Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yamanaka, H. Articles by Okamoto, K. Search for Related Content PubMed PubMed Citation Articles by Yamanaka, H. Articles by Okamoto, K.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2008, p. 7693-7698, Vol. 190, No. 23
0021-9193/08/$08.00+0     doi:10.1128/JB.00853-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

MacAB Is Involved in the Secretion of Escherichia coli Heat-Stable Enterotoxin II

Hiroyasu Yamanaka,^1* Hidetomo Kobayashi,¹ Eizo Takahashi,² and Keinosuke Okamoto²

Laboratory of Molecular Microbiological Science, Faculty of Pharmaceutical Sciences, Hiroshima International University, Hiro-Koshingai, Kure, Hiroshima 737-0112,¹ Department of Pharmacogenetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Okayama 700-8530, Japan²

Received 23 June 2008/ Accepted 11 September 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
The heat-stable enterotoxin (ST) produced by enterotoxigenic Escherichia coli is an extracellular peptide toxin that evokes watery diarrhea in the host. Two types of STs, STI and STII, have been found. Both STs are synthesized as precursor proteins and are then converted to the active forms with intramolecular disulfide bonds after being released into the periplasm. The active STs are finally translocated across the outer membrane through a tunnel made by TolC. However, it is unclear how the active STs formed in the periplasm are led to the TolC channel. Several transporters in the inner membrane and their periplasmic accessory proteins are known to combine with TolC and form a tripartite transport system. We therefore expect such transporters to also act as a partner with TolC to export STs from the periplasm to the exterior. In this study, we carried out pulse-chase experiments using E. coli BL21(DE3) mutants in which various transporter genes (acrAB, acrEF, emrAB, emrKY, mdtEF, macAB, and yojHI) had been knocked out and analyzed the secretion of STs in those strains. The results revealed that the extracellular secretion of STII was largely decreased in the macAB mutant and the toxin molecules were accumulated in the periplasm, although the secretion of STI was not affected in any mutant used in this study. The periplasmic stagnation of STII in the macAB mutant was restored by the introduction of pACYC184, containing the macAB gene, into the cell. These results indicate that MacAB, an ATP-binding cassette transporter of MacB and its accessory protein, MacA, participates in the translocation of STII from the periplasm to the exterior. Since it has been reported that MacAB cooperates with TolC, we propose that the MacAB-TolC system captures the periplasmic STII molecules and exports the toxin molecules to the exterior.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Gram-negative bacteria such as Escherichia coli have a cell envelope containing two lipid bilayer membranes, the inner membrane (IM) and outer membrane (OM). These membranes function as barriers to the transport of macromolecules. However, the bacteria in fact transport various kinds of macromolecules across these membranes to survive (8, 18). To achieve the efficient transport of macromolecules, the bacteria have developed special systems. The tripartite transport system is typical of such systems. This system generally consists of three proteins: the IM transporter, the OM channel, and the accessory protein, which functions as an adaptor connecting with both the IM and OM proteins (23, 35). The IM transporter acts as a pump protein. To achieve active transport, the three change their conformation, utilizing as a driving force the proton motive force or ATP hydrolysis (24). Although there is not enough energy in the OM, it is thought that the OM channel can express transport activity by working together with both the IM transporter and the accessory protein.

TolC is a major OM channel in E. coli that plays an important role in the excretion of a wide range of molecules, including antibiotics (18, 25, 27), bile salts (3, 40, 45), organic solvents (1), enterobactin (4), several antibacterial peptides such as colicin V (11, 12) and microcin J25 (7), and also a large protein toxin, alpha-hemolysin (47, 48). Although TolC acts as a unique OM channel in these cases, various kinds of IM transporters and accessory proteins interact with TolC and enable E. coli to expel structurally diverse molecules. To date, it has been found that TolC can associate with at least 11 kinds of IM transporters and accessory proteins. They are AcrAB, AcrAD, AcrEF, MdtABC, MdtEF, EmrAB, EmrKY, MacAB, YojHI, CvaAB, and HlyBD. For instance, the AcrAB-TolC system functions as a major excretion apparatus for antibiotics, bile salts, and noxious organic solvents and provides intrinsic resistance to these compounds (1, 3, 18, 25, 27, 40, 45). CvaAB, YojHI, and HlyBD enable the bacterium to export proteinaceous factors such as colicin V, microcin J25, and alpha-hemolysin, respectively (7, 11, 12, 47, 48). Thus, TolC plays a central role in the extracellular transport of diverse molecules in cooperation with various kinds of translocators.

