This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paredes-Sabja, D.
Right arrow Articles by Sarker, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paredes-Sabja, D.
Right arrow Articles by Sarker, M. R.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2008, p. 1190-1201, Vol. 190, No. 4
0021-9193/08/$08.00+0     doi:10.1128/JB.01748-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Clostridium perfringens Spore Germination: Characterization of Germinants and Their Receptors{triangledown}

Daniel Paredes-Sabja,1,2 J. Antonio Torres,2 Peter Setlow,4 and Mahfuzur R. Sarker1,3*

Departments of Biomedical Sciences,1 Food Science and Technology,2 Microbiology, Oregon State University, Corvallis, Oregon 97331,3 Department of Molecular, Microbial and Structural Biology, University of Connecticut Health Center, Farmington, Connecticut 060304

Received 31 October 2007/ Accepted 27 November 2007


arrow
ABSTRACT
 
Clostridium perfringens food poisoning is caused by type A isolates carrying a chromosomal enterotoxin (cpe) gene (C-cpe), while C. perfringens-associated non-food-borne gastrointestinal (GI) diseases are caused by isolates carrying a plasmid-borne cpe gene (P-cpe). C. perfringens spores are thought to be the important infectious cell morphotype, and after inoculation into a suitable host, these spores must germinate and return to active growth to cause GI disease. We have found differences in the germination of spores of C-cpe and P-cpe isolates in that (i) while a mixture of L-asparagine and KCl was a good germinant for spores of C-cpe and P-cpe isolates, KCl and, to a lesser extent, L-asparagine triggered spore germination in C-cpe isolates only; and (ii) L-alanine or L-valine induced significant germination of spores of P-cpe but not C-cpe isolates. Spores of a gerK mutant of a C-cpe isolate in which two of the proteins of a spore nutrient germinant receptor were absent germinated slower than wild-type spores with KCl, did not germinate with L-asparagine, and germinated poorly compared to wild-type spores with the nonnutrient germinants dodecylamine and a 1:1 chelate of Ca2+ and dipicolinic acid. In contrast, spores of a gerAA mutant of a C-cpe isolate that lacked another component of a nutrient germinant receptor germinated at the same rate as that of wild-type spores with high concentrations of KCl, although they germinated slightly slower with a lower KCl concentration, suggesting an auxiliary role for GerAA in C. perfringens spore germination. In sum, this study identified nutrient germinants for spores of both C-cpe and P-cpe isolates of C. perfringens and provided evidence that proteins encoded by the gerK operon are required for both nutrient-induced and non-nutrient-induced spore germination.


arrow
INTRODUCTION
 
Bacillus and Clostridium species have the ability to form metabolically dormant spores that are extremely resistant to environmental stresses, such as heat, radiation, and toxic chemicals (41, 50). As a consequence of this resistance, spores of a number of these species are significant agents of food spoilage and food-borne gastrointestinal (GI) diseases (51). However, to cause deleterious effects, dormant spores must first go through germination and then outgrowth to be converted to vegetative cells. Spore germination has been studied most extensively for Bacillus subtilis (31, 40, 49) and can be initiated by a variety of chemicals, including nutrients, cationic surfactants, and enzymes, as well as by hydrostatic pressure (37). Nutrient germinants for spores of Bacillus species include L-alanine, a mixture of L-asparagine, D-glucose, D-fructose, and potassium ions (AGFK), and inosine (8, 32, 49). These nutrient germinants interact with cognate receptors located in the inner spore membrane (20, 36), stimulating the release of monovalent cations (H+, Na+, and K+), divalent cations (Ca2+, Mg2+, and Mn2+), and the spore core's large depot (~20% of core dry weight) of pyridine-2,6-dicarboxylic acid (dipicolinic acid [DPA]) (49), accompanied by an increase in the water content of the spore core. DPA is released as a 1:1 chelate with divalent cations, predominantly Ca2+ (Ca-DPA), and Ca-DPA release triggers further events in spore germination. Most important among the latter is the hydrolysis of the spore's peptidoglycan cortex by one or more spore cortex lytic enzymes (SCLEs), which allows the core to expand and to take up even more water to the level found in growing cells. This event, in turn, restores protein movement and enzyme action in the spore core and leads to resumption of energy metabolism and macromolecular synthesis (11, 50).

Genetic evidence strongly suggests that orthologous proteins belonging to the GerA family form the nutrient germinant receptors through which the spore senses the presence of nutrients in the environment (32, 33, 40). In B. subtilis, the genes of the GerA family are expressed only during sporulation in the developing forespore (14) and are carried in three tricistronic operons, termed gerA, gerB, and gerK (31, 33). Each of these operons appears to encode a single nutrient germinant receptor which is a complex of the three proteins encoded by each operon, and null mutation in any cistron within the operon results in inactivation of the respective receptor (31, 40). There is also genetic evidence suggesting that the three proteins encoded by each operon physically interact to form a receptor (20, 39) and that these receptors interact with each other to some degree (2, 5, 39). Hydropathy profiling indicates that two proteins (A and B) encoded by each operon are integral membrane proteins, which is consistent with their being receptors for environmental stimuli (31, 40). However, the C component is a relatively hydrophilic product that is likely to be anchored to the membrane via a covalently attached diacylglyceryl moiety (21, 22, 31).

Spore germination in Clostridium species is less well studied than that in Bacillus species. Limited studies have shown that spores of proteolytic Clostridium botulinum and Clostridium sporogenes germinate in response to L-alanine but not to AGFK or inosine (4), but no such information is available for spores of Clostridium perfringens, an important human GI pathogen. C. perfringens food poisoning is caused by type A isolates carrying a chromosomal enterotoxin (cpe) gene (C-cpe), while C. perfringens-associated non-food-borne GI diseases are caused by isolates carrying a plasmid-borne cpe gene (P-cpe) (28, 45). However, exceptions were reported in a recent study (26), which showed that P-cpe isolates can also be a common cause of food poisoning. C. perfringens spores are thought to be the important infectious cell morphotype, and after inoculation into a suitable host, these spores must germinate and return to active growth to cause GI disease (28). In this study, we investigated the germination of spores of pathogenic C. perfringens C-cpe and P-cpe isolates. We identified nutrient germinants for C. perfringens spores and identified differential germination responses in spores of C-cpe and P-cpe isolates. In addition, through construction of mutations in genes encoding nutrient germinant receptors, we investigated the roles of different receptors in spore germination in response to a number of nutrient and nonnutrient germinants.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids. The C. perfringens strains and plasmids used in this study are described in Table 1.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Bacterial strains and plasmids used for this study

Spore preparation. Starter cultures (10 ml) of C. perfringens isolates were prepared by overnight growth at 37°C in fluid thioglycolate (FTG; Difco) broth as described previously (25). Sporulating cultures of C. perfringens were prepared by inoculating 0.2 ml of an FTG starter culture into 10 ml of Duncan-Strong sporulation medium (13), which was incubated for 24 h at 37°C to form spores, as confirmed by phase-contrast microscopy. Spore preparations were prepared by scaling up the latter procedure. Spores were purified by repeated washing with sterile distilled water until they were >99% free of sporulating cells, cell debris, and germinated spores, were suspended in distilled water at an optical density at 600 nm (OD600) of ~6, and were stored at –20°C. Spores of B. subtilis strain JH642 were prepared by growth for ~72 h at 37°C on agar plates (35), and the spores were purified as described previously (43, 47).

