This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hussain, M. B. B. M.
Right arrow Articles by Zhang, L.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hussain, M. B. B. M.
Right arrow Articles by Zhang, L.-H.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2008, p. 1045-1053, Vol. 190, No. 3
0021-9193/08/$08.00+0     doi:10.1128/JB.01472-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

The Acyl-Homoserine Lactone-Type Quorum-Sensing System Modulates Cell Motility and Virulence of Erwinia chrysanthemi pv. zeae{triangledown}

Mumtaz B. B. M. Hussain,1,{dagger} Hai-Bao Zhang,1,{dagger} Jin-Ling Xu,1 Qiongguang Liu,2 Zide Jiang,2 and Lian-Hui Zhang1*

Institute of Molecular and Cell Biology, 61 Biopolis Drive, Singapore 138673,1 Department of Plant Pathology, South China Agricultural University, Guangzhou 510642, People's Republic of China2

Received 12 September 2007/ Accepted 20 November 2007


arrow
ABSTRACT
 
Erwinia chrysanthemi pv. zeae is one of the Erwinia chrysanthemi pathovars that infects on both dicotyledons and monocotyledons. However, little is known about the molecular basis and regulatory mechanisms of its virulence. By using a transposon mutagenesis approach, we cloned the genes coding for an E. chrysanthemi pv. zeae synthase of acyl-homoserine lactone (AHL) quorum-sensing signals (expIEcz) and a cognate response regulator (expREcz). Chromatography analysis showed that expIEcz encoded production of the AHL signal N-(3-oxo-hexanoyl)-homoserine lactone (OHHL). Null mutation of expIEcz in the E. chrysanthemi pv. zeae strain EC1 abolished AHL production, increased bacterial swimming and swarming motility, disabled formation of multicell aggregates, and attenuated virulence of the pathogen on potato tubers. The mutation also marginally reduced the inhibitory activity of E. chrysanthemi pv. zeae on rice seed germination. The mutant phenotypes were rescued by either exogenous addition of AHL signal or in trans expression of expIEcz. These data demonstrate that the AHL-type QS signal plays an essential role in modulation of E. chrysanthemi pv. zeae cell motility and the ability to form multicell aggregates and is involved in regulation of bacterial virulence.


arrow
INTRODUCTION
 
Erwinia chrysanthemi pv. zeae is the major pathogen responsible for bacterial stalk rot of maize around the world (20, 29, 31). The pathogen was also found to cause rice foot rot in Asian countries, including Japan, China, India, Indonesia, and South Korea (11, 17). E. chrysanthemi pv. zeae is a member of the pathovars of the gram-negative bacterium Erwinia chrysanthemi, which has been divided, on the basis of its pathogenicity on host plants and certain biochemical and physiological differences, into six pathovars: pv. chrysanthemi, pv. dianthicola, pv. dieffenbachiae, pv. paradisiaca, pv. parthenii, and pv. zeae (7). The variations among these pathovars were subsequently verified by molecular genetic analysis (20, 21). While the rationality of this pathovar classification is still under debate and a new scheme of classification has been proposed (29), in which E. chrysanthemi pv. zeae was delineated as a novel species, Dickeya zeae, the distinct status of E. chrysanthemi pv. zeae in different taxonomy schemes may reflect its unshakeable differences from other pathovars, which will hereby be collectively referred to as E. chrysanthemi strains for convenience and to be consistent with numerous previous studies. Recent constant outbreaks of rice foot rot disease caused by E. chrysanthemi pv. zeae have stirred serious concern (17); however, little is known about the molecular bases of its host specificity and the pathogenic mechanisms of this important pathovar of E. chrysanthemi.

Among the closely related bacterial pathogens, a few E. crysanthemi strains that infect dicotyledonous plants, such as strains EC3937 and EC16, have been characterized extensively at biochemical and genetic levels. They are known to cause the soft rot disease that is characterized by foul-smelling rot and eventual collapse of plant tissues. The pathogens produce a range of pectinases as key virulence factors which degrade various components of pectins (5, 15, 28), as well as other degradative enzymes such as cellulase isozymes, protease isozymes, xylanase, and phospholipase (5, 15, 28). In addition, the pigment indigoidine and the siderophores chrysobactin and achromobactin have been implicated in the bacterial systemic infections (8, 9, 27). Production of the pectate lyases is regulated by the transcriptional repressor KdgR, whose repression is released by the presence of pectin degradation products such as 2-keto-3-deoxygluconate (28). In addition, the acyl-homoserine lactone (AHL)-type quorum-sensing (QS) signals may be implicated in the regulation of virulence. The QS system of E. chrysanthemi includes the AHL-dependent transcription factor ExpR and an enzyme, ExpI, which is responsible for the synthesis of N-(3-oxo-hexanoyl)-homoserine lactone (OHHL) and N-hexanoyl-homoserine lactone (22). Of these two AHLs, OHHL is the most abundant and was thus postulated to be the most physiologically important QS signal in E. chrysanthemi (22). Mutation of the AHL synthase gene, expI, results in a decrease of some pectinase gene expression but does not seem to significantly change the total pectinase activity of the pathogen (22).