Yamanaka et al. and Foreman et al. found that TolC is also involved in the secretion of the heat-stable enterotoxins (STs; STI and STII) produced by enterotoxigenic E. coli (ETEC) (16, 50). Although in their primary structure these STs are quite different (32, 34, 44, 52), their maturation processes are similar. That is, these STs are synthesized as precursor proteins with an amino-terminal signal sequence and are translocated across the IM via the Sec machinery (16, 31, 51). After translocation, the toxins are released into the periplasm and folded to the mature forms via the actions of DsbA, a periplasmic disulfide oxidoreductase (9, 30, 49). The mature STs thus produced are ultimately transported from the periplasm into the milieu through the TolC channel (9, 50). This evidence indicates the TolC channel is also involved in the excretion of periplasmic substrates such as STs. However, it remains unclear how STs produced in the periplasm are moved to the TolC channel. In several known efflux systems containing TolC, the components construct a tripartite transport system as described above. We therefore presume that a certain transporter in cooperation with TolC recognizes the periplasmic ST molecules and leads them to the interior of the TolC channel.

In this study, we examined whether several distinct types of IM translocators and their accessory proteins, which are already known to function with TolC, participate in the translocation of STs from the periplasm to the exterior. The transporters examined in this study are AcrAB, AcrEF, MdtEF, EmrAB, EmrKY, MacAB, and YojHI. It is known that AcrAB, AcrEF, and MdtEF are RND (resistance nodulation cell division) family transporters, EmrAB and EmrKY are MF (major facilitator) superfamily transporters, and MacAB and YojHI are ABC (ATP-binding cassette) family transporters (7, 27, 29, 39). The results revealed that an ABC transporter, MacAB, was involved in the translocation of STII from the periplasm into the milieu but not in the translocation of STI. This is the first report about a factor engaged in the export of an ST from the periplasm to the exterior in cooperation with TolC.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Bacterial strains, plasmids, and growth conditions. E. coli strains and plasmids used in this study are listed in Table 1. Strains were cultivated at 37°C in Luria-Bertani (LB) broth (10 g of Bacto-tryptone, 5 g of yeast extract, and 5 g of NaCl per liter) or LB agar. For gene disruption, strains were grown at 30°C in SOB medium (Difco). The Red helper plasmid pKD46 and other plasmids, pKD4 and pCP20, required for gene disruption were kindly provided by the E. coli Genetic Stock Center (Yale University). The antibiotics ampicillin (50 µg/ml), kanamycin (25 µg/ml), and chloramphenicol (12.5 µg/ml) were used for selection where indicated.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used in this study

Construction of mutants whose target gene(s) was disrupted. A direct mutagenesis using PCR gene fragments was performed as originally described by Datsenko and Wanner (6). The kanamycin resistance gene (kan) of the plasmid pKD4 was amplified using primers P1 and P2, which are shown in Table 2. These primers were designed with 39 nucleotides (nt) homologous to the region immediately upstream (P1) or downstream (P2) of the target gene followed by the 20-nt sequence derived from sequence upstream or downstream of kan encoded on pKD4 (Table 2). A 100-ng aliquot of the PCR product was mixed with 50 µl of electrocompetent E. coli BL21(DE3) cells carrying pKD46, and the mixed solution was transferred into an ice-cold 0.2-cm cuvette (Bio-Rad Laboratories). Electroporation was conducted using a Gene Pulser Xcell electroporation system (Bio-Rad Laboratories) at 2.5 kV, 25 mF, and 200 and was immediately followed by the addition of 1 ml of SOC medium (SOB medium containing 20 mM glucose). We then incubated the culture for 2 h at 37°C. A 100-µl aliquot of the cell suspension was spread onto LB agar containing kanamycin and incubated for 16 to 18 h at 37°C to select for kanamycin-resistant recombinants.

View this table: [in this window] [in a new window]

TABLE 2. PCR primers designed for gene disruptionsa

Verification of the gene disruption. To verify whether appropriate homologous recombination occurred, we carried out a PCR analysis using the primers k1 (CAGTCATAGCCGAATAGCCT), k2 (CGGTGCCCTGAATGAACTGC), and kt (CGGCCACAGTCGATGAATCC) (6) and also primers for the regions upstream and downstream of each target gene (Table 2).

