This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zaini, P. A.
Right arrow Articles by da Silva, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zaini, P. A.
Right arrow Articles by da Silva, A. M.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2008, p. 2368-2378, Vol. 190, No. 7
0021-9193/08/$08.00+0     doi:10.1128/JB.01495-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

The Iron Stimulon of Xylella fastidiosa Includes Genes for Type IV Pilus and Colicin V-Like Bacteriocins{triangledown} ,{dagger}

Paulo A. Zaini,1 Andréa C. Fogaça,1 Fernanda G. N. Lupo,1 Helder I. Nakaya,1 Ricardo Z. N. Vêncio,2,{ddagger} and Aline M. da Silva1*

Departamento de Bioquímica, Instituto de Química,1 Programa de Pós-Graduação Interunidades em Bioinformática, Universidade de São Paulo, São Paulo, Brazil2

Received 17 September 2007/ Accepted 8 January 2008


arrow
ABSTRACT
 
Xylella fastidiosa is the etiologic agent of a wide range of plant diseases, including citrus variegated chlorosis (CVC), a major threat to citrus industry. The genomes of several strains of this phytopathogen were completely sequenced, enabling large-scale functional studies. DNA microarrays representing 2,608 (91.6%) coding sequences (CDS) of X. fastidiosa CVC strain 9a5c were used to investigate transcript levels during growth with different iron availabilities. When treated with the iron chelator 2,2'-dipyridyl, 193 CDS were considered up-regulated and 216 were considered down-regulated. Upon incubation with 100 µM ferric pyrophosphate, 218 and 256 CDS were considered up- and down-regulated, respectively. Differential expression for a subset of 44 CDS was further evaluated by reverse transcription-quantitative PCR. Several CDS involved with regulatory functions, pathogenicity, and cell structure were modulated under both conditions assayed, suggesting that major changes in cell architecture and metabolism occur when X. fastidiosa cells are exposed to extreme variations in iron concentration. Interestingly, the modulated CDS include those related to colicin V-like bacteriocin synthesis and secretion and to functions of pili/fimbriae. We also investigated the contribution of the ferric uptake regulator Fur to the iron stimulon of X. fastidiosa. The promoter regions of the strain 9a5c genome were screened for putative Fur boxes, and candidates were analyzed by electrophoretic mobility shift assays. Taken together, our data support the hypothesis that Fur is not solely responsible for the modulation of the iron stimulon of X. fastidiosa, and they present novel evidence for iron regulation of pathogenicity determinants.


arrow
INTRODUCTION
 
When challenged with limiting iron concentrations such as those encountered in host tissues, pathogenic bacteria commonly manage iron homeostasis by releasing iron from intracellular reservoirs and increasing the expression of iron acquisition systems (73). This allows survival in an otherwise prohibiting environment, since iron is an essential cofactor for many proteins mediating electron transfer and redox reactions. Besides functioning as a barrier against pathogens, light control of free iron concentration within host tissues reduces the deleterious effects of iron overload, such as the generation of reactive oxygen species (78, 83). Strict control of iron metabolism is also observed for bacteria, and in most cases it is exerted by the ferric uptake regulator, Fur. When bound to Fe2+, this intracellular iron sensor is capable of binding to Fur boxes at operator sequences, blocking the transcription of genes involved in many cellular processes besides iron uptake (1). The description of the iron regulatory circuitry has recently increased in complexity due to the discovery of other transcriptional repressors and of small noncoding regulatory RNAs (23, 51, 82).

Many pathogenic bacteria have also evolved to couple the iron-limiting response to the expression of other virulence determinants, such as exotoxin A in Pseudomonas aeruginosa (47), pectinolytic enzymes in Erwinia chrysanthemi (76), type IV pili in Moraxella catarrhalis (48), and an adhesin in Staphylococcus aureus (11). These and other observations support the hypothesis that the iron concentration is sensed as an environmental signal to successfully establish an infection or colonization process (26, 58, 70, 78, 88).

Transcriptome and proteome analyses of microbes subjected to iron-restricted and iron-replete conditions are adding many genes to the iron stimulon (5, 21, 55, 86). These studies have also provided novel information on the dynamic nature of the iron stimulon, such as the growth phase-dependent response (54), the cross talk between regulons (56), and adaptation to particular conditions (24).

Despite the annotation of many genes related to iron metabolism and pathogenicity in the genomic sequences of different strains of the phytopathogen Xylella fastidiosa (79, 84), their function and regulation according to iron availability remain to be demonstrated. Here we report the analysis of steady-state levels of transcripts of this bacterium when subjected to iron-restricted and iron-replete conditions in order to describe its iron stimulon and its relation with virulence determinants. We also investigated the contribution of the ferric uptake regulator Fur to the iron stimulon of X. fastidiosa.


arrow
MATERIALS AND METHODS
 
Bacterial strain and growth conditions. X. fastidiosa strain 9a5c, isolated from symptomatic Citrus sinensis (L.) Osbeck trees with citrus variegated chlorosis (CVC) (44), was grown in periwinkle wilt (PW) (16) broth medium at 28°C with rotary agitation at 80 rpm. The total iron concentration in PW medium is in the range of 4.5 µM, as determined by inductively coupled plasma atomic emission spectrometry on a Spectro Ciros charge-coupled device (Spectro Analytical Instruments) (data not shown). The culture was maintained through weekly serial transfers at a 1/10 dilution in PW medium, for no longer than 12 weeks. Exponential-phase cells (7-day-old cultures) were subjected to iron limitation by the addition of 200 µM 2,2'-dipyridyl or to iron excess by the addition of 100 µM ferric pyrophosphate to 500-ml cultures. Aliquots (50 ml) of cell cultures were taken at each time point (0, 15, 60, 240, and 960 min), and cells were immediately harvested by centrifugation (3,000 x g, 4 min, 4°C); the culture medium was discarded, and the cells were immediately frozen on dry ice prior to RNA extraction.