In our preliminary work, we found that E. chrysanthemi pv. zeae strain EC1, which was isolated from a rice plant showing typical foot rot symptoms, was able to cause infections on both dicotyledonous and monocotyledonous plants. In contrast, E. chrysanthemi strain EC3937, which infects dicot plants, did not cause any visible symptoms or adverse effect on rice plants. It is curious how well the AHL QS system is conserved and whether it plays a similar role in different pathovars of E. chrysanthemi. In this study, we identified the expR-expI homologues in E. chrysanthemi pv. zeae strain EC1 through transposon mutagenesis. We showed that disruption of the gene encoding AHL signal production results in significant changes in bacterial cell motility and in formation of cell aggregates and resulted in partially decreased bacterial virulence.


arrow
MATERIALS AND METHODS
 
Bacterial strains, culture media, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli was routinely maintained at 37°C in LB medium, which contains (per liter) 10 g Bacto tryptone, 5 g yeast extract, and 10 g NaCl (pH 7.0). E. chrysanthemi strains were either grown at 28°C in yeast extract broth (YEB), which contains (per liter) 10 g Bacto tryptone, 5 g yeast extract, 5 g sucrose, 5 g NaCl, and 1 mM MgSO4·7H2O (pH 7.0) or grown in minimal medium or in SOBG medium as indicated (33, 34). Antibiotics were added at the following concentrations when required: gentamicin, 25 µg/ml; and kanamycin, 100 µg/ml.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Strains and plasmids used in this study

Transposon mutagenesis. Transposon Tn5, carried by the suicide plasmid pRL27 in E. coli strain BW20767, was transferred into E. chrysanthemi pv. zeae strain EC1 by conjugation as previously described with minor revisions (16). Briefly, conjugal mating was performed by mixing overnight cultures of donor and recipient strains in about a 2:1 ratio onto LB agar plates and incubating them at 28°C for 6 h. Tn5 mutants were then selected on minimal medium agar plates containing kanamycin. These mutants were then screened for the defective phenotype in QS signal production using the AHL bioassay method described in the following section.

AHL bioassay. Agrobacterium tumefaciens NT1 containing a tra-lacZ fusion gene was used an AHL biosensor (24). Briefly, plates containing 20 ml of minimal agar medium supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal; 40 µg/ml) were used for the bioassay. The solidified medium was cut into separate slices (1 cm in width). An Erwinia colony was streaked to one end of an agar slice, and then the fresh cultures of the AHL biosensor strain at an optical density at 600 nm (OD600) of {approx}0.1 were spotted at progressively further distances from the Erwinia bacteria. The plates were incubated at 28°C for 24 h. The blue spots of the AHL biosensor indicated the AHL activity (6). The AHL signals from liquid culture were extracted and concentrated as described previously (14), and chromatography analyses were performed following the method described previously (30). The standard AHL molecules used in this study were synthesized and purified as described previously (35).

DNA cloning and sequencing. The DNA fragment containing a Tn5 insert was cloned by using the plasmid rescue approach described previously (16). The genomic DNAs of the mutants were extracted with the MasterPure DNA purification kit (EPICENTRE Biotechnologies), digested with BamHI, and ligated using T4 DNA ligase. The ligation mixture was transformed into E. coli DH5{alpha}/{lambda}pir, and the transformants containing Tn5 plasmids were selected on LB agar supplemented with 100 µg/ml kanamycin. The flanking regions of the Tn5 insert were sequenced using three primers, with two designed based on the Tn5 sequence (16)—i.e., tpnRL17-1 (5'-AACAAGCCAGGGATGTAACG) and tpnRL13-2 (5'-CAGCAACACCTTCTTCACGA)—and one primer, ExpR1 (5'-CCCATACTTGCCCAGTAGAG), designed based on the sequence information.

Complementation of the AHL-deficient mutants of strain EC1. Primers ExpIB1 (5'-CGGGATCCTCACCAGGTGAGCTATTGCG) and ExpIB2 (5'- CGGAATTCGCTTGGGGTTGAAATGAACC) were designed based on sequence data of expIEcz and used to amplify its coding region. The PCR product was then subjected to BamHI and EcoRI digestion, as was the plasmid expression vector pDSK-Genr. The digested PCR product and vector were then purified and ligated in such a way that the coding region of expI was placed under the control of the lac promoter carried by the vector. The ligation mixture was transferred to E. coli, and transformations were selected on LB agar supplemented with 25 µg/ml gentamicin and confirmed by DNA sequencing. The corresponding complemented strains of WM3, WM6, and WM8 were generated by conjugal triparental mating, and the transformants were selected on minimal medium agar plates supplemented with 100 µg/ml kanamycin and 25 µg/ml gentamicin. The resultant strains, WM3expI, WM6expI, and WM8expI, were confirmed by PCR and phenotype analysis.

Swimming, swarming, and cell aggregation assay. For determination of swimming motility, the plate containing about 20 ml of semisolid Bacto tryptone agar medium (per liter contains 10 g Bacto tryptone, 5 g NaCl, 3 g agar) supplemented with X-Gal (40 µg/ml) was either spotted with bacteria using a toothpick or inoculated with 1 µl of an overnight bacterial culture. The plates were incubated at 28°C for 6 h, and the diameter of the bacterial zone was measured. The swarming motility was assayed under the same conditions, except for the medium, which contains (per liter) 5 g peptone, 3 g yeast extract, and 4 g agar. The experiment was repeated three times in triplicates.

For observation of cell aggregation, overnight start cultures of strain EC1 and its derivatives were diluted to an OD600 of 0.5 and 50 µl of each bacterial dilution was added to a 50-ml Falcon tube containing 10 ml of fresh LB medium. The tubes were incubated at 28°C with shaking at 250 rpm for 6 h before microscopy examination.

Pathogenicity assay. Potato (Solanum tuberosum L. var. Bintje) tubers were obtained from local stores. After being washed with tap water and dried on a paper towel, potato tubers were surfaced sterilized with 70% ethanol and then sliced evenly about 5 mm in thickness. Each slice was then placed in a petri dish lined with Whatman no. 3 filter paper moistened with sterilized water. Bacterial cells (2 µl at an OD600 of 1.2) were added to the center of the sliced potato tuber after piercing it with a pipette tip. The potato tubers were then incubated at 28°C for 24 h. The potato tubers were observed regularly for symptom development. Each assay was repeated three times with triplicate determinations each time.