Spore germination. After heat activation (70°C for 30 min for B. subtilis, 75°C for 10 min for P-cpe isolates, and 80°C for 10 min for C-cpe isolates), spores were cooled to room temperature and incubated at 30°C for 10 min (unless noted otherwise) before the addition of germinants. Spores of C-cpe and P-cpe isolates were heat activated at different temperatures because our preliminary germination assay demonstrated that C-cpe isolates germinated better when heat activated at 80°C for 10 min, whereas P-cpe isolates germinated better when heat activated at 75°C for 10 min. Spore germination was routinely measured by monitoring the OD600 of spore cultures (Smartspec 3000 spectrophotometer; Bio-Rad Laboratories, Hercules, CA), which falls ~60% upon complete spore germination, and levels of spore germination were confirmed by phase-contrast microscopy. Germination was routinely carried out aerobically, since no differences in germination kinetics were detected under anaerobic conditions (data not shown). The extent of spore germination was calculated by measuring the decrease in OD600 and was expressed as a percentage of initial OD600. The rate of germination was expressed as the maximum rate of loss of OD600 of the spore suspension relative to the initial value. To evaluate the effects of pH on the rate of germination, germination was carried out in 25 mM sodium phosphate buffer (pH 5.7 to 7.5) or 10 mM Tris-HCl buffer (pH 8.0 and 8.5) at 30°C. All values reported are averages for two experiments performed with two independent spore preparations, and individual values varied <15% from the average.

Construction of gerK mutant. To isolate a derivative of C. perfringens strain SM101 with an insertion of catP, giving chloramphenicol resistance (Cmr; 20 µg/ml), in the gerK operon, a gerK mutator plasmid was constructed as follows. A 3,163-bp fragment carrying the gerK operon and 619 bp upstream of gerKA was PCR amplified with primers CPP213 and CPP214, which had KpnI and SalI cleavage sites, respectively (Table 2). The ~3.2-kb PCR fragment was cloned into plasmid pCR-XL-TOPO (Invitrogen, Carlsbad, CA) in Escherichia coli, giving plasmid pDP9, and excised from this plasmid by digestion with KpnI and SalI, and the 3.2-kb fragment was ligated between the KpnI and SalI sites of plasmid pMRS104, giving plasmid pDP10. The latter plasmid was digested with SpeI, which cuts only once within the gerKA open reading frame (ORF), the ends were filled, and an ~1.3-kb SmaI-NaeI fragment containing the catP gene from plasmid pJIR418 (3) was inserted, giving plasmid pDP11. The latter plasmid contains an inactivated gerK operon and, since it contains no C. perfringens origin of replication, cannot replicate in this host. Plasmid pDP11 was introduced into C. perfringens strain SM101 by electroporation (12), and a gerK mutant, strain DPS101, was selected by allelic exchange as described previously (45). The replacement of the wild-type gerKA gene with the mutant allele in strain DPS101 and the loss of the plasmid from this strain were confirmed by PCR and Southern blot analyses (data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Primers used in this study

Construction of gerAA mutants. A derivative of strain SM101 with an intron inserted in the gerAA gene was constructed as follows. To target the L1.LtrB intron (6) to gerAA, the intron sequence in plasmid pJIR750ai was modified based upon the sequences of predicted insertion sites in the gerAA gene, using the InGex intron prediction program (Sigma-Aldrich). For optimal gene interruption and stable insertion, the insertion site in the antisense strand, between positions 123 and 124 (score, 9.4; E value, 0.038) from the start codon, was chosen. Three short sequence elements from the intron RNA involved in base pairing with the DNA target site (6) were modified by PCR, using gerAA-specific primers CPP235, CPP236, and CPP237 (Table 2) and the LtrBAsEBS2 universal primer (CGAAATTAGAAACTTGCGTTCAGTAAAC) provided with the Targetron gene knockout system (Sigma-Aldrich Corporation, St. Louis, MO). The 353-bp gerAA Targetron was then cloned into plasmid pCR-XL-TOPO, generating plasmid pDP12, and a 353-bp HindIII-BsrGI fragment from pDP12 was cloned between the HindIII and BsrGI sites of the pJIR750ai vector, giving plasmid pDP13. Plasmid pDP13 was electroporated into C. perfringens strain SM101 (12), and Cmr colonies were screened for the insertion of the Targetron by PCR using gerAA-specific primers CPP211 and CPP212 (Table 2). To cure the Cmr coding vector, one Cmr Targetron-carrying clone was subcultured daily for 2 days in FTG medium without Cm, and single colonies were patched onto brain heart infusion (BHI) agar, with or without Cm, giving strain DPS102.

To isolate a derivative of SM101 with a deletion of the entire gerAA gene, a {Delta}gerAA suicide vector was constructed as follows. A 1,856-bp DNA fragment carrying 186 bp from the N-terminal coding region and 1,670 bp upstream of gerAA was PCR amplified using primers CPP257 and CPP258 (Table 2), which had KpnI and SpeI cleavage sites at the 5' ends of the forward and reverse primers, respectively (Table 2). A 1,994-bp fragment carrying 225 bp from the C-terminal coding region and 1,769-bp downstream of gerAA was PCR amplified using primers CPP259 and CPP260 (Table 2), which had PstI and XhoI cleavage sites, respectively. These PCR fragments were cloned into plasmid pCR-XL-TOPO, giving plasmids pDP18 and pDP19, respectively. A 1,856-bp KpnI-SpeI fragment from pDP18 was cloned upstream of catP in pMRS99 (M. R. Sarker, unpublished data), giving plasmid pDP20, and an ~2.0-kb PstI-XhoI fragment from pDP19 was cloned downstream of catP in pDP20, giving pDP21. Finally, an ~4.5-kb fragment carrying {Delta}gerAA::catP was cloned into plasmid pMRS104, which cannot replicate in C. perfringens (19), giving plasmid pDP22. Plasmid pDP22 was introduced into C. perfringens strain SM101 by electroporation (12), and the gerAA deletion strain DPS103 was isolated by allelic exchange (45). The presence of the gerAA deletion in strain DPS103 was confirmed by PCR and Southern blot analyses (data not shown).

RT-PCR analyses. C. perfringens strains were grown in either Duncan-Strong sporulation medium (13) or TGY (3% Trypticase, 2% glucose, 1% yeast extract, 0.1% cysteine) vegetative medium (25) at 37°C for 4 h, and total RNA was isolated as described previously (12, 18). The primer pairs CPP205 and CPP206, CPP207 and CPP208, and CPP283 and CPP284 (Table 2), which amplified 822-, 873-, and 839-bp internal fragments from gerAA, gerKA, and gerKC, respectively, were used to detect gerAA-, gerKA-, and gerKC-specific mRNAs in RNA preparations by reverse transcription-PCR (RT-PCR) analysis as described previously (18, 19).

DPA release. DPA release during nutrient-triggered spore germination was measured by heat activating a spore suspension (OD600 of 1.5) and incubating it at 40°C with 5 mM KCl to allow adequate measurement of DPA release. For DPA release during dodecylamine germination, spores were incubated at 60°C with 1 mM dodecylamine and 25 mM Tris-HCl (pH 7.4). Aliquots (1 ml) of germinating cultures were centrifuged for 2 min in a microcentrifuge, and DPA in the supernatant fluid was measured by monitoring the OD270 as described previously (5, 48).

Measurement of spore core DPA content. Spores were germinated with and without heat activation, cooled to room temperature, diluted to an OD600 of 1.5, and incubated at 40°C with Ca-DPA (50 mM CaCl2, 50 mM DPA adjusted to pH 8.0 with Tris base). At various times, aliquots (1 ml) were centrifuged for 2 min in a microcentrifuge, and the spore pellet was washed four times with 1 ml distilled water and suspended in 1 ml of distilled sterile water. The residual spore core DPA content was determined by boiling samples for 60 min, centrifuging them at 8,000 rpm in a microcentrifuge for 15 min, and measuring the OD270 of the supernatant fluid as described previously (5, 48). In B. subtilis, DPA comprises ~85% of the material absorbing at 270 nm that is released from spores by boiling (2, 5). The change in OD600 during spore germination by Ca-DPA was also measured as described above. However, since Ca-DPA promotes spore clumping, spores were sonicated briefly to disrupt clumps before measuring the OD600.

Colony formation assay. To assess the colony-forming ability of spores of strains SM101, DPS101, and DPS103, spores at an OD600 of 1 (~108 spores/ml) were heat activated at 80°C for 10 min, aliquots of various dilutions were plated on BHI agar and incubated at 37°C anaerobically for 24 h, and colonies were counted.