RNA isolation and cDNA labeling. Total RNA was isolated with Trizol reagent (Invitrogen), and residual DNA was removed by treatment with 10 U of RQ1 RNase-free DNase I (Promega) and 40 U of the RNase inhibitor RNaseOUT (Invitrogen). RNA integrity was checked through denaturing agarose gel electrophoresis, and the lack of residual DNA was checked by PCR. Quantitations were performed on a NanoDrop ND-1000 spectrophotometer. Total RNA (20 µg) was reverse transcribed and labeled using the SuperScript indirect cDNA labeling system (Invitrogen) according to the manufacturer's instructions.

Microarray construction and hybridization. Microarray slides containing unique internal PCR-amplified fragments representing 2,608 X. fastidiosa 9a5c coding sequences (CDS) (91.6% of the total) spotted at least in duplicate were constructed as previously described (41) and hybridized by the method of reference 68.

Microarray data acquisition, filtering, normalization, and analysis. Microarray data analysis was performed according to reference 40. For each cell treatment (iron limitation or iron excess), two biological replicates were performed, using dye swap labeling, throughout five-point time series, resulting in at least 20 data points for each CDS before data filtering. We used intensity-dependent cutoff values for classifying a gene as differentially expressed based on self-self hybridization experiments, as previously described (41, 85). Briefly, the self-self approach consists of simultaneously hybridizing the cDNA from the control sample (growth in regular PW medium) labeled with either Alexa Fluor 555 or Alexa Fluor 647 to estimate the experimental noise. We used credibility intervals of 0.98, a window size of 1.0, and a window step of 0.2. A gene was classified as differentially expressed at a given time point if more than 50% of its replicates were outside the intensity-dependent cutoff curves, when at least two replicates were used.

RT-qPCR. Reverse transcription (RT) was carried out with 5 µg of X. fastidiosa total RNA primed with 500 ng of random hexamers using the SuperScript first-strand synthesis system (Invitrogen). One hundred nanograms of the resulting cDNA was subjected to quantitative PCR (qPCR) with 800 nM (each) of the forward and reverse primers and 10 µl of Platinum Sybr green qPCR SuperMix UDG (Invitrogen) on a GeneAmp 5700 system (Applied Biosystems) using the default thermocycler program for all genes. qPCR assays were performed in triplicate with the gene-specific primer pairs shown in Table S1 in the supplemental material from two biological replicas distinct from those performed for microarray analysis. Threshold values were normalized according to the threshold cycle of CDS XF2175 (dnaQ), which is expressed at similar levels under all conditions tested according to our microarray data and was also used previously (15, 40). The change in the expression of each gene was calculated using the 2–{Delta}{Delta}CT method (46).

Preparation of recombinant X. fastidiosa Fur. The complete CDS of fur (XF2344) was amplified from the genomic DNA of strain 9a5c with primers 5'TGAGAAGCATATGGAATTAAATGATTTACG and 5'CACGGTACCTCCACGACCGCGT. The 400-bp amplicon was purified from the agarose gel with a QIAquick gel extraction kit (Qiagen), digested with KpnI and NdeI, and ligated onto KpnI- and NdeI-linearized pET36b (Novagen). The ligation reaction product was electroporated into Escherichia coli BL21(DE3) cells (Invitrogen). The pET36b-Xf-Fur (pXf-Fur) construct was isolated from the kanamycin-resistant bacterial transformants, and the insert was sequenced on both strands. Molecular cloning and recombinant expression procedures were essentially as described elsewhere (2), unless otherwise noted. DNA sequencing was performed with BigDye Terminator mix, version 3.1 (Perkin-Elmer), on an ABI 377 DNA automated sequencer (Applied Biosystems).

E. coli BL21(DE3) cells transformed with pXf-Fur were grown in 50 ml LB medium (2) with 1% glucose and 40 µg/ml kanamycin to an optical density at 600 nm (OD600) of {approx}0.3. Cells were then harvested by centrifugation at 3,000 x g for 1 min, resuspended in 50 ml LB plus 0.3 mM isopropyl-β-D-thiogalactoside (IPTG), and grown for 3 h at 37°C. Following centrifugation at 3,000 x g for 3 min at 4°C, the cell pellet was resuspended in lysis buffer (20 mM Tris [pH 8.0], 2 mM MnCl2, 20 mM imidazole, 10% glycerol, 1 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride) and sonicated (Branson Sonifier) in an ice bath for five cycles of 10 s with 30-s intervals. The crude extract was centrifuged at 10,000 x g for 30 min at 4°C, and the supernatant fraction was subjected to standard Ni2+ affinity chromatography using nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant X. fastidiosa Fur (FurXf) was eluted with lysis buffer supplemented with 25 to 300 mM imidazole. Aliquots of purified recombinant FurXf were kept at –20°C and used within 2 weeks.

Protein concentrations were determined with the Bradford reagent (Bio-Rad). Recombinant protein expression and purification were monitored by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (42) followed by staining with Coomassie blue.

EMSA. The experimental procedure for electrophoretic mobility shift assays (EMSA) was modified from reference 18. DNA fragments of {approx}150 bp were amplified from the genomic DNA of X. fastidiosa strain 9a5c, E. coli BL21(DE3), or P. aeruginosa PA14 (kindly provided by R. Baldini, University of São Paulo, São Paulo, Brazil) with the following primers: Xf0009F (5'-TCTCATGCTATGGGAAAAGTTAAA), Xf0009R (5'-TGCCAATGGGCTCTATAACA), Xf0010F (5'-CCGTGTACCGGTCAATTTTT), Xf0010R (5'-CTGTGGCAACGATGAAAAGA), Xf0599F (5'-CCATTTTGATTACCTGACATCATT), Xf0599R (5'-CAGGGGGATGTAATGTCACC), Xf1712F (5'-AGAAATTGACGCATTGTTTCC), Xf1712R (5'-CCCAAAAGCATTGACCTGAT), Xf2344F (5'-CATCGGCTGACTAGGTCGTT), Xf2344R (5'-TAAACAAGAGGTCGCCTTGC), XF16SF (5'-GGTCTTGACATCTGCGGAACTT), XF16SR (5'-CAGCCATGCAGCACCTGTCT), Ec-fhuAF (5'-CCCTTTCTTTTCATCTGGTTG), Ec-fhuAR (5'-ACGCGCCATTGGTATATCTC), Pa-pvdSF (5'-TCTGAAACGCCGAAGAATTT), and Pa-pvdSR (5'-GTGGGGTAAGACCCACACAT).