Elimination of the antibiotic resistance gene. To make multiple gene knockout (KO) mutants, we eliminated the kan gene on the chromosome introduced by the homologous recombination. We utilized pCP20, a temperature-sensitive plasmid that shows thermal induction of FLP (flip-out) recombinase (6). The kan replacement mutants were transformed with pCP20, and the transformants were selected at 30°C on LB agar containing both ampicillin and chloramphenicol, after which a few were colony purified once, nonselectively, at 43°C and then tested for loss of all antibiotic resistance. We confirmed the loss of kan on the chromosome by means of a PCR analysis using primers for the regions upstream and downstream of each target gene (Table 2). The deletion mutants thus obtained were used in the second direct mutation for the next target gene. Repeating these procedures, we made multiple KO mutants: BL21(DE3) 2-1, 2-2, 3, 4, 5, 6, and 7 (Table 1).

Pulse-chase experiment. The pulse-chase experiment using L-[³⁵S]cysteine (ICN Biomedicals) was performed according to our previously described method (33, 50). After the pulse-chase period (pulse for 3 min, chase for 3 min), the culture was fractionated into culture supernatant and periplasmic fractions as described previously (33, 50). Both fractions were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), using a 20% acrylamide gel. Radiolabeled STs were visualized by autoradiography using BioMax MS X-ray film (Kodak).

Insertion of macAB into the plasmid pACYC184. The macAB gene was amplified from the chromosomal DNA of E. coli BL21(DE3) using two primers, MacAB-up (5'-AAAAGTGACAAGCTTCTGAGAGATTCA-3') and MacAB-down (5'-GCAGTCGCATAAAGCTTCTGTCTCATTGTG-3'). These primers cover the regions upstream and downstream of macAB, respectively. Both primers contain a HindIII site (underlined). The macAB gene amplified with these primers encompassed both the promoter and structural regions of the gene. The amplified gene fragments were digested with HindIII. The resulting gene fragments were inserted into a HindIII site of the plasmid pACYC184. The plasmid obtained was designated pACYC-MacAB (Table 1).

Sensitivity test. The sensitivity of cells to erythromycin was examined by halo assay on an LB agar plate using a Tridisk (Eiken, Japan). A drop of bacterial suspension (approximately 10⁸ cells/ml) was spread on an LB agar plate. A Tridisk attached to three filters containing 0.5, 2.0, and 10.0 µg/ml of erythromycin was carefully placed onto the plate. The plate was allowed to incubate overnight at 37°C. We then observed the halo (growth inhibition zone) formed around each filter.

Immunoblotting against TolC. Preparation of the OM fraction and detection of the TolC band on the SDS-PAGE (12.5% acrylamide) gel by immunoblotting were performed as described previously (53). To detect TolC, an antiserum prepared by injecting a peptide (ELRKSAADRDAAFEK) conjugated with ovalbumin into rabbits was used. The generated immune complexes were detected with a chemiluminescence reagent (Amersham Biosciences, United Kingdom).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
The STs STI and STII are major pathogenic factors produced by ETEC that evoke watery diarrhea (22). To investigate how STs are released into the milieu, therefore, is very important for understanding and controlling the pathogenicity of ETEC. In this study, we searched for a factor participating in the TolC-dependent translocation of STs from the periplasm to the exterior, because TolC usually forms a tripartite transport system with the IM translocator and its accessory protein.

Secretion of STs in multiple KO mutants. Since all standard E. coli strains can release STs to the exterior when transformed with the plasmid containing the ST gene alone, we postulated that an intrinsic mechanism contributes to the secretory process. To date, it has been found that nine IM translocators and their accessory proteins, both encoded on the E. coli chromosome, can construct a tripartite transport system in cooperation with TolC. They are AcrAB, AcrAD, AcrEF, MdtABC, MdtEF, EmrAB, EmrKY, MacAB, and YojHI (7, 21, 27, 28). We therefore focused upon these transporters in this study.

We made multiple KO mutants (1 to 7) derived from BL21(DE3) as shown in Table 1 and analyzed the extracellular secretion of STs in these mutants by conducting pulse-chase experiments. As shown in Fig. 1A, the amount of TolC in the OM was almost the same in all KO mutants, suggesting that these gene disruptions did not affect the production of TolC.

View larger version (52K): [in this window] [in a new window]

FIG. 1. Secretion of STs from cells of E. coli BL21(DE3) and derivative deletion mutants. TolC in the OM of each mutant was detected by immunoblotting using anti-TolC antiserum (A). To examine the secretion of STs, a pulse-chase experiment was carried out as described in the text. The culture supernatant and periplasmic fractions were resolved by SDS-PAGE (20% acrylamide gel), and STs in the gels were detected by autoradiography. (B and C) Secretion of STI (B) and STII (C) from cells.