Statistical analyses. Student's t test was used for specific comparisons.


arrow
RESULTS
 
Ability of various compounds to trigger C. perfringens spore germination. Spores of B. subtilis 168 derivatives germinated well with either L-alanine, L-valine, or AGFK, although not with the individual components of AGFK (Table 3), as expected (39). In contrast, C. perfringens SM101 spores germinated only slightly with two single amino acids, L-alanine and L-asparagine, although they germinated well with AGFK (Table 3). However, much of the effect of AGFK appeared to be due to the K+ ions, as KCl alone gave a significant extent of germination of C. perfringens SM101 spores, glucose plus fructose was ineffective, and asparagine plus KCl was effective, albeit to a lesser extent than AGFK (Table 3; Fig. 1). The rate of KCl-induced spore germination was dependent on the KCl concentration, with a maximum germination response at 100 to 200 mM (Fig. 2). In contrast to the stimulation of C. perfringens spore germination by KCl, NaCl was ineffective, while KI, KBr, and KH2PO4 were all effective (Table 3), as observed with spores of Bacillus megaterium QM B1551 (7, 44).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Germination of C. perfringens spores by various compounds


Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 1. Germination of C. perfringens spores with various germinants. Spores of strain SM101 (wild type) were heat activated and germinated at 30°C in 25 mM sodium phosphate buffer (pH 7.0) with no germinant ({triangleup}) or with 100 mM L-alanine (+), L-asparagine ({blacktriangleup}), KCl ({square}), AK ({blacksquare}), or AGFK (•), and the OD600 was measured as described in Materials and Methods.


Figure 2
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 2. KCl concentration dependence of C. perfringens spore germination. Heat-activated SM101 spores (wild type) were germinated with various KCl concentrations. The maximum rate of germination was calculated as described in Materials and Methods.

To examine whether KCl, with or without AGFK components, is a universal germinant for C. perfringens spores, germination experiments were extended to spores of six additional isolates of cpe+ C. perfringens type A, three C-cpe isolates (E13, NCTC8239, and FD1041), and three P-cpe isolates (NB16, B40, and F5603) (9, 10). As observed with spores of C-cpe isolate SM101 (Table 3), spores of the C-cpe isolates exhibited only minimal germination with L-alanine or L-valine but some germination with L-asparagine (Table 4). However, spores of these isolates germinated well with KCl (Table 4), suggesting that KCl is a universal germinant for spores of C-cpe isolates. Interestingly, the germination of spores of the P-cpe isolates differed from that of spores of the C-cpe isolates, in that KCl alone did not induce significant germination of the P-cpe spores. The P-cpe spores also germinated fairly well with L-alanine and L-valine, as well as with L-asparagine plus potassium (AK), but not with L-asparagine alone (Table 4).


View this table:
[in this window]
[in a new window]

 
TABLE 4. Germination of spores of C. perfringens isolates carrying cpe on the chromosome (C-cpe isolates) or a plasmid (P-cpe isolates)

Effects of pH and temperature on C. perfringens spore germination. To define the optimal conditions for C. perfringens spore germination, the temperature and pH of germination were varied, using spores of SM101 (a C-cpe isolate) and NB16 (a P-cpe isolate) and L-alanine, KCl, and AK as germinants (Fig. 3A to D). While the optimum temperature for germination of SM101 and NB16 spores with all germinants tested was ~40°C, there were differences in the responses of spore germination with different germinants to temperature. In particular, germination of SM101 spores with KCl was much more sensitive to higher temperatures than was germination with AK.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 3. Effects of temperature (A and B) and pH (C and D) on germination of C. perfringens spores. Heat-activated spores of strains SM101 (A and C) and NB16 (B and D) were germinated with 100 mM AK (•), 100 mM KCl ({circ}), or 100 mM L-alanine ({square}). The maximum rate of germination was calculated as described in Materials and Methods.

The pH dependences of germination of SM101 and NB16 spores with AK were also similar, with a pH optimum of 7.0 to 7.5. The responses of KCl and L-alanine germination to pH were also similar but were not optimal at pH 7.0 to 7.5, rather exhibiting a gradual increase in germination rate as the pH was lowered to 5.7.

Identification of putative germination receptor homologues in C. perfringens. Studies with B. cereus, B. anthracis, and B. subtilis have shown that the responses of spores of these species to nutrient germinants are mediated through nutrient germinant receptor proteins encoded by the gerA operon family (8, 23, 39). When the C. perfringens SM101 genome sequence was subjected to BLASTP analyses to identify genes encoding GerA family nutrient germinant receptor protein homologues, four ORFs (CPR0614, CPR0615, CPR0616, and CPR1053) encoding proteins with high similarity (50 to 55%) to GerA family proteins from B. subtilis were identified (Fig. 4A and B). CPR1053 is predicted to encode a 473-residue protein with a central region containing five transmembrane segments (TMS). Due to its high similarity with the "A" proteins of all three B. subtilis GerA-type receptors, we termed CPR1053 gerAA. The gerK locus in C. perfringens (34) comprises three ORFs, namely, CPR0614, CPR0615, and CPR0616. Based on amino acid sequence similarity (39 to 56%) to the orthologues in B. subtilis, ORFs CPR0614, CPR0615, and CPE0616 were designated gerKB, gerKA, and gerKC, respectively (Fig. 4A and B). As in B. subtilis, gerKA and gerKC are adjacent, with gerKA being the first gene in a putative bicistronic operon, but unlike the situation in B. subtilis, gerKB is transcribed in the opposite direction from that of gerKAC and is 96 bp upstream of gerKA. GerKA is predicted to be a 473-residue protein with five TMS, and GerKC is predicted to be a 374-residue protein containing an N-terminal signal protein followed by a consensus sequence for diacylglycerol addition to a cysteine residue. GerKB is predicted to be a 362-residue protein with 10 TMS.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 4. Analysis of genes encoding nutrient germinant receptors in C. perfringens. (A) Comparison of genes encoding nutrient germinant receptor proteins in B. subtilis and C. perfringens. Data were obtained from the Entrez Genome website (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi?view=1). (B) Percent amino acid sequence similarities between nutrient germinant receptor protein homologues from B. subtilis and C. perfringens. (C) RT-PCR analysis of C. perfringens genes encoding germinant receptor homologues. RNAs from sporulating cells of strains SM101 (wild type) and DPS101 (gerK) were subjected to RT-PCR analysis using gerKA-, gerKC-, and gerAA-specific internal primers. Lanes labeled "wt-RT" and "mt-RT" contain RT-PCR products obtained from RNAs from strains SM101 and DPS101, respectively. Lanes labeled "PCR" contain PCR products obtained from SM101 DNA, using gerAA-, gerKA-, and gerKC-specific internal primers. The PCR- and RT-PCR-amplified products were analyzed by agarose (1%) gel electrophoresis and photographed under UV light. The presence of RT-PCR products cannot be explained by amplification from contaminated DNA because no PCR product was obtained from RNA in the absence of reverse transcriptase (data not shown).

To assess the expression of gerAA, gerKA, and gerKC homologues in C. perfringens, we performed RT-PCR analysis. As expected, the 822-, 873-, and 839-bp RT-PCR products specific for gerAA, gerKA, and gerKC, respectively, were detected in RNAs extracted from C. perfringens SM101 grown under sporulation conditions (Fig. 4C). The sizes of the RT-PCR amplification products matched the sizes of the products obtained in control PCRs (Fig. 4C). However, no gerAA-, gerKA-, or gerKC-specific RT-PCR products were detected in RNAs from SM101 vegetative cells (data not shown), indicating that C. perfringens gerAA, gerKA, and gerKC are expressed only during sporulation.

Effect of gerK mutation on nutrient germination of C. perfringens spores. As noted above, there are many studies with Bacillus species indicating that it is through nutrient germinant receptors of the GerA family that nutrients trigger spore germination. To assess whether the gerKA and gerKC gene products have any role in C. perfringens spore germination, we constructed an insertion mutation in gerKA, giving strain DPS101. No gerKA- or gerKC-specific transcripts were detected in RNAs isolated from sporulating DPS101 cells (Fig. 4C), indicating that the disruption of gerKA had a polar effect on the downstream gerKC gene. Strikingly, the germination level of DPS101 spores with KCl, AK, or L-asparagine was well below that of the parental wild-type SM101 spores, in particular with L-asparagine, when spore germination was assessed by the OD600 of spore cultures (Fig. 5A to C). These differences were confirmed by examining spore cultures by phase-contrast microscopy (data not shown), which showed in particular that after incubation for 60 min with L-asparagine, ≥95% of SM101 spores had germinated, while at most 5% of DPS101 spores had germinated.