The amplicons were purified in GFX columns (GE Healthcare) and then labeled with T4 polynucleotide kinase (Fermentas) and [{gamma}-32P]ATP according to the manufacturer's instructions.

For the DNA-protein interaction assays, 10 nM labeled DNA fragment was mixed with increasing concentrations of recombinant FurXf at 37°C for 20 min in ligation buffer (10 mM BisTris [pH 7.5], 5 µg/ml salmon sperm DNA, 10% glycerol, 100 µM MnCl2, 100 µg/ml bovine serum albumin,1 mM MgCl2, 40 mM KCl). Competition with a 60-fold concentration of "cold" DNA was performed for each assay. The reactions were resolved (90 min, 185 V) on native 5% polyacrylamide gels previously run at 185 V for 30 min in 400 mM BisTris (pH 7.5) supplemented with 2 mM MnCl2. Dried gels were exposed for 2 h to a Phosphor Screen (Molecular Dynamics), which was then scanned using Storm (Molecular Dynamics).

Computational search for X. fastidiosa Fur boxes. Predicted X. fastidiosa promoter regions (–350 to +50 bp of predicted traslation start sites) were retrieved from genomic sequence available at http://www.xylella.lncc.br/. This set was then interrogated with 112 Fur boxes characterized in other bacteria (see Table S2 in the supplemental material), using Cross_match (http://www.phrap.org/phredphrapconsed.html) requiring at least 11/19 hits. The putative FurXf boxes mapped to CDS down-regulated at high iron concentrations (HIC) were selected, and base frequencies at each position were determined with WebLogo (13).

Microarray data accession numbers. A detailed description of the microarray can be found in reference 41 and at NCBI's Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo) under accession number GPL2708. The complete data set is publicly available according to MIAME guidelines at the GEO database under accession numbers GSE5886 and GSE5888.


arrow
RESULTS AND DISCUSSION
 
X. fastidiosa transcriptome in response to iron availability. The transcriptional profile of X. fastidiosa citrus strain 9a5c in response to iron availability was assessed by incubating cells for different times (15, 60, 240, and 960 min) at HIC or low iron concentrations (LIC). Total RNA was isolated and labeled for hybridization to DNA microarrays comprising 91.6% of the CDS annotated in the genome of strain 9a5c (41, 79). As summarized in Table 1, 1,328 and 1,534 CDS were considered to be expressed at HIC and LIC, respectively. Of these CDS, 218 and 256 were classified as up- or down-regulated at HIC, while 193 and 216 were classified as up- or down-regulated at LIC, respectively. As shown in the Venn diagrams in Fig. 1, among the CDS classified as differentially expressed, 74 and 115 CDS, respectively, were up- or down regulated at both HIC and LIC. The identities of the differentially expressed CDS with their respective changes in expression are shown in Tables S3 to S8 in the supplemental material. In addition, transcriptome maps color coded according to the expression status (induction/repression/no change) of each CDS at HIC or LIC are available at the project website (http://verjo19.iq.usp.br/xylella/microarray/iron/).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Summary of microarray hybridization resultsa


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 1. Summary of differentially expressed CDS according to iron availability. Diagrams show the numbers of CDS up- and down-regulated at either HIC or LIC, as well as the numbers of CDS differentially expressed under both conditions (underlined).

It should be pointed out that exposure of X. fastidiosa cells to the iron chelator or to an excess of iron for 15, 60, 240, or 960 min did not considerably affect its growth rate in the time frame used in this study (Fig. 2). These treatments also did not alter cell viability, as assessed by immediately transferring cells to solid PW medium after each incubation time and allowing them to grow for 7 days (data not shown).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 2. Growth curves of X. fastidiosa 9a5c in PW medium at different iron availabilities. (A) Cells were cultured in PW medium, and OD600 was monitored every 24 h for 7 days, after which the culture was divided into three equal portions. (B) One portion received 200 µM 2,2'-dipyridyl (solid squares), the second received 100 µM ferric pyrophosphate (solid triangles), and the third was kept in regular PW medium as a control (solid circles). After 15, 60, 240, or 960 min, the OD for each culture was monitored. Curves show average OD readings from five independent experiments with standard deviations. Samples of cells under the three distinct conditions were taken at each time point shown and plated in solid PW medium in serial dilutions. After 7 days, growth was evaluated, and no difference was observed between samples under control, LIC, or HIC conditions (data not shown).

In order to validate our microarray data, transcript levels of a subset of 44 X. fastidiosa CDS were analyzed by RT-qPCR. This subset includes CDS related mainly to iron metabolism and/or pathogenesis whose transcripts appeared to be either up- or down-regulated at HIC or LIC according to microarray data. Figure 3 shows that the transcriptional profiles of CDS XF0371 and XF0290 at HIC and of XF0933 and XF1408 at LIC obtained by microarray experiments are in agreement with the RT-qPCR results. In addition, transcript levels of the 44 selected CDS were evaluated at a single time point after incubation of cells under HIC or LIC conditions (Table 2). Taken together, the microarray and RT-qPCR data for all 44 CDS presented an overall Pearson correlation of 0.77 (Fig. 4), which increased our confidence in the microarray data.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 3. Microarray data validation. Shown are expression profiles of selected CDS by microarray (open squares) and RT-qPCR (solid squares) from cells treated with 100 µM ferric pyrophosphate (left) or with 200 µM 2,2'-dipyridyl (right). In all plots, M stands for the log2 of normalized expression ratios (treatment/control).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Transcript levels of selected CDS analyzed by RT-qPCR


Figure 4
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 4. Overall correlation of the microarray and RT-qPCR data. Both axes show the log2 of normalized expression ratios (treatment/control). The methodologies showed a Pearson correlation of 0.77.

