Previous Article | Next Article ![]()
Journal of Bacteriology, November 2008, p. 7532-7547, Vol. 190, No. 22
0021-9193/08/$08.00+0 doi:10.1128/JB.01002-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Kathrin Riedel,2
Leo Eberl,2
Carmen Buchrieser,3 and
Hubert Hilbi1*
Institute of Microbiology, ETH Zürich, Wolfgang-Pauli-Strasse 10, 8093 Zürich, Switzerland,1 Institute of Plant Biology, University of Zürich, Zollikerstr. 10, 8008 Zürich, Switzerland,2 Unité de Biologie des Bactéries Intracellulaires and CNRS URA 2171, Institut Pasteur, 28 Rue du Dr Roux, 75724 Paris, France3
Received 20 July 2008/ Accepted 9 September 2008
|
|
|---|
|
|
|---|
L. pneumophila establishes its intracellular niche in host cells by forming Legionella-containing vacuoles (LCVs), wherein the bacteria are not degraded but rather replicate. To this end, LCVs avoid the endosomal pathway by inhibiting phagosome-lysosome fusion and instead recruit early secretory vesicles and the endoplasmic reticulum (66). A key bacterial factor involved in efficient uptake and formation of LCVs is the Icm/Dot type IV secretion system (T4SS) (31, 63, 71). The Icm/Dot T4SS is a DNA conjugation system that also translocates bacterial effector proteins into the host cell (62). To date, more than 50 Icm/Dot-secreted proteins have been identified as putative effectors, many of which form families of paralogues (53). Some of these effectors interfere with host cell trafficking by modulating GTPase activity or phosphoinositide metabolism (8, 30, 53).
The life-style of a facultative intracellular bacterium is characterized by the exposure to intracellular as well as extracellular environments. To accommodate these changes, L. pneumophila adopts a biphasic life cycle that is characterized by the transition from a replicative phase to a transmissive (virulent) phase (46). This transition is mirrored by distinct gene expression patterns (9). Upon entry of L. pneumophila into the stationary growth phase, virulence genes required for transmission and infection of host cells are preferentially expressed. These genes are repressed in the replicative phase, during which components of aerobic metabolism as well as amino acid and carbohydrate catabolism are upregulated. The global shift in gene expression is governed by a complex regulatory network, including the alternative sigma factors RpoS (
S/
38) (4, 27) and FliA (
28) (28, 45), as well as conserved RNA binding proteins, such as Hfq (40) and CsrA (RsmA). The latter is a global repressor of transmission traits and an essential activator of intracellular replication (19, 21, 47).
Two-component systems such as LetA/LetS, CpxR/CpxA, PmrA/PmrS, and the response regulator LqsR have also been implicated in the regulation of transmissive traits of L. pneumophila. LetA/LetS activates transmissive traits upon entering the stationary growth phase through a relief of repression induced by CsrA (19, 21, 47), whereas CpxR and PmrA promote the expression of several Icm/Dot components and translocated substrates, respectively (3, 23, 75). Recently, we characterized the putative response regulator LqsR as a novel element of the virulence regulatory network controlled by RpoS and LetA (70). LqsR was found to promote pathogen-host cell interactions, such as phagocytosis, formation of the LCV, intracellular replication, and cytotoxicity, while delaying the entry of L. pneumophila into the replicative growth phase. DNA microarray analysis demonstrated that lqsR regulates the expression of genes involved in virulence, motility, and cell division.
In Vibrio spp. or Pseudomonas spp., endogenously produced and secreted small molecules termed autoinducers regulate virulence (7, 10, 22). The minimum set of these quorum sensing systems comprises an autoinducer synthase, which produces the autoinducer signal, and a cytoplasmic transcription factor that modulates gene expression upon binding of the signaling molecule. More-complex quorum sensing networks include two-component systems and phosphorelay systems, which detect, transmit, and integrate multiple signals (29). The L. pneumophila virulence-associated response regulator lqsR is located within the lqs (Legionella quorum sensing) cluster (lqsA-lqsR-hdeD-lqsS), which includes genes encoding the autoinducer synthase LqsA, the sensor kinase LqsS, and the putative membrane protein HdeD. In Escherichia coli, the hdeD gene is localized on an acid fitness island and involved in acid resistance (38, 39). LqsA was recently characterized as a pyridoxal 5'-phosphate-dependent enzyme producing the diffusible signaling molecule 3-hydroxy-pentadecan-4-one (68). The clustering and orientation of the lqsA-lqsR-lqsS genes are conserved among different bacterial species (70), suggesting a functional relationship among the individual genes. LqsA and LqsS are homologues of the CqsAS quorum sensing components identified in Vibrio cholerae and other marine Vibrio spp., which contribute to regulation of type III secretion, metalloprotease production, virulence, and bioluminescence (29, 41).
Here, we demonstrate that L. pneumophila lacking all four genes of the lqs cluster is more severely defective for a number of transmissive traits than an lqsR single mutant strain, and transcriptome as well as proteome data indicate that a set of Icm/Dot-secreted effector proteins is not produced in the absence of the lqs gene cluster. Thus, the lqs genes synergistically participate in pathways controlled by lqsR.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used in this study
|
![]() View larger version (53K): [in a new window] |
FIG. 1. The L. pneumophila lqs cluster and model of the Lqs quorum sensing circuit. (A) The lqs (Legionella quorum sensing) cluster consists of four ORFs, designated lqsA (lpg2731), lqsR (lpg2732), hdeD (lpg2733), and lqsS (lpg2734). The 5' flanking region contains two ORFs, lpg2730 (dsbB) and lpg2731 (cycB), encoding electron transfer proteins. An operon including ORFs lpg2735 to lpg2738 (hemC, hemD, hemX, and hemY), involved in heme biosynthesis, is located in the 3' flanking region. (B) Model of the Lqs quorum sensing circuit. (C) The two AflIII restriction sites in the lqs locus delineate the cloned genomic lqs fragment (6,790 bp), and the BsgI and BbvCI restriction sites were used to replace a 4,482-bp lqs fragment with a Km resistance cassette to construct the suicide vector for allelic exchange. Arrows indicate the oligonucleotide binding sites used for PCR screening of the genomic regions of the wild type (5,118 bp), the lqs deletion mutant (1,907 bp), and three lqs chromosomal complementation strains (CC-1, CC-9, and CC-17) (D).