Figure 5
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 5. Germination of C. perfringens wild-type and gerK spores with various germinants. Heat-activated spores of strains SM101 (wild type) ({square}) and DPS101 (gerK) ({blacksquare}) were germinated with 100 mM KCl (A), 100 mM L-asparagine plus 100 mM KCl (B), and 100 mM L-asparagine (C) as described in Materials and Methods. The control germination ({circ}) corresponds to heat-activated spores incubated in 25 mM sodium phosphate buffer (pH 7.0); no difference between SM101 and DPS101 spores was seen.

Effect of gerAA mutation on nutrient germination of C. perfringens spores. The only partial decrease in germination of spores lacking GerKA and GerKC with KCl and AK suggested that GerAA might also contribute to C. perfringens spore germination with these germinants. Initial analysis of spores of a gerAA strain (DPS102) constructed using the Targetron gene knockout system (6) found no difference in the kinetics of KCl, AK, or L-asparagine germination of SM101 and DPS102 spores (data not shown). These results suggested that either GerAA has no role in spore germination or intron insertion leads to a C-terminal fragment of GerAA that retains activity in spore germination.

To more rigorously test the role of GerAA in spore germination, we constructed a derivative of strain SM101 (strain DPS103) in which the entire gerAA gene was deleted. Germination of DPS103 and SM101 spores in 100 mM KCl was similar, although it was slightly greater for the SM101 spores (Fig. 6A). However, the defect in the DPS103 spores was more evident at a suboptimal KCl concentration (10 mM), in which the extent of DPS103 spore germination was ≤50% of that of SM101 spores after 60 min of incubation (Fig. 6D). Although the gerAA spores again showed no significant germination defect with 100 mM AK (Fig. 6B), at a lower AK concentration (10 mM) the extent of germination of DPS103 spores was significantly lower (P < 0.01) than that of SM101 spores (Fig. 6E). However, there were no significant differences in the germination of SM101 and DPS103 spores with either high (100 mM) or low (10 mM) concentrations of L-asparagine (Fig. 6C and F).


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 6. Germination of C. perfringens wild-type and gerAA spores with various germinants. Heat-activated spores of strains SM101 (wild type) ({square}) and DPS103 (gerAA) ({blacktriangleup}) were germinated with 100 mM KCl (A), 100 mM L-asparagine and 100 mM KCl (B), 100 mM L-asparagine (C), 10 mM KCl (D), 10 mM L-asparagine and 10 mM KCl (E), and 10 mM L-asparagine (F) as described in Materials and Methods. The control germination ({circ}) was heat-activated spores incubated in 25 mM sodium phosphate buffer (pH 7.0), and no difference between spores of SM101 and DPS103 was observed.

Effects of gerK and gerAA mutations on DPA release during C. perfringens spore germination. With B. subtilis spores, binding of nutrient germinants to specific receptors located in the spore's inner membrane triggers the release of a variety of compounds from the spore core, most notably DPA, which comprises ~20% of the spore core's dry weight (38). Most of this DPA is released as Ca-DPA, and Ca-DPA release activates downstream germination events (49). Consequently, to gain more insight into the roles of GerAA, GerKA, and GerKC in C. perfringens spore germination, we measured DPA release during KCl- and L-asparagine-triggered germination (Fig. 7A and B). During germination with 5 mM KCl, SM101 spores released nearly 67% of their DPA during the first 10 min and 93% of their DPA after 60 min of incubation, with the latter being expected for fully germinated spores. DPS103 (gerAA) spores released slightly less DPA (P < 0.01) than that released by SM101 spores after 60 min of incubation with 5 mM KCl, although SM101 and DPS103 spores exhibited similar levels of DPA release with L-asparagine (Fig. 7A and B). In contrast, DPS101 (gerK) spores released significantly less DPA during germination with either KCl or L-asparagine (Fig. 7A and B). These results further support the hypothesis that GerAA plays an auxiliary role in KCl but not L-asparagine germination of C. perfringens spores, while the products of the gerK operon are involved in both KCl and L-asparagine germination.


Figure 7
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 7. DPA release during germination of C. perfringens spores. Heat-activated spores of strains SM101 (wild type) ({square}), DPS101 (gerK) ({blacksquare}), and DPS103 (gerAA) ({blacktriangleup}) were germinated in 25 mM sodium phosphate buffer (pH 7.0) with 5 mM KCl (A) or 100 mM L-asparagine (B). At various times, DPA release was measured as described in Materials and Methods.

Effects of gerK and gerAA mutations on colony formation by C. perfringens spores. The germination defects observed in DPS101 and DPS103 spores suggested that these spores might have lower colony-forming efficiencies than that of SM101 spores, as spores need to sense the availability of nutrients to initiate germination and outgrowth. This hypothesis was tested by plating SM101, DPS101, and DPS103 spores on BHI agar and incubating them for 24 h at 37°C under anaerobic conditions. No significant differences in colony formation efficiency were observed between SM101 (8.4 x 107 CFU/ml/OD600 unit [average for three experiments]) and DPS103 (8.3 x 107 CFU/ml/OD600 unit) spores, although DPS101 spores exhibited a significantly lower colony-forming efficiency (1.6 x 106 CFU/ml/OD600 unit) than that of SM101 spores. No additional colonies appeared from DPS101 spores when plates were incubated for up to 3 days. To evaluate whether the lower colony formation efficiency of DPS101 spores was due to their poorer germination, we compared the germination of DPS101, DPS103, and SM101 spores in BHI broth. As expected, DPS101 spores exhibited significantly less (P < 0.01) germination than did wild-type (SM101) spores, while there was only a minimal difference in germination between DPS103 and SM101 spores (Fig. 8). However, the germination difference in BHI broth between SM101 and DPS101 spores was nowhere near the 50-fold difference in colony formation. Therefore, spores of all three strains were germinated in BHI broth and examined by phase-contrast microscopy after 1 and 18 h of incubation. As expected, ~65% of SM101 and DPS103 spores and ~30% of DPS101 spores were phase dark after 1 h of incubation, in agreement with the results from measurements of OD600 (Fig. 8). However, when spore suspensions were incubated for 18 h at 40°C in BHI broth under aerobic conditions to prevent C. perfringens growth, ~99% of SM101 and DPS103 spores were phase dark, and ~90% of these phase-dark spores had released the nascent vegetative cell (data not shown). Strikingly, while ~70% of DPS101 spores were phase dark, ≤5% of the phase-dark spores seemed to release the nascent vegetative cell (data not shown), which is in clear agreement with the lower colony formation observed from these spores. These results suggest that the products of the gerK operon, but not that of gerAA, are essential not only for spore germination but also for completing germination and outgrowth and thus for eventual colony formation in BHI medium.


Figure 8
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 8. Germination of spores of C. perfringens strains in BHI broth. Heat-activated spores of strains SM101 (wild type) ({square}), DPS101 (gerK) ({blacksquare}), and DPS103 (gerAA) ({blacktriangleup}) were incubated at 40°C with BHI broth, and the OD600 was measured as described in Materials and Methods.

