. Sands, M. K., and R. B. Roberts. 1952. The effects of a tryptophan-histidine deficiency in a mutant of Escherichia coli. J. Bacteriol. 63:505-511.[Free Full Text]
55
55. Scott, C. C., P. Cuellar-Mata, T. Matsuo, H. W. Davidson, and S. Grinstein. 2002. Role of 3-phosphoinositides in the maturation of Salmonella-containing vacuoles within host cells. J. Biol. Chem. 277:12770-12776.[Abstract/Free Full Text]
56
56. Shah, D. H., M. J. Lee, J. H. Park, J. H. Lee, S. K. Eo, J. T. Kwon, and J. S. Chae. 2005. Identification of Salmonella gallinarum virulence genes in a chicken infection model using PCR-based signature-tagged mutagenesis. Microbiology 151:3957-3968.[Abstract/Free Full Text]
57
57. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden. 1996. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 93:2593-2597.[Abstract/Free Full Text]
58
58. Shin, D., S. Lim, Y. J. Seok, and S. Ryu. 2001. Heat shock RNA polymerase (E sigma(32)) is involved in the transcription of mlc and crucial for induction of the Mlc regulon by glucose in Escherichia coli. J. Biol. Chem. 276:25871-25875.[Abstract/Free Full Text]
59
59. Shivaprasad, H. L. 1997. Diseases of poultry, p. 82-96. In B. W. Calnek (ed.), Pullorum disease and fowl typhoid, 10th ed. Iowa State University Press, Ames, IA.
60
60. Shivaprasad, H. L. 2000. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 19:405-424.[Medline]
61
61. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96.[CrossRef][Medline]
62
62. Smith, H. W. 1956. The use of live vaccines in experimental Salmonella gallinarum infection in chickens with observations on their interference effect. J. Hyg. (London) 54:419-432.[Medline]
63
63. Song, M., H. J. Kim, E. Y. Kim, M. Shin, H. C. Lee, Y. Hong, J. H. Rhee, H. Yoon, S. Ryu, S. Lim, and H. E. Choy. 2004. ppGpp-dependent stationary phase induction of genes on Salmonella pathogenicity island 1. J. Biol. Chem. 279:34183-34190.[Abstract/Free Full Text]
64
64. Steele-Mortimer, O., S. Meresse, J. P. Gorvel, B. H. Toh, and B. B. Finlay. 1999. Biogenesis of Salmonella typhimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathway. Cell. Microbiol. 1:33-49.[Medline]
65
65. Stent, G. S., and S. Brenner. 1961. A genetic locus for the regulation of ribonucleic acid synthesis. Proc. Natl. Acad. Sci. USA 47:2005-2014.[Free Full Text]
66
66. Thompson, A., M. D. Rolfe, S. Lucchini, P. Schwerk, J. C. Hinton, and K. Tedin. 2006. The bacterial signal molecule, ppGpp, mediates the environmental regulation of both the invasion and intracellular virulence gene programs of Salmonella. J. Biol. Chem. 281:30112-30121.[Abstract/Free Full Text]
67
67. Wallis, T. S., M. Wood, P. Watson, S. Paulin, M. Jones, and E. Galyov. 1999. Sips, Sops, and SPIs but not stn influence Salmonella enteropathogenesis. Adv. Exp. Med. Biol. 473:275-280.[Medline]
68
68. Wigley, P., S. Hulme, L. Rothwell, N. Bumstead, P. Kaiser, and P. Barrow. 2006. Macrophages isolated from chickens genetically resistant or susceptible to systemic salmonellosis show magnitudinal and temporal differential expression of cytokines and chemokines following Salmonella enterica challenge. Infect. Immun. 74:1425-1430.[Abstract/Free Full Text]
69
69. Wigley, P., S. D. Hulme, N. Bumstead, and P. A. Barrow. 2002. In vivo and in vitro studies of genetic resistance to systemic salmonellosis in the chicken encoded by the SAL1 locus. Microbes Infect. 4:1111-1120.[CrossRef][Medline]
70
70. Wilson, R. L., J. Elthon, S. Clegg, and B. D. Jones. 2000. Salmonella enterica serovars Gallinarum and Pullorum expressing Salmonella enterica serovar Typhimurium type 1 fimbriae exhibit increased invasiveness for mammalian cells. Infect. Immun. 68:4782-4785.[Abstract/Free Full Text]
71
71. Wu, K. Y., G. R. Liu, W. Q. Liu, A. Q. Wang, S. Zhan, K. E. Sanderson, R. N. Johnston, and S. L. Liu. 2005. The genome of Salmonella enterica serovar Gallinarum: distinct insertions/deletions and rare rearrangements. J. Bacteriol. 187:4720-4727.[Abstract/Free Full Text]
72
72. Zhang, X. L., I. S. Tsui, C. M. Yip, A. W. Fung, D. K. Wong, X. Dai, Y. Yang, J. Hackett, and C. Morris. 2000. Salmonella enterica serovar Typhi uses type IVB pili to enter human intestinal epithelial cells. Infect. Immun. 68:3067-3073.[Abstract/Free Full Text]
73
73. Zhou, D., M. S. Mooseker, and J. E. Galan. 1999. Role of the S. typhimurium actin-binding protein SipA in bacterial internalization. Science 283:2092-2095.[Abstract/Free Full Text]

---

Journal of Bacteriology, October 2008, p. 6340-6350, Vol. 190, No. 19
0021-9193/08/$08.00+0     doi:10.1128/JB.00385-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Abranches, J., Martinez, A. R., Kajfasz, J. K., Chavez, V., Garsin, D. A., Lemos, J. A. (2009). The Molecular Alarmone (p)ppGpp Mediates Stress Responses, Vancomycin Tolerance, and Virulence in Enterococcus faecalis. J. Bacteriol. 191: 2248-2256 [Abstract] [Full Text]  
• Zhao, G., Weatherspoon, N., Kong, W., Curtiss, R. III, Shi, Y. (2008). A dual-signal regulatory circuit activates transcription of a set of divergent operons in Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 105: 20924-20929 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jeong, J.-H. Articles by Choy, H. E. Search for Related Content PubMed PubMed Citation Articles by Jeong, J.-H. Articles by Choy, H. E.