|
hdeD strain (NT04), the chromosomal hdeD gene was deleted as follows: pNT-1 was digested with SwaI and Mph1130I, releasing a 70-bp fragment of the hdeD ORF. The resulting backbone, including a 5' upstream (HH1) and a 3' downstream (HH2) region, were blunted using a 3'-to-5' exonuclease (Mph1103I site) and subsequently dephosphorylated using shrimp alkaline phosphatase. The Km resistance cassette was released from plasmid pUC4K with BamHI, blunted (Klenow polymerase), phosphorylated (T4 polynucleotide kinase), and inserted into the blunted hdeD fragment to create pNT-5. The HH1-Kmr-HH2 fragment was then isolated with MluI, blunted, and cloned into the pLAW344 suicide vector cut with BamHI and blunted, resulting in pNT-10. Clones were analyzed by PCR, using oHdeD-fo (CCGCGTCCATATGGCTAATTCACAAG) and oHdeD-re (TATTGGATCCCTAGAGTTTGGCCGTTTTTAC) as primers.
Allelic exchange by double homologous recombination using counterselection on sucrose was performed essentially as described previously (70, 73). L. pneumophila JR32 was transformed by electroporation (Bio-Rad Gene Pulser; 2.3 kV, 100
, 25 mF) with pNT-7 or pNT-10, and cointegration of the plasmid was assayed by selection on CYE-Km (5 to 7 days, 30°C). Several clones thus obtained were pooled, grown overnight in AYE medium, and streaked on CYE-Km containing 2% sucrose (3 days, 30°C). Single colonies were spotted on CYE-Cmr, CYE-Kmr-2% sucrose, and CYE-Kmr plates to screen for Cms Kmr Sucr colonies. Candidate deletion mutant clones were screened by PCR using the primers indicated above and by Southern blot analysis using a digitonin DNA labeling and detection kit (Roche). As an additional control, the letA and letS genes were sequenced with the lqs mutant strain and confirmed to have wild-type sequences.
To complement the
lqs mutant strain NT01, the lqs region was reintroduced into the mutant in trans or in cis. For trans-complementation, the plasmid pNT-1 was digested with XmaI and XbaI to release a 6,839-bp fragment harboring the native lqs region as well as the 5' and 3' flanking regions used for the construction of the lqs deletion strain. The fragment was cloned into pMMB207C (12), yielding plasmid pTS-1. Complementation in cis was performed by chromosomal reintegration of the native lqs region into the lqs deletion strain. The native lqs region, including the 5' and 3' flanking sequences, was released from pNT-1 with BamHI and cloned into pLAW344. The resulting suicide plasmid, pNT-25, was electroporated into the
lqs mutant strain, and cointegration of the plasmid was selected by growth on CYE-chloramphenicol (Cm) plates (3 days, 30°C). Single colonies were spotted on CYE-Cm, CYE-2% sucrose, and CYE-Km plates to screen for Cms Kms Sucr strains that replaced the Km resistance cassette with the native lqs region. The resulting chromosomal complementation (CC) strains were checked by PCR for the presence of the native lqs sequence and the absence of the Kmr cassette (Fig. 1D).
β-Galactosidase assay. To measure the activity of the lqsR promoter in the wild-type L. pneumophila and lqs mutant strains, plasmid pTS-14 was used (70), harboring a transcriptional fusion of the 5' upstream/promoter region of lqsR with the lacZ gene. Specific enzyme activity was measured in Miller units, quantifying the conversion of ortho-nitrophenyl-β-D-galactopyranoside (ONPG) into galactose and o-nitrophenol (in units of optical density at 420 nm [OD420]). Bacterial cultures containing the plasmid pTS-14 were inoculated in AYE medium (OD600 = 0.02) and grown at 37°C. At the time points indicated, the cells were harvested, suspended in 1 ml Z buffer, and lysed with 0.1% sodium dodecyl sulfate (SDS)-chloroform, and β-mercaptoethanol was added. The suspension was vortexed and reheated (28°C, 2 min), and ONPG was added for several minutes at 28°C until the suspension turned yellow. The reaction was stopped by the addition of Na2CO3, the cells were shortly spun down, and the absorbance in the supernatant was measured.
Analysis of the phagocytosis, intracellular replication, and cytotoxicity of L. pneumophila. The phagocytosis, intracellular replication, and cytotoxicity of L. pneumophila were analyzed by fluorescence-activated cell sorting as described previously, using green fluorescent protein (GFP)-labeled bacteria and A. castellanii or D. discoideum as host cells (70, 72). Briefly, exponentially growing amoebae were seeded onto a 24-well plate (2.5 x 105 A. castellanii bacteria/ml or 5 x 105 D. discoideum bacteria/ml), allowed to adhere for 1 to 2 h, infected with L. pneumophila bacteria grown for 21 h in AYE medium, and incubated at 30°C (A. castellanii) or 25°C (D. discoideum). To assay phagocytosis, the amoebae were infected (multiplicity of infection [MOI] = 50) with L. pneumophila diluted in PYG (A. castellanii) or HL5 (D. discoideum) medium and at 1 h postinfection were washed three times with Ac (A. castellanii) or SorC (D. discoideum) buffer. To assay intracellular replication, the amoebae were infected (MOI = 10) with L. pneumophila diluted in Ac buffer (A. castellanii) or MB medium (D. discoideum). To assay cytotoxicity, L. pneumophila was grown for 30 h in AYE medium at 30°C, diluted in PYG medium, and used to infect the amoebae (MOI = 100) at 30°C. Cytotoxicity was assessed at 24 h postinfection by adding propidium iodide (PI; 1 µg/ml) to A. castellanii (1, 2, 70). The viability of L. pneumophila (as determined by CFU counts) and expression of GFP (typically 80 to 90%) were routinely controlled.