Effects of gerK and gerAA mutations on Ca-DPA germination of C. perfringens spores. Previous work (40) has shown that B. subtilis spores lacking all nutrient germinant receptors are still able to germinate in the presence of exogenous Ca-DPA, which acts to promote cortex hydrolysis by activation of an SCLE (36). Similar, albeit not identical, SCLEs have also been found in other endospore-forming species, including C. perfringens (15, 24, 27, 29, 30, 52). When spores of strains SM101, DPS101, and DPS103 without prior heat activation were incubated with Ca-DPA and germination was measured, there were no significant changes in OD600 or spore refractility and no release of DPA (data not shown). However, heat-activated SM101 and DPS103 spores germinated significantly, as measured by both an OD600 decrease and DPA release (Fig. 9A and B). These results were confirmed by phase-contrast microscopy, as ~80% of SM101 and DPS103 spores became phase dark after 60 min of incubation with Ca-DPA (data not shown). In contrast, no significant OD600 decrease or DPA release was observed with heat-activated spores of DPS101 (gerK) incubated with Ca-DPA (Fig. 9A and B), and phase-contrast microscopy confirmed that after 60 min of incubation with 50 mM Ca-DPA, ~95% of the spores remained phase bright (data not shown). These results suggest that the putative gerK germinant receptor (but not the GerAA protein) plays a causal role in C. perfringens spore germination with Ca-DPA.


Figure 9
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 9. Ca-DPA germination of spores of C. perfringens strains. Heat-activated spores of strains SM101 (wild type), DPS101 (gerK), and DPS103 (gerAA) were germinated with 50 mM Ca-DPA (pH 8.0) at 40°C for 60 min, and changes in the OD600 of the culture (A) and the amount of DPA remaining in the spores (B) were measured as described in Materials and Methods. The values shown are averages for two experiments with two independent spore preparations. Error bars show 1 standard deviation from the mean.

Effects of gerK and gerAA mutations on dodecylamine germination of C. perfringens spores. Dodecylamine, a cationic surfactant (48), can also germinate spores of many Bacillus and Clostridium species, and in B. subtilis spores, dodecylamine may act by triggering spore core DPA release, perhaps by opening a channel in the spore's inner membrane (48, 54, 55). Indeed, B. subtilis spores lacking all three nutrient germinant receptors release DPA in response to dodecylamine at a rate similar to that of wild-type spores (48). With spores of C. perfringens, wild-type (SM101) and gerAA (DPS103) spores exhibited similar rates of DPA release in response to dodecylamine (Fig. 10), indicating that GerAA is not required for dodecylamine germination. However, DPS101 (gerK) spores incubated with dodecylamine released DPA at a significantly lower rate than did wild-type (SM101) spores (Fig. 10), suggesting that gerK-encoded proteins are also involved in dodecylamine germination. Phase-contrast microscopy of spores of all three strains after 60 min of incubation with dodecylamine revealed that germinated spores were not as bright as dormant spores but not as dark as nutrient-germinated spores. This is in agreement with results for B. subtilis spores germinated with dodecylamine, where some but not all of the refractility of dormant spores in the phase-contrast microscope is lost (48).


Figure 10
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 10. Dodecylamine germination of spores of C. perfringens strains. Spores of strains SM101 (wild type) ({square}), DPS101 (gerK) ({blacksquare}), and DPS103 (gerAA) ({blacktriangleup}) were incubated at 60°C with 1 mM dodecylamine (pH 7.4), and DPA release was measured as described in Materials and Methods.


arrow
DISCUSSION
 
While bacterial spores can remain dormant for many years, they can return to life in as little as 20 min via spore germination and outgrowth if nutrients are added (for reviews, see references 29 and 46). There is much interest in these processes because (i) spores cause disease through germination and outgrowth in foodstuffs or in the body and (ii) when spores germinate, they lose their resistance and are easy to kill. Thus, a detailed understanding of the mechanism(s) of spore germination may lead to the design of either inhibitors of germination or artificial germinants that could allow spore killing under mild conditions.

In this respect, our current study offers several significant contributions toward the understanding of the mechanism of germination of spores of C. perfringens, an anaerobic, toxigenic pathogen causing diseases in humans and animals (9, 10, 45, 57). Our studies suggest that C. perfringens C-cpe and P-cpe spores respond differently to germinants in that (i) while AK is a universal germinant for all surveyed C-cpe and P-cpe spores, KCl and, to a lesser extent, L-asparagine can initiate germination of C-cpe but not P-cpe spores; and (ii) although L-alanine and L-valine are germinants for P-cpe spores, these amino acids give no significant germination of C-cpe spores. These different responses suggest that P-cpe but not C-cpe spores carry a functional L-alanine receptor. The observation that L-alanine, a good germinant for spores of B. subtilis, B. cereus, and C. botulinum (1, 17, 40), was unable to trigger germination of spores of C-cpe isolates, further suggests that the germination response of C-cpe spores is different from that of B. subtilis, B. cereus, and C. botulinum spores, presumably due to differences in the complement of nutrient germinant receptors in these various species (34). Despite different germination responses, the optimum germination temperature for both C-cpe and P-cpe spores was ~40°C, which is slightly higher than the optimum growth temperature (37°C). The high optimum germination temperature for C. perfringens spores was not unexpected because the germination temperature optima for spores of Clostridium bifermentans (56) and C. botulinum group IV type G (53) are 37 to 53°C and 37 to 45°C, respectively, which are significantly higher than the temperature optima for growth of these strains.

The germination of spores of C-cpe isolates by salt alone was a bit unexpected but is by no means unique, since spores of at least some B. megaterium strains germinate well with salts alone, with KI better than with KBr, which is better than KCl (7, 44). In addition, K+ ions are essential for the germination of B. subtilis spores with AGFK (44). Unfortunately, the precise mechanism of spore germination by salts alone is not known, nor is the potential advantage of this behavior.

Bacterial spores detect nutrient germinants through specific receptors (32, 33), and three tricistronic operons, gerA, gerB, and gerK, have been identified in B. subtilis as encoding the three functional receptors in this species (32, 33, 40). In contrast, the C. perfringens SM101 genome carries only monocistronic gerA and gerKB operons and a bicistronic gerKA-gerKC operon (34). The products of the gerK operon are required for L-asparagine germination, presumably by acting as a receptor for L-asparagine. Since disruption of the gerK operon led to poorer spore germination and DPA release with KCl, this suggests that GerKA and/or GerKC plays a significant role in C. perfringens spore germination by KCl. There also appears to be some interaction between the L-asparagine and KCl germination pathways, since gerK spores germinated more poorly with AK than with KCl. The responses of AK and KCl germination to pH and temperatures also suggest that L-asparagine interacts with a different receptor or different active site on the same receptor than does KCl, especially since AK allows significant germination at rather extreme temperatures (60°C). The possibility that individual nutrient germinant receptors and perhaps even individual germinant receptor proteins have multiple binding sites that recognize different germinants has been suggested previously from work on B. subtilis spore germination and, more recently, B. megaterium spores (7).

Interestingly, the absence of GerAA slightly affected KCl germination and KCl-induced DPA release. An essential function of GerAA in the recognition of germinants, in particular KCl, seems unlikely, since the maximum germination rate of gerAA spores with an optimal concentration of KCl was similar to that of wild-type spores. However, the lower rate of inducing DPA release from gerAA spores at a suboptimal KCl concentration suggests that GerAA may be involved in a peripheral or auxiliary fashion in KCl germination. However, this appears not to be the case when DPA release is induced by exogenous Ca-DPA or dodecylamine, where the gerAA mutation has no effect.

The lower colony-forming ability of gerK spores in rich BHI medium compared to that of SM101 spores suggests that GerKA and/or GerKC is responsible for spore germination in this medium, and this was consistent with the slower germination of gerK spores in BHI medium. Interestingly, GerKA and/or GerKC also appears to be involved in the release of the nascent vegetative cell in germinated spores; perhaps these proteins are responsible for the activation of either a cortex lytic enzyme to allow completion of germination or some other enzyme that allows the nascent vegetative cell to be released from the coat/exosporium. The relatively high colony-forming ability of the gerK spores was not due to gerK reversion, because PCR did not detect the wild-type gerKA-gerKC operon in colonies obtained from gerK spores. While gerK spores had an ~50-fold lower colony-forming ability than did wild-type spores on BHI medium, this is much less of a decrease than that observed with B. subtilis spores lacking all functional germinant receptors, in which colony-forming ability was reduced to <0.1% of that of wild-type spores (40). However, the colony-forming ability of C. perfringens gerK spores was significantly lower than that obtained with B. subtilis gerA, gerB, or gerK single mutant spores (40). The relatively high level of germination of C. perfringens gerK spores may be due to (i) contributions of remaining germinant receptor proteins, such as GerAA and GerKB, even though no obvious "C" protein homologue remains; (ii) the presence of germinant receptor proteins with significantly different sequences from those of the GerA family; and (iii) stochastic activation of germination components downstream of the nutrient germinant receptors, such as SpoVA proteins, which may comprise a channel involved in DPA release (55), or an SCLE (49). Analysis of a strain with mutations in not only gerKA-gerKC but also gerAA and gerKB may help in deciding between these alternatives.