Results regarding the secretion of STI from the cells harboring pET11-STI are presented in Fig. 1B. Almost all the STI synthesized in these KO mutants (1 to 7) was efficiently secreted into the culture supernatant (lanes 3 to 10), and the amount of STI remaining in the periplasm was very small (lanes 13 to 20), as observed in the wild-type cells (lanes 2 and 12). This result indicates that deletion of the transporter genes did not affect the extracellular secretion of STI. We therefore conclude that the transporters encoded by these genes (AcrAB, AcrEF, EmrAB, EmrKY, MacAB, MdtEF, and YojHI) are not engaged in the secretion of STI.

In contrast, we also examined the secretion of STII in these mutant strains harboring pET11-STII. The results are shown in Fig. 1C. In both BL21(DE3) mutants 1 and 2-1, almost all the STII produced in the cells was released into the culture supernatant (lanes 3 and 4) and the amount remaining in the periplasm was very small (lanes 13 and 14), as observed with the wild-type strain (lanes 2 and 12). However, in the other mutants (2-2 to 7), the extracellular secretion of STII was markedly disturbed (lanes 5 to 10) and a large amount remained in the periplasm (lanes 15 to 20). This result indicates that the translocation of STII from the periplasm to the exterior was largely decreased in these mutants. Since both macAB and yojHI genes were knocked out in all of these mutants, we speculate that either MacAB, YojHI, or both participate in the translocation of STII from the periplasm to the exterior.

Secretion of STs in the macAB::kan or yojHI::kan mutant. To examine the involvement of MacAB and/or YojHI in the extracellular transportation of STII, a pulse-chase experiment was carried out using a single-gene-disrupted mutant, macAB::kan [BL21(DE3)mac] or yojHI::kan [BL21(DE3)yoj]. In these mutants, the immunoblotting analysis clearly revealed that the production of TolC was not affected by the mutation of the target gene (Fig. 2A).

View larger version (38K): [in this window] [in a new window]

FIG. 2. Effects of disruption of the macAB and yojHI genes on translocation of STs from the periplasm to the exterior. TolC in the OM of each mutant was detected by immunoblotting using anti-TolC antiserum (A). To examine the secretion of STs, a pulse-chase experiment using cells harboring the indicated plasmid(s) was performed as described in the text. The culture supernatant and periplasmic fractions were resolved by SDS-PAGE (20% acrylamide gel), and STs in the gels were detected by autoradiography. (B and C) Secretion of STI (B) and STII (C) from cells.

As expected, disruption of either macAB, yojHI, or both did not affect the extracellular secretion of STI at all (Fig. 2B). On the other hand, disruption of macAB caused a marked decrease in the extracellular secretion of STII (Fig. 2C, lane 2) and the STII accumulated in the periplasm (Fig. 2C, lane 8), as observed with the mutant 2-2 harboring pET-STII (Fig. 2C, lanes 5 and 11). Disruption of yojHI, however, did not affect the secretion of STII (Fig. 2C, lanes 3 and 9). These results indicate that MacAB is closely involved in the translocation of STII from the periplasm into the culture supernatant.

Restoration of STII secretion in the macAB::kan mutant by the introduction of pACYC-MacAB. To confirm the participation of MacAB in the transportation of STII from the periplasm to the exterior, we introduced the compatible plasmid pACYC184 containing macAB (pACYC-MacAB) into BL21(DE3)mac harboring pET-STII. First, we estimated the expression of MacAB from pACYC-MacAB. SDS-PAGE (12.5% acrylamide gel) of the sonicated cell preparation revealed that both MacA and MacB were expressed in the mutant transformed with pACYC-MacAB (Fig. 3A, lane 2) but not in the mutant without the plasmid (Fig. 3A, lane 1). Next, we assessed the activity of MacAB expressed from pACYC-MacAB. Since MacAB participates in the excretion of macrolides such as erythromycin, we performed a sensitivity test using a Tridisk containing erythromycin. In this test, we used the mutant 3 because AcrAB also functions in the excretion of macrolides. As shown in Fig. 3B (lane 2), the mutant 3 was highly sensitive to erythromycin. In contrast, the mutant 3 transformed with pACYC-MacAB became resistant to erythromycin (Fig. 3B, lane 3) as observed with the wild type (Fig. 3B, lane 1), suggesting that MacAB expressed from pACYC-MacAB was actually functional.

View larger version (37K): [in this window] [in a new window]

FIG. 3. Functional analysis of MacAB expressed from pACYC-MacAB. (A) SDS-PAGE (12.5% acrylamide gel) analysis of the sonicated cell preparation obtained from cells harboring the indicated plasmid. The positions of molecular mass markers are shown on the left. The arrows on the right indicate the positions of MacA and MacB. (B) Bioassay for erythromycin efflux by the MacAB expressed from pACYC-MacAB. A sensitivity test using a Tridisk containing erythromycin (0.5, 2.0, and 10 µg/ml) was performed as described in the text.