Intracellular replication of L. pneumophila in A. castellanii was also quantified by determining the number of CFU in the supernatant. Briefly, 5 x 104 exponentially growing A. castellanii bacteria/well were seeded onto a 96-well plate, allowed to adhere for 1 to 2 h, and infected at an MOI of 1 with L. pneumophila grown for 21 h in AYE medium. The infected amoebae were incubated at 30°C, and at the time points indicated, the number of bacteria released into the supernatant was quantified by plating aliquots of appropriate dilutions on CYE plates.
The cytotoxicity of L. pneumophila was also assayed using a dye reduction assay (12). The reduction of Alamar Blueox (resazurin; Lucerna Chem) to Alamar Bluered (resorufin;
ex = 530 nm,
em = 590 nm) by A. castellanii or RAW264.7 macrophages is proportional to the number of respiring cells over 2 orders of magnitude (data not shown). Exponentially growing A. castellanii or RAW264.7 macrophages were suspended in PYG or RPMI medium and seeded onto a 96-well plate (1 x 105 cells/200 µl). L. pneumophila was grown for 21 h in AYE medium and diluted in PYG or RPMI medium, and 25 µl was used to infect the host cells at an MOI of 100, 10, or 1. Prior to the infection, the host cells were washed once, and the medium was exchanged for 200 µl Ac buffer (A. castellanii) or RPMI (RAW264.7). The infection was synchronized by centrifugation (10 min, 880 x g), and the infected cells were incubated at 30°C (A. castellanii) or 37°C (RAW264.7). At 3 h postinfection, the infected cells were carefully washed three times with Ac buffer (A. castellanii) or RPMI (RAW264.7) to remove extracellular bacteria. Two hundred microliters of PYG or RPMI medium containing 10% Alamar Blueox was added and incubated for 16 h at 30°C (A. castellanii) or 37°C (RAW264.7). As a control, uninfected host cells were treated equally. Fluorescence was measured with a Victor3 plate reader (Perkin Elmer).
Confocal and transmission electron microscopy. GFP-expressing L. pneumophila strains were grown in AYE medium at 37°C for 8 h (exponential phase), 21 h (early stationary phase), or 30 h (late stationary phase), harvested, resuspended in 1 ml 1x phosphate-buffered saline, and diluted to an OD600 of 0.15. Aliquots of the fluorescent bacteria were centrifuged on poly-L-lysine-coated coverslips, fixed with 4% paraformaldehyde, and viewed with an inverted confocal microscope (Axiovert 200 M; Zeiss) equipped with an Ultraview LCI confocal spinning disk head (PerkinElmer) and a 63x phase contrast objective (70, 72).
For transmission electron micrographs, the L. pneumophila strains were grown at 37°C for 30 h (stationary phase) in AYE medium. Subsequently, the bacteria were washed with water and finally diluted 1:10 in water. Ten microliters of the suspension was directly applied to plasma-treated 400-mesh copper grids. After sedimentation of the bacteria and removal of the remaining fluid, the samples were stained with 2% uranyl acetate and examined with a transmission electron microscope (CM 12; Philips) at 100 kV.
DNA microarray analysis. L. pneumophila wild-type JR32 and the lqs mutant strain NT01 were grown in AYE medium at 37°C and harvested for RNA isolation at the exponential (OD600 = 1.5) or stationary (OD600 = 3.0) growth phase. RNA was reverse transcribed and indirectly labeled with Cy5 or Cy3 dye (Amersham Biosciences). A DNA microarray containing gene-specific 70-mer oligonucleotides based on all predicted genes of the genomes of L. pneumophila strains Paris, Lens, and Philadelphia was used, and hybridizations were performed as described previously (9, 70, 72). As controls, biological replicates as well as dye swap experiments were carried out. For normalization and differential analysis, the R software program (http://www.r-project.org/) was used. Loess normalization (74) was performed on a slide-by-slide basis, and differential analysis was carried out separately for each comparison, using the VM method (VarMixt package) (17), together with the Benjamini and Yekutieli P value adjustment method (57).
Proteome analysis by 2-DE coupled with matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS)-based sequencing. To prepare samples, L. pneumophila wild-type strain JR32 and the lqs mutant strain NT01 were grown in AYE medium at 37°C to an OD600 of 1.5 or 3.0 (exponential or stationary growth phase, respectively). The bacteria were harvested by centrifugation (3,300 x g, 4°C, 20 min), frozen in liquid nitrogen, and stored at –80°C. To isolate proteins, the bacteria were thawed on ice, washed twice in 50 mM Tris-HCl, pH 7.5, and resuspended in the same buffer supplemented with one tablet of protease inhibitor (complete EDTA-free protease inhibitor cocktail; Roche). The bacteria were lysed by sonication, the debris were removed by centrifugation (21,000 x g, 4°C, 60 min), and the lysate was extracted with phenol as described previously (58). The precipitate was pulverized and solubilized in rehydration buffer (8 M urea, 2% {wt/vol} CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}, 15 mM dithiothreitol, and 0.2% immobilized pH gradient {IPG} buffer, pH 3 to 10; GE Healthcare). Protein concentrations were calculated according to the Bradford method, using bovine serum albumin as a standard, and prior to two-dimensional gel electrophoresis (2-DE), the protein samples were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE).