In addition to nutrients, many nonnutrients also trigger spore germination (42, 48). We obtained several results for nonnutrient germination of gerK C. perfringens spores that were in contrast to results for B. subtilis spores that lack all nutrient germinant receptors (36, 40). First, C. perfringens gerK spores germinated extremely poorly with exogenous Ca-DPA, which in B. subtilis spores acts to promote cortex hydrolysis by activation of SCLEs (34), suggesting that products of the gerK operon are involved in Ca-DPA germination of C. perfringens spores. However, since the predicted amino acid sequences of GerKA and GerKC suggest that they are inner membrane proteins (in agreement with other GerA family proteins), it is unlikely, although not impossible, that they physically interact with the C. perfringens SCLEs, SleC and SleM, that are located within and at the outer boundary of the cortex (29, 52). The following two possibilities can be envisioned: (i) whether or not the cortex is degraded by SCLEs that are activated by exogenous Ca-DPA, the GerKA and GerKC proteins are essential for the opening of an inner membrane Ca-DPA channel, perhaps composed of SpoVA proteins, as is thought to be the case for B. subtilis spores (55); or (ii) there is indeed some physical interaction, either direct or indirect, between gerK-encoded proteins and SCLEs, and this is required for efficient SCLE activation. Genes encoding SCLEs as well as SpoVA proteins are indeed present in the C. perfringens genome (34), and studies examining the roles of these proteins in C. perfringens spore germination seem likely to be rewarding. Second, C. perfringens gerK spores released DPA at a significantly lower rate than did wild-type spores with dodecylamine, again in contrast to results for B. subtilis spores lacking all nutrient germinant receptors (48). These findings indicate that the gerK-encoded proteins are also involved in Ca-DPA release triggered by dodecylamine, perhaps (i) directly by interacting with and opening some Ca-DPA channel composed of SpoVA proteins or (ii) indirectly by interacting with GerKA and/or GerKC and activating these proteins (perhaps together with GerKB), which in turn would result in Ca-DPA release, which would then activate downstream germination events. Again, analysis of C. perfringens spores with mutations in genes encoding all germinant receptor proteins, as well as SpoVA proteins and SCLEs, should allow decisions between these alternative explanations.

In summary, the work reported in this communication allows us to propose a tentative working model to explain the effects of nutrient and nonnutrient germinants on C. perfringens spore germination (Fig. 11), as follows: (i) some germinants (i.e., L-asparagine and KCl) bind to germinant receptors, promoting the release of Ca-DPA, possibly through a channel composed at least in part of SpoVA proteins; (ii) exogenous Ca-DPA requires the presence of GerKA and GerKC proteins for activation of SCLEs, which in turn degrade the spore cortex, allowing completion of spore germination; and (iii) dodecylamine germination also requires the presence of the GerKA and GerKC proteins for proper Ca-DPA release through an inner membrane channel, and the released Ca-DPA activates SCLEs, allowing cortex hydrolysis and, again, the completion of germination. Ongoing work is oriented toward understanding the important interactions between gerK-encoded proteins, SpoVA proteins, and SCLEs and the role(s) these various components play in the germination of spores of pathogenic C. perfringens. This understanding may well have applied implications in the areas of food safety and food preservation.


Figure 11
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 11. Putative model for nutrient and nonnutrient germination of C. perfringens spores. Nutrients activate germinant receptors, resulting in Ca-DPA release from the core, which triggers activation of SCLEs. External Ca-DPA induces germination through a mechanism that requires the GerK receptor to fully activate downstream germination events. Dodecylamine triggers DPA release by ultimately opening a DPA channel (composed of SpoVA proteins, by analogy with B. subtilis spores) in the spore's inner membrane. Since dodecylamine germination is unaffected by gerAA mutation but is reduced by loss of GerKA and GerKC, dodecylamine presumably acts on both the GerK receptor, to indirectly open a DPA channel, and the DPA channel itself. SCLEs are then activated by the Ca-DPA release triggered by dodecylamine, and SCLEs then promote cortex hydrolysis and completion of spore germination.


arrow
ACKNOWLEDGMENTS
 
This research was supported by a fellowship from MIDEPLAN (Chile) to D. Paredes-Sabja and by grants from the U.S. Department of Agriculture (2002-35201-12643) and the National Institutes of Health (GM19698) to M. R. Sarker and P. Setlow, respectively.

We thank Roberto Grau (Universidad Nacional de Rosario, Argentina) for technical advice during some initial germination assays. We also thank Nahid Sarker for technical assistance and Denny Weber for editorial comments.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biomedical Sciences, Oregon State University, 216 Dryden Hall, Corvallis, OR 97331. Phone: (541) 737-6918. Fax: (541) 737-2730. E-mail: sarkerm{at}oregonstate.edu Back