Functional classification of differentially expressed CDS. From the data presented above, we concluded that 685 CDS exhibited altered expression under at least one of the conditions studied (HIC or LIC). Among these, 285 were originally annotated as hypothetical or conserved hypothetical CDS (79). Using BlastX and Pfam tools, we reannotated and assigned putative functions to 55 of these CDS (see Table S9 in the supplemental material). We believe these observations will be useful for further studies on the biological roles of these previously assigned hypothetical CDS, which indeed are expressed in response to iron availability.

By examining the distribution of differentially expressed CDS into the functional categories according to the X. fastidiosa genome database, we observed that CDS involved with cell division, protein, and RNA and energy metabolism are enriched among the down-regulated CDS either at HIC or at LIC (Fig. 5). Repression of genes belonging to these categories has been detected in other bacteria subjected to similar conditions (3, 23, 63). In Bacillus subtilis, iron starvation repressed the expression of two cytochrome systems (cydABCD and qcrAB) and a number of genes encoding ribosomal proteins (3). Iron depletion also repressed genes encoding ribosomal proteins in Neisseria gonorrhoeae (23). Moreover, iron overload repressed cytochrome genes cyoABCDE in P. aeruginosa (63). These observations suggest that extreme changes in iron levels lead to a general decrease in bacterial metabolism. Despite this, we observed that exposure of X. fastidiosa cells to the iron chelator or to an excess of iron under our experimental conditions did not affect the growth rate or cell viability (Fig. 2).


Figure 5
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 5. Functional categorization of differentially expressed CDS. Shaded and open bars show the percentage of up-regulated CDS in each functional category when X. fastidiosa cells were exposed to either HIC or LIC, respectively. Hatched bars indicate the percentages of down-regulated CDS. Letters above bars represent functional categories as follows: A, degradation of small molecules (33 CDS); B, central intermediary metabolism (58 CDS); C, energy metabolism (92 CDS); D, regulatory functions (77 CDS); E, biosynthesis of small molecules (226 CDS); F, DNA metabolism (111 CDS); G, RNA metabolism (183 CDS); H, protein metabolism (85 CDS); I, metabolism of other macromolecules (17 CDS); J, cell structure (145 CDS); K, transport (141 CDS); L, cell division (25 CDS); M, mobile genetic elements (144 CDS); N, pathogenicity, virulence, and adaptation (147 CDS); O, hypothetical (1,534 CDS); P, undefined (24 CDS). The 55 reannotated CDS are included in category O in order to follow the original classification by Simpson et al. (79).

Among the 685 CDS differentially expressed when cells were incubated under HIC and/or LIC conditions (see Tables S3 to S8 in the supplemental material), we highlight those related to iron homeostasis, pathogenicity, and regulatory functions (Table 2). These groups of CDS are discussed in detail below.

Iron uptake, use, and storage. The X. fastidiosa genome encodes at least 67 CDS that are related to iron metabolism according to the previous annotation (79). As expected, many of these CDS presented changes in their transcript levels under HIC or LIC conditions (Table 2; see also Tables S3 to S8 in the supplemental material). After 15 min under conditions of iron shortage, increases in transcript levels for the receptors of free iron (feoAB) and of iron-complexed compounds (fiu) were detected by microarray hybridization (see Table S5 in the supplemental material). Up-regulation of these CDS at LIC was further confirmed by RT-qPCR (Table 2). On the other hand, transcripts encoding intracellular iron reservoirs were less abundant when cells were incubated under low-iron conditions, including the major iron storage protein, bacterioferritin, and other proteins containing iron-sulfur clusters such as RpfA, SdhB, ferredoxins, electron transfer proteins, and flavoproteins. A similar effect has been reported for Helicobacter pylori, in which transcripts for ferritin were down-regulated under iron limitation (6). Indeed, studies with several bacteria support the view that modulation of intracellular levels of iron-containing proteins in addition to the control of iron uptake maintains iron homeostasis (83).

Under the iron-replete condition, CDS XF0599 (similar to the Fiu receptor) and XF0550, which encodes a hypothetical protein similar to TonB-dependent receptors, were down-regulated (Table 2). In contrast, feoAB transcript levels were not affected. The expression pattern of fiu displays a typical Fur-regulated profile, that is, repression under iron-rich conditions and derepression in iron starvation. As will be discussed further, CDS XF0599 is a good example of a Fur-regulated gene in Xylella. Moreover, no differential expression was observed for any member of the TonB-ExbBD energy-transducing system (XF0009, XF0010, and XF0011) either at HIC or at LIC (data not shown), although Fur-mediated control of these CDS has been reported for other bacteria (8, 65, 71).

Our data showed that other CDS that contain iron or a Fe-S cluster were also down-regulated under iron overload, including qcrA (a component of cytochrome c) and cyoDCA (components of cytochrome o). As discussed above, repression of cytochrome components upon iron overload has also been described for P. aeruginosa (63). hemB was also repressed under this condition. HemB performs the second step in porphyrin and heme biosynthesis and is essential to soy symbiosis with Bradyrhizobium japonicum (10). These authors also propose that {delta}-aminolevulinic acid is the only heme-containing intermediate capable of being translocated from the plant to the endosymbiont.

In addition, rpfAB and mexB were down-regulated both at HIC and at LIC (see Table S8 in the supplemental material). rpfB (XF0287) encodes a long-chain fatty acyl coenzyme A (CoA) ligase that is involved in the synthesis of a diffusible signal factor, a molecule important for the pathogenicity of Xanthomonas campestris (4). rpfB expression is regulated by cell density in both Xanthomonas and Xylella, for which the existence of a diffusible signal factor has also been proposed (4, 12, 59, 77). MexB (XF2094) is a translocator inserted into the inner membrane that transports multiple drugs and cations through a complex also formed by MexA and OprM (61). In P. aeruginosa this gene is induced under iron-limiting conditions, and its product is possibly involved in pyoverdine secretion (69).