For isoelectric focusing, the samples were diluted with rehydration buffer to 800 µg protein in 450 µl. Immobiline DryStrips (IPG strips, 24 cm, pH 3 to 10 NL; GE Healthcare) were rehydrated and focused under mineral oil at 20°C using a gradient up to 64,000 V (30 V, 13 h; 200 V, 1.5 h; 500 V, 1.5 h, gradient to 1,000 V, 1.5 h; and gradient to 8,000 V, 6.5 h). Subsequently, the strips were equilibrated for 15 min in buffer I (6 M urea, 30% glycerol, 2% [wt/vol] SDS, and 1% [wt/vol] dithiothreitol in 50 mM Tris-HCl, pH 8.8), followed by a 15-min incubation in buffer II (6 M urea, 30% glycerol, 2% [wt/vol] SDS, and 4% [wt/vol] iodacetamide in 50 mM Tris-HCl, pH 8.8).
For SDS-PAGE, the strips were transferred to 25- by 20-cm gels. The gels were run at room temperature for 1 h at 50 mA, followed by approximately 5 h at 80 W. Subsequently, the gels were incubated for 45 min in fixing solution (45% ethanol, 10% acetic acid) before the proteins were stained with Coomassie brilliant blue G-250 as described previously (51). After the proteins were destained in water, the gels were scanned with a densitometric ImageScanner (GE Healthcare), and the raw images were analyzed with Proteomeweaver 2-D gel analysis software, version 3.1 (Bio-Rad). Gels from two independent samples were run and analyzed, and only significant (>2-fold) changes in spot intensity were considered.
To identify proteins by MALDI-TOF MS, spots of differentially expressed proteins were excised from the gels, subjected to in-gel trypsin digestion, destained at 37°C for 30 min in a 1:1 mixture of (NH4)HCO3 (5 mM, pH 7.8) and methanol, and dried by vacuum centrifugation. The dried spots were rehydrated for 10 min in 10 µl trypsin solution (10 ng/µl in 5 mM Tris-HCl, pH 8.4; sequencing grade; Promega), and after addition of another 20 µl 5 mM Tris-HCl, pH 8.4, the gel slices were incubated for 3 h at 37°C. Aliquots of 0.7 µl of the peptide samples were mixed with 2.1 µl matrix solution (0.5%
-cyano-4-hydroxycinnamic acid in 70% acetonitrile, 30% trifluoroacetic acid [0.1% wt/vol]), and 0.7 µl was immediately spotted on a MALDI plate and air dried before analysis. Samples were analyzed using a MALDI-tandem TOF system (model 4700 Proteomics Analyzer; Applied Biosystems) with an Nd:YAG laser operating at 200 Hz, as described previously (59). To identify proteins, the MS and tandem MS data were searched against the available L. pneumophila genomes (11, 13, 24) by using MASCOT version 1.9.05 (Matrix Science) as the search engine (55) and GPS Explorer software (Applied Biosystems) for database submission of data acquired by MS. The following settings were applied: maximum numbers of missed cleavage, 1; peptide tolerance, 35 ppm; and tandem MS tolerance, 0.2 kDa. Oxidation of methionine was set as a variable modification. Carboxyamidomethylation of cysteine was selected as a fixed modification. Confidence interval scores of >95% were accepted for protein identifications.
|
|
|---|
Effects of the L. pneumophila lqs genes on growth in broth and morphology. To analyze the function of the L. pneumophila lqs cluster, the corresponding genomic region, including lqsA, lqsR, hdeD, and lqsS, was deleted from the chromosome by double homologous recombination, yielding strain NT01 (Fig. 1). The growth rate of the lqs deletion mutant in AYE medium at 30°C or 37°C was very similar to that of wild-type L. pneumophila (Fig. 2A). However, while at 37°C the lqs mutant entered the replicative phase slightly later than wild-type L. pneumophila, at 30°C the mutant entered the replicative phase earlier. The latter phenotype was previously observed for an lqsR mutant strain, suggesting that LqsR plays an inhibitory role in the transmission from the transmissive to the replicative growth phase of L. pneumophila (70).
![]() View larger version (46K): [in a new window] |
FIG. 2. Effects of the L. pneumophila lqs genes on growth in broth and morphology. (A) L. pneumophila wild-type strain JR32 (, ) or lqs mutant strains ( , ) were inoculated at an OD600 of 0.1, and the growth of the strains in AYE medium was followed for 21 h at 37°C (gray line) or 28 h at 30°C (black line). Similar results were obtained in two or three independent experiments. (B) Cell morphology of L. pneumophila wild-type strain JR32, the lqs mutant, and an lqsR mutant strain grown for 8 h (exponential phase), 21 h (early stationary phase), and 30 h (late stationary phase) in AYE medium at 37°C. Representative transmission electron micrographs (upper row) or confocal microscopy pictures (lower three rows) of dividing cells (8 h); single coccoid, rod-shaped bacteria (21 h and 30 h; wild type and lqsR); or filamentous bacteria (21 h and 30 h; lqs) are shown.
|
L. pneumophila
lqs is less cytotoxic for amoebae and macrophages.
The effect of the lqs genes on host-pathogen interactions was assessed by testing for virulence-related phenotypes. L. pneumophila is cytotoxic for A. castellanii, as reflected by a shift of the host cell population toward smaller and more-granular cells in flow cytometry assays (Fig. 3A). Upon infection of A. castellanii with wild-type L. pneumophila for 24 h, the population of small, granular cells increased to 64.8%, compared to 2.8% for uninfected amoebae (data not shown) or 4.4.% for amoebae infected with icmT mutant bacteria lacking a functional Icm/Dot (intracellular multiplication/defective organelle trafficking) T4SS. An infection with lqs mutant L. pneumophila resulted in only 30.5% dead cells. The cytotoxicity defect of the lqs mutant strain was complemented upon chromosomal reintegration of a DNA fragment containing the native lqs genes (59.1% dead amoebae; strain CC9), indicating that the observed virulence defect is indeed due to the loss of the lqs gene cluster.