We then carried out a pulse-chase experiment using the mutants transformed with pACYC-MacAB. As shown in Fig. 2C, the extracellular secretion of STII in the mutant mac was completely restored by the introduction of pACYC-MacAB (lane 4) and the amount of STII remaining in the periplasm was markedly decreased (lane 10). Similarly, the secretion of STII from the mutant 2-2 was also restored by the introduction of pACYC-MacAB (Fig. 2C, lanes 6 and 12). These results strongly support that MacAB contributes to the translocation of STII from the periplasm to the exterior, although it does not participate in the secretion of STI. Thus, the secretory processes from the periplasm to the outside differ between STI and STII.

It has been reported that MacAB is an ABC transporter that collaborates with TolC (14, 15). Although MacAB was first recognized as a transporter that participates in the excretion of macrolides such as erythromycin (15), the results of our study suggest that it can transport other substrates, including STII. For Salmonella enterica serovar Typhimurium, Nishino et al. recently reported that deletion of macAB attenuated virulence (26). It is, therefore, likely that MacAB also functions as a specific export system in E. coli that is closely related to bacterial pathogenicity.

How does MacAB engage in the export of STII in E. coli? Although further study is needed to fully answer this question, MacAB must be able to capture the substrates from the periplasm and translocate them into the center of the tunnel formed by TolC, because the STII precursor is released into the periplasm, where it is converted into the mature toxin (30). Our previous study indicated that STII was localized in the periplasmic fraction, not in the IM fraction containing MacAB, when the toxin was produced in a tolC-deficient strain (53). It is therefore likely that the interaction of STII with MacAB may be weak or transient, although the interaction must occur specifically. In the efflux of some β-lactams through an RND family transporter, AcrB, it has been reported that drugs in the periplasm might be collected in the central cavity through vestibules that are opened to the periplasm (19, 20, 43) and the adaptor protein AcrA might play an important role in the transfer of energy provided by AcrB to the TolC channel to be opened (2, 17). Furthermore, in the MacAB system, Tikhonova et al. recently reported that the adaptor protein MacA stimulates the ATPase activity of MacB and acts as a functional subunit of the MacB transporter (46). It is, therefore, likely that similar molecular mechanisms, as expected in the AcrAB-TolC system, are involved in the transportation of the periplasmic STII molecules through the MacAB-TolC apparatus.

In gram-negative bacteria, six different secretion systems (types I to VI) have been identified as specific to extracellular proteins (5, 13, 36, 38, 41, 42). The type II secretion system usually functions in the transport of products that have been released and have matured in the periplasm. In this system, the periplasmic products are translocated across the OM via a multimeric protein complex called the secreton (10, 37). In the secretion of STII, however, the periplasmic toxin molecules are transported to the exterior via a distinct intrinsic transport system, MacAB-TolC, although they are released into the periplasm through the Sec machinery as seen with the type II secretory process. At this point, we should emphasize that STII is secreted via a unique pathway different from that for other protein toxins.

In conclusion, we propose a schematic model for the secretion of STs (Fig. 4) in which MacAB recognizes and transports periplasmic STII but not STI into the entrance of the TolC channel and the STII molecules are ultimately released to the exterior through the channel. However, we have not found any evidence for the interaction of STII with MacAB. Several molecular approaches will be required to resolve this process. Elucidation of the tertiary structure of MacAB may also help to consider the molecular mechanism behind this secretory process. Further research is in progress in our laboratory.

View larger version (22K): [in this window] [in a new window]

FIG. 4. Schematic model of secretion of STs to the exterior.

 
* Corresponding author. Mailing address: Laboratory of Molecular Microbiological Science, Faculty of Pharmaceutical Sciences, Hiroshima International University, Hiro-Koshingai, Kure, Hiroshima 737-0112, Japan. Phone: 81-823-73-8294. Fax: 81-823-73-8981. E-mail: h-yamana{at}ps.hirokoku-u.ac.jp