The hypothetical CDS XF1382 was also down-regulated under these conditions, and further investigations revealed the presence of a DPS domain (cd01043 [49]) also present in ferritin. Some DPS proteins bind to DNA nonspecifically, conferring protection from oxidative damage, and induction under iron-restricted conditions has also been reported (37).

Transcripts for bacterioferritin, encoded by XF0395, showed opposing results for microarray versus RT-qPCR experiments. The high expression levels observed under both conditions generated signals close to saturation, and this might have generated the discrepancy between the methodologies. RT-qPCR data suggest a positive regulation, in accordance with results observed for E. coli and P. aeruginosa (51, 89). In these bacteria, the small noncoding regulatory RNAs RyhB and PrrF anneal with different mRNAs including bfr and are themselves regulated by Fur, thus causing the observed "up-regulation" of transcripts under abundant iron conditions. In addition, the RNA chaperone Hfq (encoded by XF0089) was up-regulated at LIC (see Table S5 in the supplemental material). This chaperone is essential for the stability of RyhB in E. coli (50). In silico searches indicate that no RyhB or PrrF orthologs are encoded in the Xylella genome. However, we do not exclude the possibility of the existence of a functional analog, since RyhB and PrrF show no resemblance at the DNA sequence level.

Our data suggest that X. fastidiosa does not suffer oxidative stress under the iron-replete condition, since no induction of sodA was observed. In H. pylori, Fur-mediated control of sodB expression is used against oxidative stress (25). However, no sodB (Fe superoxide dismutase) ortholog has been identified in the Xylella genome (79). Curiously, members of the peroxiredoxin family of antioxidant peroxidases encoded in the Xylella genome, bcp (XF0961) and ahpCF (XF1530 to -31), were repressed under this condition, as were transcripts for thioredoxin, thioredoxin reductase (XF1990 and -1448), ferredoxin (XF1889), and organic hydroperoxide resistance protein (XF1827). In Staphylococcus aureus, bcp, ahcCF, and trxB (thioredoxin reductase) are controlled by PerR, a member of the Fur family also involved in sensing oxidative stress (36), but no PerR ortholog has been described for Xylella.

Pilus and fimbriae. Type IV pili are polymeric structures present on the cell surfaces of many bacteria. They exert diverse functions, such as adhesion to host surfaces and formation of cellular aggregates, and assist in cell movement (52). X. fastidiosa has functional type I and IV pili that participate in biofilm formation; the former promotes cell adhesion, while the latter is essential for cell motility (45, 53). Our data indicate that at LIC, CDS related to these apparatuses, pilVE, pilU, pilJ, and pilBR, were down-regulated (Table 2). At HIC, transcripts for pilUT and pilB were less abundant while transcripts for pilNOP and pilJIG were more abundant. In addition, under both conditions tested, the type I pilus components fimC and fimA were down-regulated. A fimA mutant of a Pearce's disease-causing strain exhibited a reduced size and number of fimbriae as well as reduced cell aggregation and size. However, this mutant still remained pathogenic to grapevines, corroborating the hypothesis that Xylella pathogenesis is multifactorial (28). It is not clear how and to what extent the alterations in transcript levels presented here modify the morphology and function of pili and fimbriae. The precise mechanism behind the transcriptional control of these CDS also remains unclear. Sigma-54 (RpoN) and its modulator RpoX (encoded by XF1408 and XF1407, respectively) might be involved in this response, since these two CDS were down-regulated under both HIC and LIC conditions (Table 2). Additionally, CDS XF1843, XF1848, and XF1849 were up-regulated. The latter two form a two-component system involved in the response to nitrogen, regulated by protein P-II (encoded by XF1843). When phosphorylated, NtrC (XF1848) activates sigma-54 (74). When inactive, sigma-54 is still capable of forming a closed complex with its target DNA sequences, blocking transcription by steric hindrance (20). In Vibrio fischeri and Dichelobacter nodosus, type IV pilus biogenesis requires sigma-54 (67, 90), and Pseudomonas rpoN mutants were significantly less virulent in multiple hosts (34). Type IV pilus-mediated twitching motility has been shown to be crucial for Xylella colonization of upstream vascular regions in planta (53), and here we show that iron is an environmental signal capable of modulating the transcriptional control of these virulence determinants.

Colicin V-like bacteriocins. Colicin V is a pore-forming toxin produced by E. coli that acts against closely related sensitive bacteria. Along with the toxin, encoded by cvaC, the system involves a production protein encoded by cvpA, activation and secretion proteins (CvaB and CvaA) that function assisted by TolC, and an immunity protein, Cvi (27, 33, 87, 91). In E. coli, cvaA, cvaB, cvaC, and cvi are carried by plasmid pColV-K30 (29), whereas in X. fastidiosa, these CDS are dispersed in two regions of the main chromosome (68, 79). According to our data, cvi (XF0261), cvaC (XF0262, XF0263, and XF0264), cvaA (XF1216), and cvaB (XF1220) transcripts are more abundant at both LIC and HIC than under control conditions (Table 2). Previous reports have shown the influence of intracellular iron levels on the expression of this toxin in E. coli (9). The CDS related to colicin V-like production are among the CDS most frequently expressed by Xylella, even under standard growth conditions in PW medium, suggesting that this toxin is a common weapon employed by this pathogen, possibly to counterbalance its slow growth and to allow efficient competition with other microorganisms within the xylem and insect foregut. In fact, cvaC was among the differentially expressed CDS identified in a study comparing X. fastidiosa freshly isolated from citrus plants with X. fastidiosa after several passages in axenic culture, highlighting the importance of cvaC in planta (22).