{triangledown} Published ahead of print on 14 December 2007. Back


arrow
REFERENCES
 
    1
  1. Alberto, F., V. Broussolle, D. R. Mason, F. Carlin, and M. W. Peck. 2003. Variability in spore germination response by strains of proteolytic Clostridium botulinum types A, B and F. Lett. Appl. Microbiol. 36:41-45.[CrossRef][Medline]
  2. 2
  3. Atluri, S., K. Ragkousi, D. E. Cortezzo, and P. Setlow. 2006. Cooperativity between different nutrient receptors in germination of spores of Bacillus subtilis and reduction of this cooperativity by alterations in the GerB receptor. J. Bacteriol. 188:28-36.[Abstract/Free Full Text]
  4. 3
  5. Bannam, T. L., and J. I. Rood. 1993. Clostridium perfringens-Escherichia coli shuttle vectors that carry single antibiotic resistance determinants. Plasmid 29:233-235.[CrossRef][Medline]
  6. 4
  7. Broussolle, V., F. Alberto, C. A. Shearman, D. R. Mason, L. Botella, C. Nguyen-The, M. W. Peck, and F. Carlin. 2002. Molecular and physiological characterization of spore germination in Clostridium botulinum and C. sporogenes. Anaerobe 8:89-100.[CrossRef]
  8. 5
  9. Cabrera-Martinez, R. M., F. Tovar-Rojo, V. R. Vepachedu, and P. Setlow. 2003. Effects of overexpression of nutrient receptors on germination of spores of Bacillus subtilis. J. Bacteriol. 185:2457-2464.[Abstract/Free Full Text]
  10. 6
  11. Chen, Y., B. A. McClane, D. J. Fisher, J. I. Rood, and P. Gupta. 2005. Construction of an alpha toxin gene knockout mutant of Clostridium perfringens type A by use of a mobile group II intron. Appl. Environ. Microbiol. 71:7542-7547.[Abstract/Free Full Text]
  12. 7
  13. Christie, G., and C. R. Lowe. 2007. Role of chromosomal and plasmid-borne receptor homologues in the response of Bacillus megaterium QM B1551 spores to germinants. J. Bacteriol. 189:4375-4383.[Abstract/Free Full Text]
  14. 8
  15. Clements, M. O., and A. Moir. 1998. Role of the gerI operon of Bacillus cereus 569 in the response of spores to germinants. J. Bacteriol. 180:6729-6735.[Abstract/Free Full Text]
  16. 9
  17. Collie, R. E., J. F. Kokai-Kun, and B. A. McClane. 1998. Phenotypic characterization of enterotoxigenic Clostridium perfringens isolates from non-foodborne human gastrointestinal diseases. Anaerobe 4:69-79.[Medline]
  18. 10
  19. Collie, R. E., and B. A. McClane. 1998. Evidence that the enterotoxin gene can be episomal in Clostridium perfringens isolates associated with non-food-borne human gastrointestinal diseases. J. Clin. Microbiol. 36:30-36.[Abstract/Free Full Text]
  20. 11
  21. Cowan, A. E., D. E. Koppel, B. Setlow, and P. Setlow. 2003. A soluble protein is immobile in dormant spores of Bacillus subtilis but is mobile in germinated spores: implications for spore dormancy. Proc. Natl. Acad. Sci. USA 100:4209-4214.[Abstract/Free Full Text]
  22. 12
  23. Czeczulin, J. R., R. E. Collie, and B. A. McClane. 1996. Regulated expression of Clostridium perfringens enterotoxin in naturally cpe-negative type A, B, and C isolates of C. perfringens. Infect. Immun. 64:3301-3309.[Abstract]
  24. 13
  25. Duncan, C. L., and D. H. Strong. 1968. Improved medium for sporulation of Clostridium perfringens. Appl. Microbiol. 16:82-89.[Medline]
  26. 14
  27. Feavers, I. M., J. Foulkes, B. Setlow, D. Sun, W. Nicholson, P. Setlow, and A. Moir. 1990. The regulation of transcription of the gerA spore germination operon of Bacillus subtilis. Mol. Microbiol. 4:275-282.[CrossRef][Medline]
  28. 15
  29. Foster, S. J., and K. Johnstone. 1987. Purification and properties of a germination-specific cortex-lytic enzyme from spores of Bacillus megaterium KM. Biochem. J. 242:573-579.[Medline]
  30. 16
  31. Hoch, J. A., and J. L. Mathews. 1973. Chromosomal location of pleiotropic negative sporulation mutations in Bacillus subtilis. Genetics 73:215-228.[Abstract/Free Full Text]
  32. 17
  33. Hornstra, L. M., Y. P. de Vries, M. H. Wells-Bennik, W. M. de Vos, and T. Abee. 2006. Characterization of germination receptors of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol. 72:44-53.[Abstract/Free Full Text]
  34. 18
  35. Huang, I. H., and M. R. Sarker. 2006. Complementation of a Clostridium perfringens spo0A mutant with wild-type spo0A from other Clostridium species. Appl. Environ. Microbiol. 72:6388-6393.[Abstract/Free Full Text]
  36. 19
  37. Huang, I. H., M. Waters, R. R. Grau, and M. R. Sarker. 2004. Disruption of the gene (spo0A) encoding sporulation transcription factor blocks endospore formation and enterotoxin production in enterotoxigenic Clostridium perfringens type A. FEMS Microbiol. Lett. 233:233-240.[CrossRef][Medline]
  38. 20
  39. Hudson, K. D., B. M. Corfe, E. H. Kemp, I. M. Feavers, P. J. Coote, and A. Moir. 2001. Localization of GerAA and GerAC germination proteins in the Bacillus subtilis spore. J. Bacteriol. 183:4317-4322.[Abstract/Free Full Text]
  40. 21
  41. Igarashi, T., B. Setlow, M. Paidhungat, and P. Setlow. 2004. Effects of a gerF (lgt) mutation on the germination of spores of Bacillus subtilis. J. Bacteriol. 186:2984-2991.[Abstract/Free Full Text]
  42. 22
  43. Igarashi, T., and P. Setlow. 2005. Interaction between individual protein components of the GerA and GerB nutrient receptors that trigger germination of Bacillus subtilis spores. J. Bacteriol. 187:2513-2518.[Abstract/Free Full Text]
  44. 23
  45. Ireland, J. A., and P. C. Hanna. 2002. Amino acid- and purine ribonucleoside-induced germination of Bacillus anthracis DeltaSterne endospores: gerS mediates responses to aromatic ring structures. J. Bacteriol. 184:1296-1303.[Abstract/Free Full Text]
  46. 24
  47. Ishikawa, S., K. Yamane, and J. Sekiguchi. 1998. Regulation and characterization of a newly deduced cell wall hydrolase gene (cwlJ) which affects germination of Bacillus subtilis spores. J. Bacteriol. 180:1375-1380.[Abstract/Free Full Text]
  48. 25
  49. Kokai-Kun, J. F., J. G. Songer, J. R. Czeczulin, F. Chen, and B. A. McClane. 1994. Comparison of Western immunoblots and gene detection assays for identification of potentially enterotoxigenic isolates of Clostridium perfringens. J. Clin. Microbiol. 32:2533-2539.[Abstract/Free Full Text]
  50. 26
  51. Lahti, P., A. Heikinheimo, T. Johansson, and H. Korkeala. 14 November 2007. Clostridium perfringens type A isolates carrying the plasmid-borne enterotoxin gene (genotypes IS1151-cpe or IS1470-like-cpe) are a common cause of food poisonings. J. Clin. Microbiol. doi:10.1128/JCM.01650-07.[Abstract/Free Full Text]
  52. 27
  53. Makino, S., N. Ito, T. Inoue, S. Miyata, and R. Moriyama. 1994. A spore-lytic enzyme released from Bacillus cereus spores during germination. Microbiology 140:1403-1410.[Abstract/Free Full Text]
  54. 28
  55. McClane, B. A. 2007. Clostridium perfringens, p. 423-444. In M. P. Doyle and L. R. Beuchat (ed.), Food microbiology: fundamentals and frontiers, 3rd ed. ASM Press, Washington, DC.
  56. 29
  57. Miyata, S., S. Kozuka, Y. Yasuda, Y. Chen, R. Moriyama, K. Tochikubo, and S. Makino. 1997. Localization of germination-specific spore-lytic enzymes in Clostridium perfringens S40 spores detected by immunoelectron microscopy. FEMS Microbiol. Lett. 152:243-247.[CrossRef][Medline]
  58. 30
  59. Miyata, S., R. Moriyama, K. Sugimoto, and S. Makino. 1995. Purification and partial characterization of a spore cortex-lytic enzyme of Clostridium perfringens S40 spores. Biosci. Biotechnol. Biochem. 59:514-515.[Medline]
  60. 31
  61. Moir, A., B. M. Corfe, and J. Behravan. 2002. Spore germination. Cell. Mol. Life Sci. 59:403-409.[CrossRef][Medline]
  62. 32
  63. Moir, A., E. H. Kemp, C. Robinson, and B. M. Corfe. 1994. The genetic analysis of bacterial spore germination. Soc. Appl. Bacteriol. Symp. Ser. 23:9S-16S.[Medline]
  64. 33
  65. Moir, A., and D. A. Smith. 1990. The genetics of bacterial spore germination. Annu. Rev. Microbiol. 44:531-553.[CrossRef][Medline]
  66. 34
  67. Myers, G. S., D. A. Rasko, J. K. Cheung, J. Ravel, R. Seshadri, R. T. DeBoy, Q. Ren, J. Varga, M. M. Awad, L. M. Brinkac, S. C. Daugherty, D. H. Haft, R. J. Dodson, R. Madupu, W. C. Nelson, M. J. Rosovitz, S. A. Sullivan, H. Khouri, G. I. Dimitrov, K. L. Watkins, S. Mulligan, J. Benton, D. Radune, D. J. Fisher, H. S. Atkins, T. Hiscox, B. H. Jost, S. J. Billington, J. G. Songer, B. A. McClane, R. W. Titball, J. I. Rood, S. B. Melville, and I. T. Paulsen. 2006. Skewed genomic variability in strains of the toxigenic bacterial pathogen, Clostridium perfringens. Genome Res. 16:1031-1040.[Abstract/Free Full Text]
  68. 35
  69. Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination and outgrowth, p. 391-450. In C. R. Harwood and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley and Sons, Chichester, United Kingdom.
  70. 36
  71. Paidhungat, M., K. Ragkousi, and P. Setlow. 2001. Genetic requirements for induction of germination of spores of Bacillus subtilis by Ca(2+)-dipicolinate. J. Bacteriol. 183:4886-4893.[Abstract/Free Full Text]
  72. 37
  73. Paidhungat, M., B. Setlow, W. B. Daniels, D. Hoover, E. Papafragkou, and P. Setlow. 2002. Mechanisms of induction of germination of Bacillus subtilis spores by high pressure. Appl. Environ. Microbiol. 68:3172-3175.[Abstract/Free Full Text]
  74. 38
  75. Paidhungat, M., B. Setlow, A. Driks, and P. Setlow. 2000. Characterization of spores of Bacillus subtilis which lack dipicolinic acid. J. Bacteriol. 182:5505-5512.[Abstract/Free Full Text]
  76. 39
  77. Paidhungat, M., and P. Setlow. 1999. Isolation and characterization of mutations in Bacillus subtilis that allow spore germination in the novel germinant D-alanine. J. Bacteriol. 181:3341-3350.[Abstract/Free Full Text]
  78. 40
  79. Paidhungat, M., and P. Setlow. 2000. Role of ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis. J. Bacteriol. 182:2513-2519.[Abstract/Free Full Text]
  80. 41
  81. Raju, D., P. Setlow, and M. R. Sarker. 2007. Antisense-RNA-mediated decreased synthesis of small, acid-soluble spore proteins leads to decreased resistance of Clostridium perfringens spores to moist heat and UV radiation. Appl. Environ. Microbiol. 73:2048-2053.[Abstract/Free Full Text]
  82. 42
  83. Riemann, H., and Z. J. Ordal. 1961. Germination of bacterial endospores with calcium and dipicolinic acid. Science 133:1703-1704.[Abstract/Free Full Text]
  84. 43
  85. Riesenman, P. J., and W. L. Nicholson. 2000. Role of the spore coat layers in Bacillus subtilis spore resistance to hydrogen peroxide, artificial UV-C, UV-B, and solar UV radiation. Appl. Environ. Microbiol. 66:620-626.[Abstract/Free Full Text]
  86. 44
  87. Rode, L. J., and J. W. Foster. 1962. Ionic germination of spores of Bacillus megaterium QM B 1551. Arch. Mikrobiol. 43:183-200.[CrossRef][Medline]
  88. 45
  89. Sarker, M. R., R. J. Carman, and B. A. McClane. 1999. Inactivation of the gene (cpe) encoding Clostridium perfringens enterotoxin eliminates the ability of two cpe-positive C. perfringens type A human gastrointestinal disease isolates to affect rabbit ileal loops. Mol. Microbiol. 33:946-958.[CrossRef][Medline]
  90. 46
  91. Sarker, M. R., R. P. Shivers, S. G. Sparks, V. K. Juneja, and B. A. McClane. 2000. Comparative experiments to examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid genes versus chromosomal enterotoxin genes. Appl. Environ. Microbiol. 66:3234-3240.[Abstract/Free Full Text]
  92. 47
  93. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolic repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA 54:704-711.[Free Full Text]
  94. 48
  95. Setlow, B., A. E. Cowan, and P. Setlow. 2003. Germination of spores of Bacillus subtilis with dodecylamine. J. Appl. Microbiol. 95:637-648.[CrossRef][Medline]
  96. 49
  97. Setlow, P. 2003. Spore germination. Curr. Opin. Microbiol. 6:550-556.[CrossRef][Medline]
  98. 50
  99. Setlow, P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J. Appl. Microbiol. 101:514-525.[CrossRef][Medline]
  100. 51
  101. Setlow, P., and E. A. Johnson. 2007. Spores and their significance, p. 35-68. In M. P. Doyle and L. R. Beuchat (ed.), Food microbiology: fundamentals and frontiers, 3rd ed. American Society for Microbiology, Washington, DC.
  102. 52
  103. Shimamoto, S., R. Moriyama, K. Sugimoto, S. Miyata, and S. Makino. 2001. Partial characterization of an enzyme fraction with protease activity which converts the spore peptidoglycan hydrolase (SleC) precursor to an active enzyme during germination of Clostridium perfringens S40 spores and analysis of a gene cluster involved in the activity. J. Bacteriol. 183:3742-3751.[Abstract/Free Full Text]
  104. 53
  105. Takeshi, K., Y. Ando, and K. Oguma. 1988. Germination of spores of Clostridium botulinum type G. J. Food Prot. 51:37-38.
  106. 54
  107. Vepachedu, V. R., and P. Setlow. 2005. Localization of SpoVAD to the inner membrane of spores of Bacillus subtilis. J. Bacteriol. 187:5677-5682.[Abstract/Free Full Text]
  108. 55
  109. Vepachedu, V. R., and P. Setlow. 2007. Role of SpoVA proteins in release of dipicolinic acid during germination of Bacillus subtilis spores triggered by dodecylamine or lysozyme. J. Bacteriol. 189:1565-1572.[Abstract/Free Full Text]
  110. 56
  111. Waites, W. M., and L. R. Wyatt. 1974. The effect of pH, germinants and temperature on the germination of spores of Clostridium bifermentans. J. Gen. Microbiol. 80:253-258.[Abstract/Free Full Text]
  112. 57
  113. Waters, M., A. Savoie, H. S. Garmory, D. Bueschel, M. R. Popoff, J. G. Songer, R. W. Titball, B. A. McClane, and M. R. Sarker. 2003. Genotyping and phenotyping of beta2-toxigenic Clostridium perfringens fecal isolates associated with gastrointestinal diseases in piglets. J. Clin. Microbiol. 41:3584-3591.[Abstract/Free Full Text]
  114. 58
  115. Zhao, Y., and S. B. Melville. 1998. Identification and characterization of sporulation-dependent promoters upstream of the enterotoxin gene (cpe) of Clostridium perfringens. J. Bacteriol. 180:136-142.[Abstract/Free Full Text]