Rice seed germination assay. Overnight bacterial cultures were diluted in 10-fold series, and the CFU (defined as the number of viable cells per ml) of each dilution was determined using heterotrophic plate counting assay (14). Fifty seeds of rice variety Texian 13 were added to 20 ml of a bacterial dilution and incubated at room temperature for 5 h. The rice seeds were then washed three times with sterilized water and transferred onto two moistened Whatman paper no. 3 filter papers in a petri dish. The seeds were then incubated at 28°C under 16-h-light-8-h-dark conditions, and sterilized water was added when necessary. Rice seeds were incubated with same amount of sterilized water as a blank control. The rate of seed germination was determined 1 week after treatment. The experiment was repeated four times with triplicates. The presented data were normalized based on the corresponding bacterial CFU.

Assay for exoenzymes. The cellulose enzyme activity was determined by plate assay. Briefly, 5 µl of fresh bacterial culture at an OD600 around 1.5 was spotted onto a LB agar plate containing 0.5% carboxymethylcellulose as a substrate. After 24 h of incubation at 30°C, the plate was flooded with 0.1% aqueous Congo red (Sigma) for 15 min and then washed with 1 M NaCl three times. The Congo red-stained carboxymethylcellulose became red, and the clearing zone around the bacterial colony indicated the cellulase activity. For assay of protease and pectinase, the bacterial supernatants were obtained by centrifugation and were filter sterilized. The pectate lyase activity and proteolytic enzyme activity were determined using polygalacturonic acid and azocasein as substrates, respectively, following the methods described previously (2, 4).

Nucleotide sequence accession number. The nucleotide sequence obtained in this study has been deposited in the GenBank database under accession no. EU142019.


arrow
RESULTS
 
Screening of the E. crysanthemi pv. zeae mutants defective in AHL production. Similar to the well-characterized E. chrysanthemi strain EC3937 (22), the rice pathogen E. chrysanthemi pv. zeae strain EC1 produced detectable AHL signals as indicated by the AHL-biosensor strain Agrobacterium tumefaciens NT1 (traR tra::lacZ749) (Fig. 1), in which the lacZ gene encoding a β-galactosidase is under the control of an AHL-dependent promoter (24). Tn5 transposon mutagensis was then used to identify the genes involved in AHL production. Mutants showing altered AHL production were selected. Out of the 15,000 mutants screened, three transposon mutants, designated as WM3, WM6, and WM8, showed an absence of AHL production (Fig. 1).


Figure 1
View larger version (59K):
[in this window]
[in a new window]

 
FIG. 1. Mutation of the expIEcz gene of E. chrysanthemi pv. zeae strain EC1 abolished AHL signal production. (A) Diffusion plate assay of AHL QS signal production by strain EC1 and its derivatives. Strain EC1 and its derivatives were streaked separately on the top of the agar bar. The AHL biosensor strain A. tumefaciens NT1(traR tra::lacZ749) was spotted on the rest of the agar bar. The biosensor spots turned blue in the presence of AHL signals. (B) Characterization of the AHL signals produced by strain EC1 using thin-layer chromatography. Synthetic OHHL was spotted as a standard control.

For identification of the AHL signals produced by E. chrysanthemi pv. zeae, the overnight cultures of strain EC1 and its mutant WM3 were extracted by ethyl acetate as described previously (14). The organic solvent in each extract was evaporated, and the signal was dissolved in methanol as a 200x concentrate. Thin-layer chromatography analysis showed that strain EC1 produced one AHL signal in a position corresponding to OHHL (Fig. 1). In agreement with the results of the plate assay, no OHHL signal was detected from the extracts from the mutant WM3 (Fig. 1).

Cloning and sequence analysis of the luxI and luxR homologues from E. chrysanthemi pv. zeae strain EC1. The Tn5 insertion flanking regions from three mutants were cloned and sequenced. Sequence analysis showed that Tn5 was inserted respectively in bp 172 (WM3) and 265 (WM6 and WM8) of an open reading frame (ORF). Comparison of the DNA sequence of this ORF using BLAST revealed about 86% identity with the expI of E. chrysanthemi strain 3937 (NCBI accession no. X96440), which codes for QS signal OHHL biosynthesis (22). This ORF was thus designated as expIEcz. At the peptide level, ExpIEcz shares about 92% identity with the ExpI of E. chrysanthemi strain 3937.

Further sequencing the downstream of expI revealed another ORF (Fig. 2A). A BLAST search found that this ORF, designated expREcz, shares 85.9% identity with the expR gene of E. chrysanthemi strain 3937 (22). In addition to high sequence similarity, the expRIecz gene of E. chrysanthemi pv. zeae strain EC1 also shares the same genome organization with the expRI of E. chrysanthemi (22). The expIEcz and expREcz genes are oppositely oriented with 33 bp overlapped at the 3' end of the genes (Fig. 2A and B). The promoter elements, including the –10 and –35 regions, and the ribosome binding site were identified in the corresponding promoter regions of the two genes. A putative lux box, which is the binding site of LuxR-type transcription factors (24, 32), was found at the region close to the –35 element in the promoter of expREcz. No lux box was found in the promoter of expIEcz. Instead, two putative lux box sequences were found in the 5' region of the expIEcz coding sequence (Fig. 2B).