Transcriptional regulators. Our expression data indicate that transcriptional regulators of the MarR and LuxR families are modulated by iron in X. fastidiosa (Table 2; see also Tables S3 to S6 in the supplemental material). At LIC, transcript levels for CDS XF0216 and XF1354 were increased. XF0216 and XF1490 transcript levels also increased at HIC. All these CDS are members of the MarR family. Members of this family are widely distributed and regulate functions such as the synthesis of antibiotics and exoenzymes in Erwinia carotovora, antimicrobial factors in Serratia marcescens, and adhesins and invasion factors in Yersinia pseudotuberculosis (57, 81).

Another CDS up-regulated at LIC was XF0972, which encodes a LuxR-type regulator. The LuxR domain is present in many regulators that become phosphorylated by sensor members of two-component systems and are involved in a series of biological functions such as nitrogen fixation in Rhizobium meliloti, bioluminescence in V. fischeri, and sporulation in B. subtilis (39, 75, 80). Regulators with LuxR domains are also involved in quorum sensing by derivatives of homoserine lactones, and recently it was demonstrated that Erwinia carotovora ExpR activates the transcription of a global RNA regulator (14). Iron deprivation also caused reductions in transcript levels of the regulator pilR (XF2545). Orthologs of pilR are directly involved with type IV pilus biosynthesis (67), and its negative regulation may account for the lower transcript levels observed for other pil CDS observed under iron limitation.

Characterization of the Fur protein of X. fastidiosa. The ferric uptake regulator protein (Fur) is known to play a central role in iron homeostasis in the organisms for which large-scale expression data are available (3, 19, 63, 66). As more organisms are studied, however, other transcriptional regulators are proving to take part in the iron stimulon (23, 32, 38, 82).

To investigate how much of the iron stimulon is controlled by Fur in Xylella, we performed functional studies with the Fur protein and putative Fur boxes. A fur ortholog (FurXf) is present in the genome of strain 9a5c, and its predicted amino acid sequence shows 61% identity to that of P. aeruginosa Fur. Sequence alignment of FurXf (Fig. 6A) with other members of the Proteobacteria revealed the highly conserved motifs YRVLNQF and HHDH, which are important for targeting the DNA sequence (Fur box) and for binding to an Fe2+, respectively (30). Initial sequence alignment revealed an extra 28-residue N-terminal segment on FurXf that is not present in any of the Fur proteins in COG0735 (data not shown). Therefore, we concluded this to be a wrong assignment of the translational start and excluded it from further analysis. Hence, the sequence coding for the remaining 136 amino acids was used for preparation of the recombinant protein that was purified by His-tagged affinity chromatography (Fig. 6B).


Figure 6
View larger version (59K):
[in this window]
[in a new window]

  		FIG. 6. Characterization of recombinant FurXf. (A) Alignment of Fur proteins from different bacteria (all from GenBank): Xf, Xylella fastidiosa; Xcc, Xanthomonas campestris pv. campestris; Pa, Pseudomonas aeruginosa PAO1; Eca, Erwinia carotovora subsp. atroseptica SCRI1043; Ec, Escherichia coli K-12. Numbers 1 and 2 above the sequences indicate domains important for DNA and Fe2+ binding, respectively. (B) Purification of recombinant FurXf by Ni2+ affinity chromatography. Lane 1, 10 µg of the soluble fraction of a noninduced culture; lane 2, 10 µg of the soluble fraction of a culture induced with IPTG; lane 3, 10 µg of flowthrough; lanes 4 to 6, fractions eluted with 75, 100, and 150 mM imidazole, respectively. Arrow indicates recombinant FurXf.

Recombinant FurXf was then used in EMSA to check its binding to Fur box-like DNA sequences. Purified FurXf was initially assayed with the promoter regions of E. coli fhuA (fhuAEc) and P. aeruginosa pvdS (pvdSPa) (Fig. 7). Both CDS have been shown to be Fur regulated, and the corresponding Fur boxes have been determined (7, 62). The recognition of both Fur boxes by FurXf encouraged us to search for conserved Fur boxes in the strain 9a5c genome. A similarity search in the promoter regions of strain 9a5c using a collection of 112 Fur boxes characterized in other bacteria (see Table S2 in the supplemental material) retrieved 653 putative Xylella Fur boxes. Sixty-one candidates mapped within the promoter regions of 49 CDS negatively regulated at HIC. Among these CDS is XF0599, which encodes a putative TonB-dependent outer membrane receptor similar to E. coli Fiu. XF0599 is indeed a good example of Fur-mediated transcriptional regulation in X. fastidiosa, as we mentioned above. Along with the antagonism observed between its transcript levels and the iron concentration, its promoter region contains two Fur boxes with 13/19 and 14/19 perfect matches with the E. coli consensus 5'-GATAATGATAATCATTATC, which are also recognized by recombinant FurXf according to the EMSA for which results are shown in Fig. 7. Based on these results, a consensus was built from 36 putative Fur boxes similar to those found in the operator sequences of XF0599, fhuAEc, and pvdSPa (Fig. 8).


Figure 7
View larger version (49K):
[in this window]
[in a new window]

  		FIG. 7. EMSA of promoter regions and FurXf. In all assays, 10 nM labeled DNA was incubated with recombinant FurXf (0, 10 nM, 100 nM, 1 µM, 10 µM, and 10 µM in the presence of unlabeled DNA at a 60-fold excess [lanes 1 to 6, respectively]). The mobility shift seen with 10 µM FurXf (lane 5) was considered nonspecific, given that this amount caused some retardation of the DNA fragment from the 16S rRNA gene and of fragments from the promoter sequences of tonB (XF0009) and fur (XF2344), which show no evidence of Fur regulation based on microarray and RT-qPCR data plus in silico Fur box searches.


Figure 8
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 8. Sequence logo of the Fur box of X. fastidiosa 9a5c. Searches for Fur boxes in the Xylella genome were performed using 112 previously characterized Fur boxes listed in Table S2 in the supplemental material. The putative FurXf boxes that mapped to CDS down-regulated at HIC were selected, and a consensus was built from 36 putative Xylella Fur boxes similar to those found in the operator sequences of XF0599, fhuAEc, and pvdSPa. Base frequencies at each position were determined with WebLogo (13).