![]() View larger version (51K): [in a new window] |
FIG. 3. L. pneumophila lacking the lqs cluster is less cytotoxic for amoebae and macrophages. (A) Cytotoxicity of L. pneumophila against A. castellanii was assayed by flow cytometry at 24 h postinfection (MOI = 100) using the wild-type strain JR32, an lqs mutant strain, a chromosomally complemented lqs mutant (CC9), or an icmT mutant strain. Live versus dead A. castellanii bacteria were scored by a population shift toward smaller, more granular cells (forward scatter [FSC] versus sideward scatter [SSC]; upper) and quantified by PI staining (PI versus counts; lower). The data shown are representative of at least two independent experiments. (B) The viability of A. castellanii (left) or murine RAW264.7 (right) macrophages infected with L. pneumophila wild-type strain JR32 or the lqs or icmT mutant strain was assayed by an Alamar Blue dye reduction assay at 19 h postinfection (MOIs of 100, 10, and 1). The data shown are representative of at least three independent experiments. Statistically significant (P < 0.05; unpaired Student t test) differences are marked by asterisks (*, wild type versus mutants; **, lqs versus icmT).
|
Supplying the native lqs genes on plasmid pNT-1 in trans did not complement the cytotoxicity defect of the lqs mutant. However, since pNT-1 strongly reduced the cytotoxicity of wild-type L. pneumophila (data not shown), complementation by this plasmid was unlikely. Providing the four genes of the lqs cluster on a multicopy plasmid likely alters the copy number and possibly the expression levels of individual genes and thus might impair the balance between functionally different components of a complex regulatory system.
Alternatively, the viability of A. castellanii or murine RAW264.7 macrophages infected with L. pneumophila was assessed by determining the ability of the host cells to reduce the dye Alamar Blue. Using this dye reduction assay, wild-type L. pneumophila infected at an MOI of 100 or 10 was found to reduce the viability of A. castellanii by approximately 50% within 19 h postinfection. In contrast, the lqs and icmT mutant strains apparently did not reduce the viability of the amoebae at the MOIs tested (Fig. 3B).
Different from amoebae, macrophages are killed by L. pneumophila by a replication-independent but contact-dependent mechanism (33). Moreover, mammalian cells are usually more susceptible to killing by pathogenic bacteria than amoebae due to the induction of apoptotic pathways. Accordingly, the infection of murine RAW264.7 macrophages with wild-type L. pneumophila caused an MOI-dependent reduction in viability, as measured by the Alamar Blue reduction assay (Fig. 3B). An infection with wild-type L. pneumophila reduced the viability of macrophages already at an MOI of 1 approximately 20%, compared to the level for an uninfected macrophage monolayer, and at MOIs of 10 and 100, the viabilities decreased approximately 50% and 80%, respectively. Interestingly, while the lqs mutant strain was not cytotoxic for A. castellanii, under the same conditions, the mutant was cytotoxic for macrophages, as determined by a viability reduction of 15% or 50% at an MOI of 10 or 100, respectively. Cytotoxicity was entirely dependent on a functional Icm/Dot T4SS, since an icmT mutant did not reduce the viability of macrophages. In summary, in the absence of the lqs gene cluster L. pneumophila is impaired for cytotoxicity against A. castellanii and macrophages, and the phenotype is complemented upon reintegration of the native lqs genes into the chromosome.
L. pneumophila
lqs is impaired for intracellular growth in A. castellanii and efficient phagocytosis.
To analyze the intracellular replication of an lqs deletion mutant within A. castellanii, the amoebae were infected with GFP-expressing bacteria at an MOI of 10, and the percentage of green fluorescent amoebae was determined by flow cytometry as established previously (70). At 2 days postinfection, 34% and 4% of amoebae infected with the wild-type and lqsR mutant L. pneumophila strains, respectively, showed fluorescence above the background level (amoebae infected with icmT mutant bacteria), and within another day, these values increased to approximately 80% (Fig. 4A). In contrast, only 4% of A. castellanii strains infected with the lqs deletion mutant showed fluorescence values above the background level at 3 days postinfection, and this value increased to 35% over 5 days. These results indicate that a lack of the lqs gene cluster impairs intracellular replication much more strongly than the lack of only lqsR, suggesting that the other genes of the cluster synergistically contribute to the production of virulence traits.
![]() View larger version (38K): [in a new window] |
FIG. 4. L. pneumophila lqs is impaired for intracellular growth in A. castellanii and efficient phagocytosis. Intracellular replication of GFP-labeled L. pneumophila strains within A. castellanii over the period of 5 days was assayed by flow cytometry by gating on the amoebae (A) or on the bacteria (B) (black bars, wild-type JR32; dark gray bars, lqsR; light gray bars, lqs; white bars, icmT) released from infected amoebae (means and standard deviations for triplicates). (C) Intracellular replication of L. pneumophila strains was determined by counting CFU after infecting A. castellanii at an MOI of 1 with wild-type strain JR32 (black triangles), an hdeD mutant (gray triangles), an lqsR mutant (gray circles), an lqs mutant (white circles), or an icmT mutant (black squares). At the time points indicated, appropriate dilutions of supernatants of the infected amoebae were plated. (D) Phagocytosis of GFP-labeled L. pneumophila strains (wild-type JR32, hdeD, lqsR, lqs, or icmT) by A. castellanii infected at an MOI of 50 for 1 h was assayed by flow cytometry. Similar results were obtained in two (A, B) and at least three (C, D) independent experiments.
|
In another approach, we quantified intracellular replication within and release from A. castellanii of lqs mutants by determining the number of CFU in the supernatant (Fig. 4C). L. pneumophila does not replicate in the medium used for amoebae, and therefore, the number of CFU determined represents intracellularly grown bacteria. While the number of wild-type L. pneumophila bacteria grown in amoebae increased 4 orders of magnitude within 2 to 4 days, 100-fold-lower numbers of CFU were determined for an lqs mutant strain within the same period of time, indicating that the mutant bacteria replicated much less efficiently in amoebae. This phenotype was observed for several lqs mutant strains isolated independently (data not shown). Similar to what was observed with GFP-labeled L. pneumophila, the intracellular growth defect of an L. pneumophila lqsR mutant strain was less severe than the growth defect of the lqs mutant. Within 2 to 4 days, approximately 10 times fewer lqsR mutant bacteria were released from A. castellanii than from wild-type L. pneumophila, as reported previously (Fig. 4C) (70). We also quantified intracellular replication of an L. pneumophila
hdeD mutant strain (NT04) and found that this strain replicated at the wild-type level. The
hdeD mutant appeared morphologically normal and grew at the wild-type rate in AYE broth (data not shown). Finally, as expected, icmT mutant bacteria did not replicate at all but rather were eradicated by the amoebae.