Figure 2
View larger version (56K):
[in this window]
[in a new window]

 
FIG. 2. Physical map and sequence analysis of the DNA fragment containing the genes involved in AHL QS signal biosynthesis and regulation. (A) Physical map of the 2.3-kb fragment containing the expIEcz and expREcz genes. The transposon insertion sites in the AHL-deficient mutants WM3, WM6, and WM8 are marked by vertical arrows. The direction of transcription is indicated by horizontal arrows. (B) Nucleotide sequences of expIEcz and expREcz and the predicted peptide products. The predicted ribosomal binding sites (RB) and putative promoter elements are indicated by boldface type and underlines. The predicted lux box consensus sequences were boxed.

Overexpression of expIEcz in the AHLFormula mutants restored the QS signal production. The wild-type expIEcz was then cloned from the E. chrysanthemi pv. zeae strain EC1 by PCR amplification. For the complementation test, the gene was placed under the control of the lac promoter in expression vector pDSK-Genr. The resultant construct was introduced into the mutants WM3, WM6, and WM8 separately. Bioassay results showed that AHL produced in the three mutants was fully restored (Fig. 1), demonstrating that expIEcz is the gene responsible for AHL production in strain EC1.

Mutation of expIEcz drastically enhanced bacterial swimming and swarming motility. E. chrysanthemi pv. zeae strain EC1 appeared blue on the medium containing X-Gal (Fig. 1), presumably due to production of β-galactosidase. This property was used to improve the visibility of EC1 cells on the swimming assay plate. The results showed that the three expIEcz mutants had a significantly increased swimming motility compared to wild-type EC1 (Fig. 3A). The swimming motility was restored to the wild-type level in the corresponding complemented strains WM3expI, WM6expI, and WM8expI, which expressed the expIEcz gene in trans.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 3. Mutation of the gene encoding AHL biosynthesis enhanced EC1 swimming motility. (A) Swimming distance of strain EC1 and its derivatives. (B) Swimming motility of EC1 and its AHL-deficient mutants in the absence (open bars) and presence (filled bars) of 2 µM OHHL. (C) Swarming motility of EC1 and its derivatives in the absence (open bars) and presence (filled bars) of 2 µM OHHL.

To determine if exogenous OHHL was able to modulate the bacterial swimming motility, the swimming assay was performed in the presence or absence of the OHHL signal. The results showed that addition of 2 µM OHHL was able to decrease the swimming motility of the mutants to the level of wild-type strain EC1 (Fig. 3B).

Similarly, mutation of expI resulted in drastically increased swarming motility. The mutant WM3 phenotype was restored to the wild-type level by either expression of expIEcz in trans or exogenous addition of OHHL (Fig. 3C).

AHL signal-induced formation of cell aggregates in E. chrysanthemi pv. zeae liquid culture. Bacteria swim and swarm by rotating their flagella. Electron microscopy analysis, however, did not reveal obvious differences in flagellar location and number when the wild-type strain, EC1, was compared with its AHL-deficient mutants. Interestingly, however, close examination by the naked eye found that strain EC1 grown in LB medium produced many cell clumps in liquid culture, even under vigorous shaking conditions, whereas no visible cell clumps were noticed in the culture of its AHL-deficient mutants throughout bacterial growth. Microscopy analysis confirmed the formation of multicell aggregates by strain EC1 and the planktonic living status of the AHL-deficient mutant WM3 bacterial cells (Fig. 4). For quantitative comparison, microscope counting was used to determine the total numbers of cell aggregates in 10 randomly selected fields of vision. While none was found in WM3 culture, strain EC1 on average had about seven multicell aggregates per field of vision, with each aggregate containing at least a few hundred cells 50 to 100 µm in diameter. The findings suggest that AHL QS signal might induce the formation of E. chrysanthemi pv. zeae cell aggregates. The speculation was confirmed by either addition of 2 µM exogenous OHHL to WM3 culture (data not shown) or in trans expression of the OHHL synthase gene expIEcz in the mutant WM3 (Fig. 4). Microscope observation also found that the planktonic cells were swimming rapidly and constantly, whereas cell aggregates were virtually standing still.


Figure 4
View larger version (88K):
[in this window]
[in a new window]

 
FIG. 4. AHL signal induced the formation of cell aggregates by E. chrysanthemi pv. zeae. Bacterial strains were grown at 28°C with shaking in LB (top) or SOBG (bottom) medium for 6 h. Photos were taken at x400 under an Olympus BX50 microscope.

We then tested the formation of cell aggregates in SOBG medium, which supports the type III secretion system-dependent pellicle formation of E. chrysanthemi in stationary culture (33). Under the same stationary conditions, both EC1 and its QS-defective mutant form similar pellicles, except that the mutant pellicles appeared slightly thinner than those of the wild type (data not shown). The difference between the wild type and its mutant became obvious when bacteria were grown under shaking conditions. Although unlike in LB medium, mutation of expIEcz did not completely abolish cell aggregate formation, EC1 and the complemented strain WM3expI formed significantly bigger cell aggregates (~200 to 300 µm in diameter) than the mutant WM3 (~50 to 80 µm in diameter) (Fig. 4). These data, together with the size difference of the cell aggregates formed in LB and SOBG media (50 to 100 µm versus 200 to 300 µm) and the previous findings that a functional type III secretion system is required for the pellicle but not for biofilm formation by E. chrysanthemi (33), suggest that several pathways may be involved in the formation of the E. chrysanthemi pv. zeae cell aggregates in SOBG medium, including the one regulated by OHHL signals.

AHL-deficient mutants showed partially decreased virulence against potato tubers. The ability of strain EC1 and the AHL-deficient mutants to cause maceration in potato tubers was investigated. Similar to E. chrysanthemi strain EC3937 (Fig. 5B), which is known to cause infections in dicot plants, E. chrysanthemi pv. zeae strain EC1 could also cause soft rot symptoms on potato tubers (Fig. 5A). When inoculated on potato tubers, the AHL-deficient mutants WM3 (Fig. 5C) and WM6 (Fig. 5E) caused smaller maceration zones than the wild-type strain EC1 and their corresponding complemented strains (Fig. 5D and F). In addition, the mutant-infected plant tissues generated less tissue fluid in the vicinity of maceration than those infected by the wild type and the complemented strains.