Journal of Bacteriology, February 2008, p. 1190-1201, Vol. 190, No. 4
0021-9193/08/$08.00+0     doi:10.1128/JB.01748-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Paredes-Sabja, D., Udompijitkul, P., Sarker, M. R. (2009). Inorganic Phosphate and Sodium Ions Are Cogerminants for Spores of Clostridium perfringens Type A Food Poisoning-Related Isolates. Appl. Environ. Microbiol. 75: 6299-6305 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Setlow, P., Sarker, M. R. (2009). The protease CspB is essential for initiation of cortex hydrolysis and dipicolinic acid (DPA) release during germination of spores of Clostridium perfringens type A food poisoning isolates. Microbiology 155: 3464-3472 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Setlow, P., Sarker, M. R. (2009). GerO, a Putative Na+/H+-K+ Antiporter, Is Essential for Normal Germination of Spores of the Pathogenic Bacterium Clostridium perfringens. J. Bacteriol. 191: 3822-3831 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Setlow, P., Sarker, M. R. (2009). Role of GerKB in Germination and Outgrowth of Clostridium perfringens Spores. Appl. Environ. Microbiol. 75: 3813-3817 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Setlow, P., Sarker, M. R. (2009). SleC Is Essential for Cortex Peptidoglycan Hydrolysis during Germination of Spores of the Pathogenic Bacterium Clostridium perfringens. J. Bacteriol. 191: 2711-2720 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Bond, C., Carman, R. J., Setlow, P., Sarker, M. R. (2008). Germination of spores of Clostridium difficile strains, including isolates from a hospital outbreak of Clostridium difficile-associated disease (CDAD). Microbiology 154: 2241-2250 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Setlow, B., Setlow, P., Sarker, M. R. (2008). Characterization of Clostridium perfringens Spores That Lack SpoVA Proteins and Dipicolinic Acid. J. Bacteriol. 190: 4648-4659 [Abstract] [Full Text]  
  • Paredes-Sabja, D., Sarker, N., Setlow, B., Setlow, P., Sarker, M. R. (2008). Roles of DacB and Spm Proteins in Clostridium perfringens Spore Resistance to Moist Heat, Chemicals, and UV Radiation. Appl. Environ. Microbiol. 74: 3730-3738 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paredes-Sabja, D.
Right arrow Articles by Sarker, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paredes-Sabja, D.
Right arrow Articles by Sarker, M. R.