Our microarray data along with the Fur box searches suggest that only 20% of iron-regulated CDS are also Fur regulated in X. fastidiosa. Alternatively, other nonconserved Fur boxes might exist in this bacterium. Although other regulators may take part in the iron stimulon, the recognition of unknown target sequences by Fur cannot be excluded. On the other hand, several promoters containing consensus Fur boxes identified by bioinformatics searches appeared not to be regulated by iron or Fur in Campylobacter jejuni, indicating that the Fur box consensus needs experimental refinement in each case (35).

Despite the fact that tonB (XF0009) was not considered differentially expressed in our array experiments, its promoter region was also assayed for FurXf interaction, although no conserved Fur box was detected in it. As expected, no gel retardation was observed (Fig. 7). We also analyzed the promoter region of fur, since autoregulation has been reported in different bacterial species (17). No conserved Fur box was detected, and neither gel retardation nor differential expression was observed for X. fastidiosa fur (Fig. 7). Moreover, the furXf promoter is bidirectional. As previously pointed out (72), none of the bacteria where the omlA-fur context is conserved are capable of the otherwise frequently observed autoregulation of Fur.

Concluding remarks. Whole-genome transcriptome analysis has provided a wealth of information for organisms such as the citrus-infecting strains of X. fastidiosa, for which genetic tools are still in their infancy. By investigating the response of this bacterium to extreme variations in iron concentrations, we found that many CDS expected to be iron regulated were not significantly affected by the iron shift, such as hemolysin-like RTX toxins or the hemagglutinin-like secreted proteins previously shown to be involved in biofilm maturation within the xylem vessels (31). Interestingly, the iron stimulon of Xylella goes beyond uptake and storage systems, encompassing type IV pilus and colicin V production. This suggests that iron sensing might be important in the early stages of plant colonization, to activate systems that allow efficient translocation throughout xylem vessels and competition against endophytes, and not for biofilm formation. According to current models of biofilm formation by Xylella, cells initially multiply and adhere to each other and host surfaces; later, they synthesize fastidian gum and hemagglutinin-like adhesins for biofilm maturation, when vessel clogging occurs and symptoms become evident (43, 60, 64, 77). These findings warrant further studies in order to better understand the regulation of X. fastidiosa pathogenicity determinants as well as to evaluate their importance for its survival within both host and vector. Our results also indicate that although iron concentration influences the abundance of many transcripts, only a fraction of these transcripts appear to be directly regulated by Fur. Other transcriptional regulators are possibly involved, particularly those regulated by the iron shift. Combined transcriptome and proteome approaches (21, 86) are needed to verify whether Fur-independent regulation extends to the posttranscriptional level.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Tie Koide, Leandro M. Moreira, Suely L. Gomes, Sergio Verjovski-Almeida, and Phillip E. Klebba for suggestions and discussions. We also thank Adriana Y. Matsukuma for technical assistance.

This work was funded by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) to A. M. da Silva. P. A. Zaini, A. C. Fogaça, F. G. N. Lupo, and H. I. Nakaya received fellowships from FAPESP. A. M. da Silva was partially supported by CNPq.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Bioquímica, Instituto de Química, Universidade de São Paulo, Av. Prof. Lineu Prestes 748, 05508-000, São Paulo, SP, Brazil. Phone: 5511 3091-2182. Fax: 5511 3091-2186. E-mail: almsilva{at}iq.usp.br Back

{triangledown} Published ahead of print on 25 January 2008. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back

{ddagger} Present address: Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103-8904. Back