Figure 5
View larger version (95K):
[in this window]
[in a new window]

 
FIG. 5. AHL-deficient mutants showed attenuated soft rot syptoms on potato tubers. Each cut tuber was inoculated with 2 µl of fresh bacterial cells at an OD600 of 1.2. The bacterial strains inoculated were EC1 (A), EC3937 (B), WM3 (C), WM3expI (D), WM6 (E), and WM6expI (F). Photographs were taken 24 h after incubation at 28°C. The experiment was repeated three times with similar results. The photographs show a set of representative samples.

Mutation of expIEcz marginally decreased the bacterial ability to inhibit rice seed germination. Given that the major impact of pathovar E. chrysanthemi pv. zeae on rice is the inhibition of rice seed germination (17), we compared the pathogenic effects of E. chrysanthemi strain EC3937 and E. chrysanthemi pv. zeae strain EC1 on rice seeds. In each treatment, 50 rice seeds were placed in a 20-ml bacterial solution (106 CFU bacterial cells per ml) for 5 h at room temperature before washing and letting seeds germinate. Treatment of rice seeds with EC1 resulted in total inhibition of rice seed germination, whereas under the same conditions the E. chrysanthemi strain EC3937 did not show any detectable inhibitory effect (Fig. 6A). The QS mutant WM3, however, also completely inhibited the rice seeds' germination when the same inoculum concentration was used (Fig. 6B).


Figure 6
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 6. E. chrysanthemi pv. zeae inhibited rice seed germination. (A) Rice seedling symptoms after treatment with strains EC1 and EC3937 (106 CFU of bacterial cells per ml), respectively. Water was used as a control. The photo was taken 1 week after treatment. (B) Quantitative comparison of the rice seed germination inhibitory activities of EC1 and its derivatives. In each treatment, 50 rice seeds were added to a tube containing 20 ml of bacterial suspension containing a certain number of bacterial cells as indicated. The mixtures were incubated at room temperature for 5 h before washing. The washed seeds were then transferred to a clean plate with moisturized filter papers and incubated at 28°C under 16-h-light-8-h-dark conditions. The rate of germination was determined 1 week later.

To analyze potential quantitative differences, we prepared a series of dilutions of bacterial cultures with water and determined the abilities of different bacterial strains to inhibit rice seed germination. While E. chrysanthemi strain EC3937 had no effect on rice seed germination regardless of inoculated bacterial cell numbers (data not shown), surprisingly, E. chrysanthemi pv. zeae strain EC1 showed an unusual strong inhibitory ability even at an inoculum concentration as low as 1 viable cell per ml (Fig. 6). This was somewhat unexpected because under this condition, the ratio of seeds to viable bacterial cells was 5:2. Plausible explanations are that the pathogen could proliferate during incubation by utilizing the nutrients from rice seeds and that more bacterial cells survived on rice seeds than on the LB agar plates used for counting the bacterial CFU. Mutation of the expIEcz gene in E. chrysanthemi pv. zeae strain EC1 only had a marginal effect on its inhibitory activity against rice seed germination. Unlike E. chrysanthemi strain EC3937, the mutant WM3 at a low concentration of 100 CFU still provided full inhibition of rice seed germination. The difference between WM3 and its wild type, EC1, in germination inhibition became obvious only when the bacterial cell numbers were diluted to less than 10 CFU (Fig. 6). In contrast, the inhibitory effect of the complemented strain WM3expI was basically indistinguishable from that of wild-type strain EC1 regardless of inoculum concentration (Fig. 6).

Mutation of expIEcz did not significantly reduce the production of exoenzymes. As exoenzymes are common virulence factors of many plant bacterial pathogens, we tested whether disruption of E. chrysanthemi pv. zeae QS signaling affected the production of exoenzymes. The mutant WM3 showed comparable activities of protease (7.7 ± 1.4 U/ml) and pectate lyase (0.036 ± 0.005 U/ml) to those of EC1 (7.8 ± 1.1 U/ml and 0.040 ± 0.004 U/ml, respectively). Similarly, WM3 and EC1 generated indistinguishable cellulose activities based on the almost identical sizes of clear zones in the plate assay (data not shown).


arrow
DISCUSSION
 
Our research aims were to identify the QS genes of E. chrysanthemi pv. zeae and to determine their potential roles in regulation of the bacterial physiology and pathogenesis. In this study, we cloned and sequenced the expIEcz and expREcz genes, which encode an AHL synthase and the corresponding AHL-dependent transcription factor (Fig. 2), respectively. We showed that mutation of expIEcz in E. chrysanthemi pv. zeae strain EC1 abolished the production of AHL QS signal OHHL (Fig. 1), markedly increased swimming and swarming motility (Fig. 3), eliminated formation of cell aggregates in LB medium (Fig. 4), and partially attenuated bacterial virulence (Fig. 5 and 6). The AHL QS system has been characterized in several E. chrysanthemi strains (3), but its role in regulation of bacterial behaviors has not been clearly established. Inactivation of the expI gene in E. chrysanthemi strain EC3937 results in decreased expression of some pectinase genes, but the role of the QS system in bacterial physiology remains elusive (22, 26). Similarly, mutation of the same gene in E. chrysanthemi strain EC16 has no apparent effect on its virulence in witloof chicory leaves (13). To our knowledge, the data from this study show for the first time that the AHL QS system of E. chrysanthemi pv. zeae controls several obvious phenotypes, illustrating its role in modulation of bacterial physiology and virulence.