Published ahead of print on 19 September 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1
1. Aono, R., N. Tsukagoshi, and M. Yamamoto. 1998. Involvement of outer membrane protein TolC, a possible membrane of the mar-sox regulon in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12. J. Bacteriol. 180:938-944.[Abstract/Free Full Text]
2
2. Bavro, V. N., Z. Pietras, N. Furnham, L. Pérez-Cano, J. Fernández-Recio, X. Y. Pei, R. Misra, and B. Luisi. 2008. Assembly and channel opening in a bacterial drug efflux machine. Mol. Cell 30:114-121.[CrossRef][Medline]
3
3. Bina, J. E., and J. J. Mekalanos. 2001. Vibrio cholerae tolC is required for bile resistance and colonization. Infect. Immun. 69:4681-4685.[Abstract/Free Full Text]
4
4. Bleuel, C., C. Große, N. Taudte, J. Scherer, D. Wesenberg, G. J. Krauß, D. H. Nies, and G. Grass. 2005. TolC is involved in enterobactin efflux across the outer membrane of Escherichia coli. J. Bacteriol. 187:6701-6707.[Abstract/Free Full Text]
5
5. Christie, P. J. 2001. Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol. Microbiol. 40:294-305.[CrossRef][Medline]
6
6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
7
7. Delgado, M. A., P. A. Vincent, R. N. Farías, and R. A. Salomón. 2005. YojI of Escherichia coli functions as a microcin J25 efflux pump. J. Bacteriol. 187:3465-3470.[Abstract/Free Full Text]
8
8. Dinh, T., I. T. Paulsen, and M. H. Saier, Jr. 1994. A family of extracytoplasmic proteins that allow transport of large molecules across the outer membranes of gram-negative bacteria. J. Bacteriol. 176:3825-3831.[Abstract/Free Full Text]
9
9. Foreman, D. T., Y. Martinez, G. Coombs, A. Torres, and Y. M. Kupersztoch. 1995. TolC and DsbA are needed for the secretion of STB, a heat-stable enterotoxin of Escherichia coli. Mol. Microbiol. 18:237-245.[CrossRef][Medline]
10
10. Gérard-Vincent, M., V. Robert, G. Ball, S. Bleves, G. P. Michel, A. Lazdunski, and A. Filloux. 2002. Identification of XcpP domains that confer functionally and specificity to the Pseudomonas aeruginosa type II secretion apparatus. Mol. Microbiol. 44:1651-1665.[CrossRef][Medline]
11
11. Gilson, L., H. K. Mahanty, and R. Kolter. 1990. Genetic analysis of an MDR-like export system: the secretion of colicin V. EMBO J. 9:3875-3894.[Medline]
12
12. Guo, X., R. W. Harrison, and P. C. Tai. 2006. Nucleotide-dependent dimerization of the C-terminal domain of the ABC transporter CvaB in colicin V secretion. J. Bacteriol. 188:2383-2391.[Abstract/Free Full Text]
13
13. Jacob-Dubuisson, F., C. Locht, and R. Antoine. 2001. Two-partner secretion in gram-negative bacteria: a thrifty, specific pathway for large virulence proteins. Mol. Microbiol. 40:306-313.[CrossRef][Medline]
14
14. Kobayashi, N., K. Nishino, T. Hirata, and A. Yamaguchi. 2003. Membrane topology of ABC-type macrolides antibiotic exporter MacB in Escherichia coli. FEBS Lett. 546:241-246.[CrossRef][Medline]
15
15. Kobayashi, N., K. Nishino, and A. Yamaguchi. 2001. Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J. Bacteriol. 183:5639-5644.[Abstract/Free Full Text]
16
16. Kupersztoch, Y. M., K. Tachias, C. R. Moomaw, L. A. Dreyfus, R. Urban, C. Slaughter, and S. Whipp. 1990. Secretion of methanol-insoluble heat-stable enterotoxin (ST_B): energy- and secA-dependent conversion of pre-ST_B to an intermediate indistinguishable from the extracellular toxin. J. Bacteriol. 172:2427-2432.[Abstract/Free Full Text]
17
17. Lobedanz, S., E. Bokma, M. F. Symmons, E. Koronakis, C. Hughes, and V. Koronakis. 2007. A periplasmic coiled-coil interface underlying TolC recruitment and the assembly of bacterial drug efflux pumps. Proc. Natl. Acad. Sci. USA 104:4612-4617.[Abstract/Free Full Text]
18
18. Ma, D., D. N. Cook, J. E. Hearst, and H. Nikaido. 1994. Efflux pump and drug resistance in gram-negative bacteria. Trends Microbiol. 2:489-493.[CrossRef][Medline]
19