Another virulence trait of L. pneumophila is efficient phagocytosis, which is dependent on a functional Icm/Dot T4SS as well as on LqsR (31, 70, 72). As expected, approximately 10 times more wild-type L. pneumophila bacteria were taken up by A. castellanii than by an icmT mutant strain (Fig. 4D). The lqs deletion mutant strain was as defective for efficient phagocytosis by the amoebae as the icmT mutant, and the lqsR mutant strain again showed a less pronounced phenotype. Moreover, the lqs and lqsR mutant strains were also phagocytosed less efficiently by D. discoideum and by differentiated human HL-60 macrophage-like cells (data not shown). Thus, deletion of the lqs genes apparently affects the expression of genes required for efficient phagocytosis of L. pneumophila. In contrast, the lack of HdeD did not affect the efficient phagocytosis of L. pneumophila.
In summary, compared to the deletion of lqsR only, the deletion of all four genes of the lqs cluster results in more-pleiotropic and more-severe phenotypes with regard to bacterial morphology and virulence traits. Since hdeD apparently is not involved in pathogen-host interactions, lqsA and lqsS likely account for the synergistic effects observed.
Effects of the lqs genes on pH and salt sensitivity of L. pneumophila in AYE medium. In E. coli, the hdeD gene is implicated in acid tolerance (38, 39). Therefore, we compared the growth of wild-type L. pneumophila and the hdeD, lqsR, and lqs mutant strains on CYE agar plates of different pH values. L. pneumophila grew robustly on CYE plates only over a quite narrow pH range of 6.6 to 7.4. Wild-type L. pneumophila and the hdeD mutant grew similarly at pH 6.3 to 7.7 (Fig. 5A) yet did not grow at pH 6.0 or 8.0 (data not shown). Thus, under the conditions tested, hdeD does not appear to play a role in acid tolerance of L. pneumophila. Interestingly, however, the lqs mutant strain was much more acid sensitive than the lqsR mutant, which grew at dilutions 3 to 4 orders of magnitude higher at pH values differing by only 0.2 to 0.3 units from the optimal value of 6.9. In summary, compared to the lqsR mutant strain the lqs mutant is characterized not only by more-severe morphological and virulence phenotypes but also by a more pronounced physiological phenotype.
![]() View larger version (43K): [in a new window] |
FIG. 5. Effects of the lqs genes on pH and salt sensitivity of L. pneumophila in AYE medium. L. pneumophila wild-type strain JR32 or the hdeD, lqsR, or lqs mutant strain grown for 21 h in AYE medium was spotted in triplicates at the dilutions indicated onto CYE agar plates titrated to the pH values indicated (A) or spotted onto CYE agar plates containing 100 mM NaCl or no additional salt (control) (B). One representative dilution series is shown for each strain, and similar results were obtained in three independent experiments.
|
The lqs genes regulate lqsR promoter activity. The expression of the lqsR response regulator gene is positively regulated by the alternative sigma factor RpoS and the two-component regulator LetA (70). To test whether the expression of lqsR is also regulated by the genes of the lqs cluster or by lqsR alone, we investigated the production of β-galactosidase under the control of the lqsR promoter in the L. pneumophila wild-type strain JR32 or in an lqs or lqsR mutant background (Fig. 6). In the wild-type strain, the lqsR promoter was induced in the replicative phase approximately sixfold. The expression of the lqsR promoter was reduced in the lqsR and even more pronounced in the lqs mutant strain. Interestingly, while in the wild-type strain and the lqsR mutant the expression of the lqsR promoter decreased to background levels upon entry into the stationary growth phase, in the lqs mutant the expression of lqsR remained almost constant at approximately 50% of the maximum wild-type level. These results suggest that the deletion of the lqs gene cluster affects the expression of the lqsR promoter more profoundly and also in an apparently more complex manner than deletion of only lqsR.
![]() View larger version (26K): [in a new window] |
FIG. 6. The lqs genes regulate lqsR promoter activity. lqsR promoter activity was quantified by β-galactosidase activity (bars) at the OD600s indicated (symbols) in wild-type L. pneumophila (black bars, ), an lqs mutant (white bars, ), or an lqsR mutant (gray bars, ) harboring plasmid pTS-14, which contains the lacZ gene under the control of the lqsR promoter. Similar results were obtained in at least two independent experiments.