E. chrysanthemi pv. zeae appears to be different from other gram-negative bacterial strains in the mode of QS regulation of bacterial motility. In other bacterial organisms, null mutation of AHL biosynthesis or enzymatic degradation of AHL signal in bacteria either has no effect on swimming motility, as in the case of Pseudomonas aeruginosa (25), or results in decreased swimming and swarming motility, such as in Yersinia enterocolitica (1). In contrast, inactivation of AHL-synthase gene expIEcz in the bacterial pathogen E. chrysanthemi pv. zeae resulted in a hypermotile phenotype, which was restored to the wild-type level by exogenous addition of AHL signals (Fig. 3). Interestingly, mutation of expIEcz also drastically changed the growth pattern of E. chrysanthemi pv. zeae by shifting from the multicell aggregate form of the wild-type strain to the planktonic form of the mutants (Fig. 4). This changed growth pattern of the AHL-deficient mutants could largely, if not entirely, account for their hypermotile phenotype, as flagellar rotation in cell aggregates could be severely restricted.

Our data show that the decreased virulence of the AHL-deficient mutants is unlikely due to altered exoenzyme production as EC1 and its mutants displayed similar activities of proteases, pectinases, and cellulases. However, the increased motility and reduced ability to form multicell aggregates of the AHL-deficient mutants of E. chrysanthemi pv. zeae seem to be consistent with their decreased virulence phenotype (Fig. 3 to 6). Previous studies suggest that both motility and the ability to form multicell aggregates might contribute to bacterial colonization or virulence (1, 18, 19, 23). The hypermotile mutants of Vibrio fischeri are significantly delayed in colonization of host organism (18). The ability to form multicell aggregates enhances the bacterial survival on host plants under various environmental conditions (19). It was also noted that conditions that promote virulence gene expression may become unfavorable to the expression of motility genes (23). Culture of Salmonella enterica on motility agar plates significantly induces the expression of the virulence gene but at the same time down-regulates the expression of flagellar genes. This regulation is mediated by SirA, a two-component response regulator of the FixJ family (23). Further investigation of AHL-regulated bacterial motility and aggregation at genetic and genomic levels would be important to delineate the molecular mechanisms of their association with E. chrysanthemi pv. zeae virulence.

The QS system of E. chrysanthemi pv. zeae seems to share a similar evolutionary origin to that of its closely related E. chrysanthemi pathovars (12). The notion is supported by several lines of evidence. First, the expIEcz-expREcz gene region is highly homologous (86%) at the nucleotide level to the expI-expR DNA fragment of E. chrysanthemi strain EC3937 (22). Second, while the orientation of the two genes in the strain EC1 genome differs from that of the luxI-luxR operon of marine bacterium Vibro fischeri (NCBI accession no. Y00509), it is similar to those of E. chrysanthemi strain EC3937 (NCBI accession no. X96440) as well as other Erwinia species (10). Third, similar to strain EC3937, in which null mutation of expI only causes a slight decrease in transcriptional expression of some pectinase genes but does not change the overall pectinase activity (22), inactivation of expIEcz in strain EC1 also did not significantly affect its total pectate lyase activity.

It is interesting to note the sharp contrast in virulence of E. chrysanthemi pv. zeae and the reference strain E. chrysanthemi EC3937 on dicots and monocots. E. chrysanthemi pv. zeae strain EC1 produced similar symptoms to E. chrysanthemi strain EC3937 on dicoteledonous plants (Fig. 5), but it differed from the E. chrysanthemi strain in its strong virulence on rice seeds (Fig. 6). At an inoculum concentration as low as 1 CFU per ml, strain EC1 still caused about 90% inhibition of rice seed germination. In sharp contrast, under the conditions used in this study E. chrysanthemi strain EC3937 did not show any inhibitory effect on rice seeds, which germinated normally even in the presence of 106 CFU of the pathogen per ml (Fig. 6). Intriguingly, the AHL-defective mutants of E. chrysanthemi pv. zeae showed only a marginal decrease in inhibitory activity against rice seed germination. Albeit the mechanism remains unknown, these data taken together suggest E. chrysanthemi pv. zeae may differ from the other E. chrysanthemi pathovars by producing a unique virulence factor(s) responsible for the strong inhibitory activity against rice seed germination and that production of this virulence factor(s) may not or only partially depend on the AHL-type QS system identified in this study.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Michael San Francisco, Pablo Rodríguez Palenzuela, and Amy Charkowski for providing E. chrysanthemi strains and to Dominique Expert, Guy Condemine, and Sylvie Reverchon for advice on taxonomy of E. chrysanthemi strains. We also thank Raymond M. H. Teng for providing excellent technical assistance with chromatography analysis and Jane S. H. Cheong and Joyce C. H. Loh for help with screening and preliminary characterization of transposon mutants.

Funding was provided by the Agency of Science, Technology and Research (A*Star), Singapore.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Molecular and Cell Biology, 61 Biopolis Drive, Singapore 138673. Phone: 65-6586 9686. Fax: 65-6779 1117. E-mail: lianhui{at}imcb.a-star.edu.sg Back