19. Murakami, S., R. Nakashima, E. Yamashita, T. Matsumoto, and A. Yamaguchi. 2006. Crystal structures of a multidrug transporter reveal a functionally rotating mechanism. Nature 443:173-179.[CrossRef][Medline]
20
20. Murakami, S., R. Nakashima, E. Yamashita, and A. Yamaguchi. 2002. Crystal structure of bacterial multidrug efflux transporter AcrB. Nature 419:587-593.[CrossRef][Medline]
21
21. Nagakubo, S., K. Nishino, T. Hirata, and A. Yamaguchi. 2002. The putative response regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug exporter system, MdtABC. J. Bacteriol. 184:4161-4167.[Abstract/Free Full Text]
22
22. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
23
23. Nikaido, H. 1996. Multidrug efflux pumps of gram-negative bacteria. J. Bacteriol. 178:5853-5859.[Free Full Text]
24
24. Nikaido, H. 1994. Prevention of drug access to bacterial targets: permeability barriers and active efflux. Science 264:382-388.[Abstract/Free Full Text]
25
25. Nikaido, H., and H. I. Zgurskaya. 2001. AcrAB and related multidrug efflux pumps of Escherichia coli. J. Mol. Microbiol. Biotechnol. 3:215-218.[Medline]
26
26. Nishino, K., T. Latifi, and E. A. Groisman. 2006. Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Mol. Microbiol. 59:126-141.[CrossRef][Medline]
27
27. Nishino, K., J. Yamada, H. Hirakawa, T. Hirata, and A. Yamaguchi. 2003. Roles of TolC-dependent multidrug transporters of Escherichia coli in resistance to β-lactams. Antimicrob. Agents Chemother. 47:3030-3033.[Abstract/Free Full Text]
28
28. Nishino, K., and A. Yamaguchi. 2002. EvgA of the two-component signal transduction system modulates production of the YhiUV multidrug transporter in Escherichia coli. J. Bacteriol. 184:2319-2323.[Abstract/Free Full Text]
29
29. Nishino, K., and A. Yamaguchi. 2001. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183:5803-5812.[Abstract/Free Full Text]
30
30. Okamoto, K., T. Baba, H. Yamanaka, N. Akashi, and Y. Fujii. 1995. Disulfide bond formation and secretion of Escherichia coli heat-stable enterotoxin II. J. Bacteriol. 177:4579-4586.[Abstract/Free Full Text]
31
31. Okamoto, K., and M. Takahara. 1990. Synthesis of Escherichia coli heat-stable enterotoxin STp as a pre-pro form and role of the pro sequence in secretion. J. Bacteriol. 172:5260-5265.[Abstract/Free Full Text]
32
32. Okamoto, K., and H. Yamanaka. 2000. Properties and actions of heat-stable enterotoxin of Escherichia coli. J. Nat. Toxins 9:213-229.[Medline]
33
33. Okamoto, K., H. Yamanaka, M. Takeji, and Y. Fujii. 2001. Region of heat-stable enterotoxin II of Escherichia coli involved in translocation across the outer membrane. Microbiol. Immunol. 45:349-355.[Medline]
34
34. Ozaki, H., T. Sato, H. Kubota, Y. Hata, Y. Kutsube, and Y. Shimonishi. 1991. Molecular structure of the toxic domain of heat-stable enterotoxin produced by a pathogenic strain of Escherichia coli. J. Biol. Chem. 266:5934-5941.[Abstract/Free Full Text]
35
35. Paulsen, I. T., J. H. Park, P. S. Choi, and M. H. Saier, Jr. 1997. A family of gram-negative bacterial outer membrane factors that function in the export of proteins, carbohydrates, drugs, and heavy metals from gram-negative bacteria. FEMS Microbiol. Lett. 156:1-8.[Medline]
36
36. Plano, G. V., J. B. Day, and F. Ferracci. 2001. Type III export: new uses for an old pathway. Mol. Microbiol. 40:284-293.[CrossRef][Medline]
37
37. Pugsley, A. P. 1993. The complete general secretory pathway in gram-negative bacteria. Microbiol. Rev. 57:50-108.[Abstract/Free Full Text]
38
38. Pukatzki, S., A. T. Ma, D. Sturtevant, B. Krastins, D. Sarracino, W. C. Nelson, J. F. Heidelberg, and J. J. Mekalanos. 2006. Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc. Natl. Acad. Sci. USA 103:1528-1533.[Abstract/Free Full Text]
39
39. Putman, M., H. W. van Veen, and W. N. Konings. 2000. Molecular properties of bacterial multidrug transporters. Microbiol. Mol. Biol. Rev. 64:672-693.[Abstract/Free Full Text]
40