|
legion/), and the InterPro database (http://www.ebi.ac.uk/interpro/). Interestingly, in the lqs mutant many key components required for the replicative phase were induced (Fig. 7A), including genes encoding (i) the protein production and secretion machinery (39% of the induced genes), (ii) metabolic functions (24%), (iii) membrane-bound bioenergetic complexes (7%), (iv) components of the bacterial envelope (7%), and (v) stress response proteins (8%). In contrast, among the genes repressed in the absence of the lqs cluster, as many as 22% encode factors required for the transmissive (virulent) phase of L. pneumophila, including virulence and motility factors (Fig. 7B). Among the downregulated virulence factors are Icm/Dot-secreted effector proteins, such as SidC, RalF, SidM/DrrA, LidA, or members of the SidE family of paralogues (53). Icm/Dot-independent (putative) virulence factors, such as the enhanced entry proteins (Enh) (14), the 24-kDa macrophage-induced major protein (42), or eukaryote-like proteins (8, 16), were also repressed. Eight percent of the genes repressed in the lqs mutant strain encode structural and regulatory components of the flagellum, which is a major trait of the transmissive (stationary) phase. It is noteworthy that the gene encoding the major structural component of the flagellum, flaA, was downregulated as much as 50-fold, and some flagellar genes organized in operons, e.g., lpg1218 to lpg1222, were also found to be repressed. Furthermore, 7% of the genes downregulated in the lqs mutant are predicted to encode regulatory or signal transduction proteins, suggesting that the lqs cluster is part of a complex regulatory network. Finally, while 16% of the genes repressed in the lqs mutant in stationary phase are involved in metabolic pathways, the vast majority of the downregulated genes (46%) are unknown and/or hypothetical. Many of these unclassified ORFs are predicted to encode small proteins (<100 amino acids) (see Table S1B in the supplemental material).
![]() View larger version (30K): [in a new window] |
FIG. 7. Classification and graphic representation of the lqs mutant strain transcriptome. DNA microarray analysis of the stationary-phase L. pneumophila lqs mutant or the wild-type strain JR32 revealed 190 or 196 genes that were induced or repressed, respectively, at least twofold. The genes induced (A) or repressed (B) in the lqs mutant strain compared to the levels in wild-type L. pneumophila were classified into functional groups and further divided into subgroups (y axis) based on their annotation or prediction by use of the InterPro database. The percentages of genes regulated are indicated with a bar graph (x axis) and represented as a pie graph (inset). The analysis is based on Table S1 in the supplemental material.
|
![]() View larger version (88K): [in a new window] |
FIG. 8. Comparative 2-DE analysis of soluble intracellular proteins extracted from wild-type L. pneumophila or an lqs mutant strain grown in AYE to stationary phase at 37°C. (A) Proteins were separated in the first dimension by isoelectric focusing on IPG strips with nonlinear pH gradients from 3 to 10, followed by SDS PAGE on 13% polyacrylamide gels in the second dimension. The gels were stained with Coomassie brilliant blue G-250. (B) The resulting spot patterns were analyzed with the Proteomeweaver software program. About 30 spots with increased intensities in either wild-type L. pneumophila (red circles) or the lqs mutant strain (blue circles) were picked, processed, and analyzed using MALDI-TOF MS-based sequencing. The protein spots identified are listed in Table S2 in the supplemental material. Asterisks indicate proteins regulated with the same pattern as in DNA microarray experiments. The gels shown are representatives of two independent experiments.
|
|
View this table: [in a new window] |
TABLE 2. Selection of differentially produced proteins in the proteomes of wild-type L. pneumophila and the lqs mutanta
|
|
|
|---|
The lqsA and lqsS gene products, an autoinducer synthase and a putative sensor kinase, might contribute to the lqs phenotypes by participating upstream of LqsR in a quorum sensing circuit. However, to account for the synergistic effects of the lqs deletion compared to what was found for the lqsR deletion, other regulatory pathways likely also play a role (Fig. 1B). The putative sensor kinase LqsS possibly signals to other (unknown) response regulators, which target a set of genes different from the LqsR-regulated genes. Alternatively or additionally, the
-hydroxyketone signaling molecule(s) produced by the autoinducer synthase LqsA (68) might trigger other receptor kinases in addition to LqsS.
While the L. pneumophila lqs mutant strain was attenuated in a number of virulence assays, the mutant showed reduced cytotoxicity against RAW264.7 macrophages but not A. castellanii when a dye reduction assay was used (Fig. 3B). Macrophages but not amoebae are sensitive to Icm/Dot-dependent immediate cytotoxicity (33), and therefore, it is not unexpected that, compared to free-living amoebae, the mammalian cells are more susceptible to wild-type L. pneumophila and also to attenuated mutants. Since in the dye reduction assay the lqs mutant strain was as cytotoxic as wild-type bacteria, and since the lqs mutant strain still grew intracellularly in contrast to an icmT mutant strain (Fig. 4A to C), the Icm/Dot T4SS is at least partially functional in the mutant strain, suggesting that the production of the T4SS is not significantly affected by the lqs genes. This finding is in agreement with transcriptome (see Table S1 in the supplemental material) and proteome (see Table S2 in the supplemental material) analyses, revealing that a number of Icm/Dot substrates but not structural components of the T4SS are downregulated in the lqs mutant strain. These results also suggest that the defect in efficient phagocytosis of the lqs and lqsR mutant strains is due to downregulation of specific effector proteins rather than a nonfunctional T4SS, even though the lqs and to a smaller extent the lqsR mutant strains are not more efficiently phagocytosed than an icmT mutant (Fig. 4D).
The virulence defects of the lqs mutant are reflected in the gene expression profile and proteome of the mutant strain. Both transcriptome and proteome analyses revealed downregulations of the Icm/Dot-secreted effectors SidC, SdcA, RalF, SidM/DrrA, and SdeD in the lqs mutant (Table 2). SidC and its paralogue SdcA specifically bind the host cell lipid phosphatidylinositol-4 phosphate, which accumulates on the LCV, where it serves as a membrane anchor for L. pneumophila effector proteins (56, 72). RalF and SidM/DrrA are guanine nucleotide exchange factors for the small GTPases Arf1 (49) and Rab1 (36, 48), respectively, which recruit their cognate GTPase to the LCV membrane.