{triangledown} Published ahead of print on 14 December 2007. Back

{dagger} M. B. B. M. Hussain and H.-B. Zhang contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Atkinson, S., C.-Y. Chang, R. E. Sockett, M. Cámara, and P. Williams. 2006. Quorum sensing in Yersinia enterocolitica controls swimming and swarming motility. J. Bacteriol. 188:1451-1461.[Abstract/Free Full Text]
  2. 2
  3. Caldas, C., A. Cherqui, A. Pereira, and N. Simões. 2002. Purification and characterization of an extracellular protease from Xenorhabdus nematophila involved in insect immunosuppression. Appl. Environ. Microbiol. 68:1297-1304.[Abstract/Free Full Text]
  4. 3
  5. Castang, S., S. Reverchon, P. Gouet, and W. Nasser. 2006. Direct evidence for the modulation of the activity of the Erwinia chrysanthemi quorum-sensing regulator ExpR by acylhomoserine lactone pheromone. J. Biol. Chem. 281:29972-29987.[Abstract/Free Full Text]
  6. 4
  7. Chatterjee, A. K., K. K. Thurn, and D. J. Tyrell. 1985. Isolation and characterization of Tn5 insertion mutants of Erwinia chrysanthemi that are deficient in polygalacturonate catabolic enzymes oligogalacturonate lyase and 3-deoxy-D-glycero-2,5-hexodiulosonate dehydrogenase. J. Bacteriol. 162:708-714.[Abstract/Free Full Text]
  8. 5
  9. Collmer, A., and D. W. Bauer. 1994. Erwinia chrysanthemi and Pseudomonas syringae: plant pathogens trafficking in extracellular virulence proteins. Curr. Top. Microbiol. Immunol. 192:43-78.[Medline]
  10. 6
  11. Dong, Y. H., J. L. Xu, X. Z. Li, and L. H. Zhang. 2000. AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of Erwinia carotovora. Proc. Natl. Acad. Sci. USA 97:3526-3531.[Abstract/Free Full Text]
  12. 7
  13. Dye, D. W., J. F. Bradbury, M. Goto, A. C. Hayward, R. A. Lelliott, and M. N. Schroth. 1980. International standards for naming pathovars of phytopathogenic bacteria and a list of pathovar names and pathotype strains. Rev. Plant Pathol. 59:153-168.
  14. 8
  15. Enard, C., A. Diolez, and D. Expert. 1988. Systemic virulence of Erwinia chrysathemi 3937 requires a functional iron assimilation system. J. Bacteriol. 170:2419-2426.[Abstract/Free Full Text]
  16. 9
  17. Enard, C., and D. Expert. 2000. Characterization of a tonB mutation in Erwinia chrysanthemi 3937: TonBEch is a member of the enterobacterial TonB family. Microbiology 146:2051-2058.[Abstract/Free Full Text]
  18. 10
  19. Goodier, R. I., and B. M. M. Ahmer. 2001. SirA orthologs affect both motility and virulence. J. Bacteriol. 183:2249-2258.[Abstract/Free Full Text]
  20. 11
  21. Goto, M. 1979. Bacterial foot rot of rice caused by a strain of Erwinia chrysanthemi. Phytopathology 69:213-216.
  22. 12
  23. Gray, K. M., and J. R. Garey. 2001. The evolution of bacterial LuxI and LuxR quorum sensing regulators. Microbiology 147:2379-2387.[Abstract/Free Full Text]
  24. 13
  25. Ham, J. H., Y. Cui, J. R. Alfano, P. Rodriguez-Palenzuela, C. M. Rojas, A. K. Chatterjee, and A. Collmer. 2004. Analysis of Erwinia chrysanthemi EC16 pelE::uidA, pel::uidA, and hrpN::uidA mutants reveals strain-specific atypical regulation of the Hrp type III secretion system. Mol. Plant-Microbe Interact. 17:184-194.[Medline]
  26. 14
  27. Hu, J. Y., F. Yang, Y. H. Lin, H. B. Zhang, S. L. Ong, N. Dong, J. L. Xu, W. J. Ng, and L. H. Zhang. 2003. Microbial diversity and prevalence of virulent pathogens in biofilms developed in a water reclamation system. Res. Microbiol. 154:623-629.[Medline]
  28. 15
  29. Hugouvieux-Cotte-Pattat, N., G. Condemine, W. Nasser, and S. Reverchon. 1996. Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Microbiol. 50:213-257.[CrossRef][Medline]
  30. 16
  31. Larsen, R. A., M. M. Wilson, A. M. Guss, and W. W. Metcalf. 2002. Genetic analysis of pigment biosynthesis in Xanthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is functional in a wide variety of bacteria. Arch. Microbiol. 178:193-201.[CrossRef][Medline]
  32. 17
  33. Liu, Q. G., and Z. Z. Wang. 2004. Infection characteristics of Erwinia chrysanthemi pv. zeae on rice. J. S. China Agric. Univ. 25:55-57.
  34. 18
  35. Millikan, D. S., and E. G. Ruby. 2002. Alterations in Vibrio fischeri motility correlate with a delay in symbiosis initiation and are associated with additional symbiotic colonization defects. Appl. Environ. Microbiol. 68:2519-2528.[Abstract/Free Full Text]
  36. 19
  37. Monier, J. M., and S. E. Lindow. 2003. Differential survival of solitary and aggregated bacterial cells promotes aggregate formation on leaf surfaces. Proc. Natl. Acad. Sci. USA 100:15977-15982.[Abstract/Free Full Text]
  38. 20
  39. Nassar, A., Y. Bertheau, C. Dervin, J.-P. Narcy, and M. Lemattre. 1994. Ribotyping of Erwinia chrysanthemi strains in relation to their pathogenic and geographic distribution. Appl. Environ. Microbiol. 60:3781-3789.[Abstract/Free Full Text]
  40. 21
  41. Nassar, A., A. Darrasse, M. Lemattre, A. Kotoujansky, C. Dervin, R. Vedel, and Y. Bertheau. 1996. Characterization of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and restriction fragment length polymorphism analysis of PCR-amplified fragments of pel genes. Appl. Environ. Microbiol. 62:2228-2235.[Abstract]
  42. 22
  43. Nasser, W., M. L. Bouillant, G. Salmond, and S. Reverchon. 1998. Characterization of the Erwinia chrysanthemi expI-expR locus directing the synthesis of two N-acyl-homoserine lactone signal molecules. Mol. Microbiol. 29:1391-1405.[CrossRef][Medline]
  44. 23
  45. Otteman, K. M., and J. F. Miller. 1997. Roles for motility in bacterial-host interactions. Mol. Microbiol. 24:1109-1117.[CrossRef][Medline]
  46. 24
  47. Piper, K. R., S. Beck von Bodman, and S. K. Farrand. 1993. Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362:448-450.[CrossRef][Medline]
  48. 25
  49. Reimmann, C., N. Ginet, L. Michel, C. Keel, P. Michaux, V. Krishnapillai, M. Zala, K. Heurlier, K. Triandafillu, H. Harms, G. Défago, and D. Haas. 2002. Genetically programmed autoinducer destruction reduces virulence gene expression and swarming motility in Pseudomonas aeruginosa PAO1. Microbiology 148:923-932.[Abstract/Free Full Text]
  50. 26
  51. Reverchon, S., M. L. Bouillant, G. Salmond, and W. Nasser. 1998. Integration of the quorum-sensing system in the regulatory networks controlling virulence factor synthesis in Erwinia chrysanthemi. Mol. Microbiol. 29:1407-1418.[CrossRef][Medline]
  52. 27
  53. Reverchon, S., C. Rouanet, D. Expert, and W. Nasser. 2002. Characterization of indigoidine biosynthetic genes in Erwinia chrysanthemi and role of this blue pigment in pathogenicity. J. Bacteriol. 184:654-665.[Abstract/Free Full Text]
  54. 28
  55. Robert-Baudouy, J., W. Nasser, G. Condemine, S. Reverchon, V. E. Shevchik, and N. Hugouvieux-Cotte-Pattat. 2000. Pectic enzymes of Erwinia chrysanthemi, regulation and role in pathogenesis, p. 221-268. In G. Stacay and N. T. Keen (ed.), Plant-microbe interactions, vol 5. APS Press, St. Paul, MN.
  56. 29
  57. Samson, R., J. B. Legendre, R. Christen, W. Achouak, and L. Gardan. 2005. Transfer of Pectobacterium chrysanthemi (Burkholder et al. 1953) Brenner et al. 1973 and Brenneria paradisiaca to the genus Dickeya gen. nov. as Dickeya chrysanthemi comb. nov. and Dickeya paradisiaca comb. nov. and delineation of four novel species: Dickeya dadantii sp. nov., Dickeya dianthicola sp. nov., Dickeya dieffenbachiae sp. nov., and Dickeya zeae sp. nov. Int. J. Syst. Evol. Microbiol. 55:1415-1427.[Abstract/Free Full Text]
  58. 30
  59. Shaw, P. D., G. Ping, S. L. Daly, C. Cha, J. E. Cronan, Jr., K. L. Rinehart, and S. K. Farrand. 1997. Detecting and characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography. Proc. Natl. Acad. Sci. USA 94:6036-6041.[Abstract/Free Full Text]
  60. 31
  61. Sinha, S. K., and M. Prasad. 1977. Bacterial stalk rot of maize, its symptoms and host-range. Zentbl. Bakteriol. Parasitenkd. Infektkrankh. Hyg. 132:81-88.
  62. 32
  63. Stevens, A. M., and E. P. Greenberg. 1997. Quorum sensing in Vibrio fischeri: essential elements for activation of the luminescence genes. J. Bacteriol. 179:557-562.[Abstract/Free Full Text]
  64. 33
  65. Yap, M.-N., C.-H. Yang, J. D. Barak, C. E. Jahn, and A. O. Charkowski. 2005. The Erwinia chrysanthemi type III secretion system is required for multicellular behavior. J. Bacteriol. 187:639-648.[Abstract/Free Full Text]
  66. 34
  67. Zhang, L., and A. Kerr. 1991. A diffusible compound can enhance conjugal transfer of the Ti plasmid in Agrobacterium tumefaciens. J. Bacteriol. 173:1867-1872.[Abstract/Free Full Text]
  68. 35
  69. Zhang, L. H., P. J. Murphy, A. Kerr, and M. E. Tate. 1993. Agrobacterium conjugation and gene regulation by N-acyl-homoserine lactones. Nature 362:446-447.[CrossRef][Medline]