40. Rosenberg, E. Y., D. Bertenthal, M. L. Nilles, K. P. Bertrand, and H. Nikaido. 2003. Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein. Mol. Microbiol. 48:1609-1619.[CrossRef][Medline]
41
41. Saier, M. H., Jr. 2006. Protein secretion and membrane insertion systems in gram-negative bacteria. J. Membr. Biol. 214:75-90.[CrossRef][Medline]
42
42. Sandkvist, M. 2001. Biology of type II secretion. Mol. Microbiol. 40:271-283.[CrossRef][Medline]
43
43. Seeger, M. A., A. Schiefner, T. Eicher, F. Verrey, K. Diederichs, and K. M. Pos. 2006. Structural asymmetry of AcrB trimer suggests a peristaltic pump mechanism. Science 313:1295-1298.[Abstract/Free Full Text]
44
44. Sukumar, M., J. Rizo, M. Wall, L. A. Dreyfus, Y. M. Kupersztoch, and L. M. Gierasch. 1995. The structure of Escherichia coli heat-stable enterotoxin b by nuclear magnetic resonance and circular dichroism. Protein Sci. 4:1718-1729.[Medline]
45
45. Thanassi, D. G., L. W. Cheng, and H. Nikaido. 1997. Active efflux of bile salts by Escherichia coli. J. Bacteriol. 179:2512-2518.[Abstract/Free Full Text]
46
46. Tikhonova, E. B., V. K. Devroy, S. Y. Lau, and H. I. Zgurskaya. 2007. Reconstitution of the Escherichia coli macrolide transporter: the periplasmic membrane fusion protein MacA stimulates the ATPase activity of MacB. Mol. Microbiol. 63:895-910.[Medline]
47
47. Vakharia, H., G. J. German, and R. Misra. 2001. Isolation and characterization of Escherichia coli tolC mutants defective in secreting enzymatically active alpha-hemolysin. J. Bacteriol. 183:6908-6916.[Abstract/Free Full Text]
48
48. Wandersman, C., and P. Delepelaire. 1990. TolC, an Escherichia coli outer membrane protein required for hemolysin secretion. Proc. Natl. Acad. Sci. USA 87:4776-4780.[Abstract/Free Full Text]
49
49. Yamanaka, H., M. Kameyama, T. Baba, Y. Fujii, and K. Okamoto. 1994. Maturation pathway of Escherichia coli heat-stable enterotoxin I: requirement of DsbA for disulfide bond formation. J. Bacteriol. 176:2906-2913.[Abstract/Free Full Text]
50
50. Yamanaka, H., T. Nomura, Y. Fujii, and K. Okamoto. 1998. Need for TolC, an Escherichia coli outer membrane protein, in the secretion of heat-stable enterotoxin I across the outer membrane. Microb. Pathog. 25:111-120.[CrossRef][Medline]
51
51. Yamanaka, H., T. Nomura, Y. Fujii, and K. Okamoto. 1997. Extracellular secretion of Escherichia coli heat-stable enterotoxin I across the outer membrane. J. Bacteriol. 179:3383-3390.[Abstract/Free Full Text]
52
52. Yamanaka, H., S. Shinoda, and K. Okamoto. 2003. Delivery of heat-stable enterotoxin of Escherichia coli to the exterior and the action of the toxin to induce diarrhea. Recent Res. Dev. Infect. Immun. 1:45-59.
53
53. Yamanaka, H., S. Tadokoro, M. Miyano, E. Takahashi, H. Kobayashi, and K. Okamoto. 2007. Studies on the region involved in the transport activity of Escherichia coli TolC by chimeric protein analysis. Microb. Pathog. 42:184-192.[CrossRef][Medline]

---

Journal of Bacteriology, December 2008, p. 7693-7698, Vol. 190, No. 23
0021-9193/08/$08.00+0     doi:10.1128/JB.00853-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Blair, J. M. A., La Ragione, R. M., Woodward, M. J., Piddock, L. J. V. (2009). Periplasmic adaptor protein AcrA has a distinct role in the antibiotic resistance and virulence of Salmonella enterica serovar Typhimurium. J Antimicrob Chemother 64: 965-972 [Abstract] [Full Text]  
• Rosner, J. L., Martin, R. G. (2009). An Excretory Function for the Escherichia coli Outer Membrane Pore TolC: Upregulation of marA and soxS Transcription and Rob Activity Due to Metabolites Accumulated in tolC Mutants. J. Bacteriol. 191: 5283-5292 [Abstract] [Full Text]  
• Arends, S. J. R., Kustusch, R. J., Weiss, D. S. (2009). ATP-Binding Site Lesions in FtsE Impair Cell Division. J. Bacteriol. 191: 3772-3784 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yamanaka, H. Articles by Okamoto, K. Search for Related Content PubMed PubMed Citation Articles by Yamanaka, H. Articles by Okamoto, K.