Additional differentially regulated Icm/Dot substrates were identified either by transcriptome (see Table S1 in the supplemental material) or by proteome (see Table S2 in the supplemental material) analysis: LidA, SidD, SidG, SidH, a protein similar to SidE, SdeA, and SdeC. LidA interacts with Rab1, promotes structural alterations of the Golgi apparatus, and thus contributes to the subversion of the early secretory pathway by L. pneumophila (15, 36). SidG, SidH, and SdeA belong to a subgroup of Icm/Dot substrates interacting with the IcmS/IcmW complex in the bacterial cytoplasm (6, 54). SidH and its paralogues SdhA and SdhB were found to promote intracellular replication of L. pneumophila in macrophages by preventing host cell apoptosis rather than being required for the formation of the LCV (34). Finally, SidE, SdeA, SdeC, and SdeD form a paralogous family of Icm/Dot substrates with an unknown function (35). Taken together, the Icm/Dot substrates coordinately downregulated in the attenuated lqs mutant strain might identify a set of effector proteins critical for L. pneumophila virulence. In agreement with this notion, an lqsR mutant strain was attenuated less severely than the lqs mutant, and as judged by transcriptome analysis, no known Icm/Dot substrate (except SdbB) was found to be downregulated in the absence of only lqsR (70). As a corollary, the expression of Icm/Dot substrates might critically depend on signaling via the autoinducer synthase LqsA (68) and the putative sensor kinase LqsS.
Other virulence factors downregulated in the absence of the lqs cluster include VipE, which was identified in a screen for L. pneumophila genes interfering with vesicle transport in Saccharomyces cerevisiae (67), and paralogous members of the EnhC family of enhanced entry proteins. The EnhC proteins feature several Sel-1 domains, which are characteristic of a subfamily of eukaryotic tetratricopeptide repeat proteins and are implicated in protein-protein interactions (25). An EnhC paralogue termed LpnE (lpg2222) was recently found to be defective for efficient entry into but not intracellular replication within THP-1 macrophages (52). However, it is unlikely that downregulation of multiple enh genes accounts for the phagocytosis defect of the lqs mutant, since the expression levels of the enhA and enhB genes are upregulated in an lqsR mutant strain (70), which is impaired for efficient phagocytosis to an extent similar to that for the lqs mutant (Fig. 4D). In contrast, the major macrophage infectivity potentiator Mip was found to be upregulated in the lqs (see Table S1A in the supplemental material) and in the lqsR (70) mutant strains.
It is noteworthy that the 24-kDa macrophage-induced major protein and a number of eukaryote-like genes were downregulated in the lqs mutant strain (see Table S1B in the supplemental material). The L. pneumophila genome encodes a high number of eukaryote-like proteins (11), the acquisition of which by horizontal gene transfer was proposed to result from the coevolution of the bacteria with eukaryotic phagocytes (16). Several of these proteins possess conserved protein-protein interaction motifs preferably found in eukaryotes, such as the ankyrin or Sel-1 domains, and might subvert signal transduction or transcriptional control in host cells (8).
Of the 196 genes downregulated in the lqs mutant in the stationary growth phase, as many as 21% encode proteins involved in the manifestation of transmissive traits (Fig. 7B). In addition to the effector proteins outlined above, gene products required for bacterial motility belong to this group (8%). The induction of the flagellum apparatus is a major characteristic of the transmissive form of L. pneumophila. Several flagellar genes organized in operons, and flaA (encoding the major flagellar component flagellin) and the alternative sigma factor fliA are repressed in the lqs mutant strain. Interestingly, while the expression of the flaA gene is downregulated 50-fold in the lqs mutant strain, this gene is downregulated only 4-fold in the lqsR mutant, and in contrast to the lqs mutant, no other flagellar genes were downregulated (some were even slightly upregulated) in the lqsR mutant strain (70).
The elongated form observed for the lqs (but not lqsR) mutant bacteria might be a consequence of a downregulation of the bolA gene (see Table S1B in the supplemental material). In E. coli, bolA is induced during the transition from the replicative into the stationary growth phase, and the corresponding protein controls the switch between cell elongation and septation during cell division (61). An elongated form was also observed in wild-type L. pneumophila ectopically expressing the major positive regulator of the replicative growth phase, CsrA (21, 47), or the response regulator LqsR (70) or in a letA or letE mutant strain (5, 28).
Another indication that in the lqs mutant the transition from replicative to transmissive phase is impaired is the fact that multiple GGDEF regulatory proteins are downregulated. These proteins produce the second messenger cyclic di-GMP and seem to be implicated in the switch to the transmissive phase (9). Interestingly, in E. coli the GGDEF protein CsrD promotes the degradation of the CsrB and CsrC regulatory RNAs, which negatively regulate the global replication activator CsrA (69). In L. pneumophila, the RNA binding protein Hfq is involved in posttranslational control of CsrA (40) and downregulated 15-fold in the absence of lqs (see Table S1B in the supplemental material). Together with the result that the lqs genes and also lqsR alone positively regulated the expression of the lqsR promoter, these findings underscore the fact that the lqs genes are components of a complex regulatory network that critically contribute to the regulation of L. pneumophila metabolism and the transition from the replicative to the transmissive phase.
This work was supported by grants awarded to H.H. from the Swiss National Science Foundation (631-065952 and PP00A-112592), ETH Zürich (TH 17/02-3), the Commission for Technology and Innovation (6629.2 BTS-LS), and UBS AG on behalf of a client. Grants from the Agence Francaise de Sécurité Sanitaire de l'Environment et du Travail (ARCL-2005-002) and NIH (AI044212) were awarded to C.B. The H.H. group participates in the NEMO (nonmammalian experimental models for the study of bacterial infections) network, supported by the Swiss 3R foundation. H.B. was a holder of a fellowship of the German Academy of Natural Scientists Leopoldina (BMBF-LPD9901/8-101).
Published ahead of print on 19 September 2008. ![]()
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
Present address: Max Planck Institute for Infection Biology, Department of Molecular Biology, Charitéplatz 1, 10117 Berlin, Germany. ![]()
|
|
|---|
-hydroxyketone signaling molecule. J. Biol. Chem. 283:18113-18123.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»