Journal of Bacteriology, February 2008, p. 1045-1053, Vol. 190, No. 3
0021-9193/08/$08.00+0     doi:10.1128/JB.01472-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Khajanchi, B. K., Sha, J., Kozlova, E. V., Erova, T. E., Suarez, G., Sierra, J. C., Popov, V. L., Horneman, A. J., Chopra, A. K. (2009). N-Acylhomoserine lactones involved in quorum sensing control the type VI secretion system, biofilm formation, protease production, and in vivo virulence in a clinical isolate of Aeromonas hydrophila. Microbiology 155: 3518-3531 [Abstract] [Full Text]  
  • Chandler, J. R., Duerkop, B. A., Hinz, A., West, T. E., Herman, J. P., Churchill, M. E. A., Skerrett, S. J., Greenberg, E. P. (2009). Mutational Analysis of Burkholderia thailandensis Quorum Sensing and Self-Aggregation. J. Bacteriol. 191: 5901-5909 [Abstract] [Full Text]  
  • Gurich, N., Gonzalez, J. E. (2009). Role of Quorum Sensing in Sinorhizobium meliloti-Alfalfa Symbiosis. J. Bacteriol. 191: 4372-4382 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hussain, M. B. B. M.
Right arrow Articles by Zhang, L.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hussain, M. B. B. M.
Right arrow Articles by Zhang, L.-H.