arrow
REFERENCES
 
    1
  1. Andrews, S. C., A. K. Robinson, and F. Rodriguez-Quinones. 2003. Bacterial iron homeostasis. FEMS Microbiol. Rev. 27:215-237.[CrossRef][Medline]
    2. 2
  2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, and K. Struhl. 1995. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, NY.
    3. 3
  3. Baichoo, N., T. Wang, R. Ye, and J. D. Helmann. 2002. Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Mol. Microbiol. 45:1613-1629.[CrossRef][Medline]
    4. 4
  4. Barber, C. E., J. L. Tang, J. X. Feng, M. Q. Pan, T. J. Wilson, H. Slater, J. M. Dow, P. Williams, and M. J. Daniels. 1997. A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol. Microbiol. 24:555-566.[CrossRef][Medline]
    5. 5
  5. Basler, M., I. Linhartova, P. Halada, J. Novotna, S. Bezouskova, R. Osicka, J. Weiser, J. Vohradsky, and P. Sebo. 2006. The iron-regulated transcriptome and proteome of Neisseria meningitidis serogroup C. Proteomics 6:6194-6206.[CrossRef][Medline]
    6. 6
  6. Bereswill, S., S. Greiner, A. H. van Vliet, B. Waidner, F. Fassbinder, E. Schiltz, J. G. Kusters, and M. Kist. 2000. Regulation of ferritin-mediated cytoplasmic iron storage by the ferric uptake regulator homolog (Fur) of Helicobacter pylori. J. Bacteriol. 182:5948-5953.[Abstract/Free Full Text]
    7. 7
  7. Berish, S. A., S. Subbarao, C. Y. Chen, D. L. Trees, and S. A. Morse. 1993. Identification and cloning of a fur homolog from Neisseria gonorrhoeae. Infect. Immun. 61:4599-4606.[Abstract/Free Full Text]
    8. 8
  8. Bjarnason, J., C. M. Southward, and M. G. Surette. 2003. Genomic profiling of iron-responsive genes in Salmonella enterica serovar Typhimurium by high-throughput screening of a random promoter library. J. Bacteriol. 185:4973-4982.[Abstract/Free Full Text]
    9. 9
  9. Boyer, A. E., and P. C. Tai. 1998. Characterization of the cvaA and cvi promoters of the colicin V export system: iron-dependent transcription of cvaA is modulated by downstream sequences. J. Bacteriol. 180:1662-1672.[Abstract/Free Full Text]
    10. 10
  10. Chauhan, S., and M. R. O'Brian. 1993. Bradyrhizobium japonicum {delta}-aminolevulinic acid dehydratase is essential for symbiosis with soybean and contains a novel metal-binding domain. J. Bacteriol. 175:7222-7227.[Abstract/Free Full Text]
    11. 11
  11. Clarke, S. R., M. D. Wiltshire, and S. J. Foster. 2004. IsdA of Staphylococcus aureus is a broad spectrum, iron-regulated adhesin. Mol. Microbiol. 51:1509-1519.[CrossRef][Medline]
    12. 12
  12. Colnaghi Simionato, A. V., D. S. da Silva, M. R. Lambais, and E. Carrilho. 2007. Characterization of a putative Xylella fastidiosa diffusible signal factor by HRGC-EI-MS. J. Mass Spectrom. 42:490-496.[CrossRef][Medline]
    13. 13
  13. Crooks, G. E., G. Hon, J. M. Chandonia, and S. E. Brenner. 2004. WebLogo: a sequence logo generator. Genome Res. 14:1188-1190.[Abstract/Free Full Text]
    14. 14
  14. Cui, Y., A. Chatterjee, H. Hasegawa, V. Dixit, N. Leigh, and A. K. Chatterjee. 2005. ExpR, a LuxR homolog of Erwinia carotovora subsp. carotovora, activates transcription of rsmA, which specifies a global regulatory RNA-binding protein. J. Bacteriol. 187:4792-4803.[Abstract/Free Full Text]
    15. 15
  15. da Silva Neto, J. F., T. Koide, S. L. Gomes, and M. V. Marques. 2007. The single extracytoplasmic-function sigma factor of Xylella fastidiosa is involved in the heat shock response and presents an unusual regulatory mechanism. J. Bacteriol. 189:551-560.[Abstract/Free Full Text]
    16. 16
  16. Davis, M., W. French, and N. Schaad. 1981. Axenic culture of the bacteria associated with phony disease of peach and plum leaf scald. Curr. Microbiol. 6:309-314.[CrossRef]
    17. 17
  17. Delany, I., R. Ieva, C. Alaimo, R. Rappuoli, and V. Scarlato. 2003. The iron-responsive regulator Fur is transcriptionally autoregulated and not essential in Neisseria meningitidis. J. Bacteriol. 185:6032-6041.[Abstract/Free Full Text]
    18. 18
  18. de Lorenzo, V., F. Giovannini, M. Herrero, and J. B. Neilands. 1988. Metal ion regulation of gene expression. Fur repressor-operator interaction at the promoter region of the aerobactin system of pColV-K30. J. Mol. Biol. 203:875-884.[CrossRef][Medline]
    19. 19
  19. Deng, K., R. J. Blick, W. Liu, and E. J. Hansen. 2006. Identification of Francisella tularensis genes affected by iron limitation. Infect. Immun. 74:4224-4236.[Abstract/Free Full Text]
    20. 20
  20. De Reuse, H., and M. K. Taha. 1997. RegF, an SspA homologue, regulates the expression of the Neisseria gonorrhoeae pilE gene. Res. Microbiol. 148:289-303.[Medline]
    21. 21
  21. Deslandes, V., J. H. Nash, J. Harel, J. W. Coulton, and M. Jacques. 2007. Transcriptional profiling of Actinobacillus pleuropneumoniae under iron-restricted conditions. BMC Genomics 8:72.[CrossRef][Medline]
    22. 22
  22. de Souza, A. A., M. A. Takita, H. D. Coletta-Filho, C. Caldana, G. H. Goldman, G. M. Yanai, N. H. Muto, R. C. de Oliveira, L. R. Nunes, and M. A. Machado. 2003. Analysis of gene expression in two growth states of Xylella fastidiosa and its relationship with pathogenicity. Mol. Plant-Microbe Interact. 16:867-875.[Medline]
    23. 23
  23. Ducey, T. F., M. B. Carson, J. Orvis, A. P. Stintzi, and D. W. Dyer. 2005. Identification of the iron-responsive genes of Neisseria gonorrhoeae by microarray analysis in defined medium. J. Bacteriol. 187:4865-4874.[Abstract/Free Full Text]
    24. 24
  24. Ernst, F. D., S. Bereswill, B. Waidner, J. Stoof, U. Mader, J. G. Kusters, E. J. Kuipers, M. Kist, A. H. van Vliet, and G. Homuth. 2005. Transcriptional profiling of Helicobacter pylori Fur- and iron-regulated gene expression. Microbiology 151:533-546.[Abstract/Free Full Text]
    25. 25
  25. Ernst, F. D., G. Homuth, J. Stoof, U. Mader, B. Waidner, E. J. Kuipers, M. Kist, J. G. Kusters, S. Bereswill, and A. H. van Vliet. 2005. Iron-responsive regulation of the Helicobacter pylori iron-cofactored superoxide dismutase SodB is mediated by Fur. J. Bacteriol. 187:3687-3692.[Abstract/Free Full Text]
    26. 26
  26. Expert, D. 1999. Withholding and exchanging iron: interactions between Erwinia spp. and their plant hosts. Annu. Rev. Phytopathol. 37:307-334.[CrossRef][Medline]
    27. 27
  27. Fath, M. J., H. K. Mahanty, and R. Kolter. 1989. Characterization of a purF operon mutation which affects colicin V production. J. Bacteriol. 171:3158-3161.[Abstract/Free Full Text]
    28. 28
  28. Feil, H., W. S. Feil, J. C. Detter, A. H. Purcell, and S. E. Lindow. 2003. Site-directed disruption of the fimA and fimF fimbrial genes of Xylella fastidiosa. Phytopathology 93:675-682.[CrossRef][Medline]
    29. 29
  29. Gilson, L., H. K. Mahanty, and R. Kolter. 1987. Four plasmid genes are required for colicin V synthesis, export, and immunity. J. Bacteriol. 169:2466-2470.[Abstract/Free Full Text]
    30. 30
  30. Gonzalez de Peredo, A., C. Saint-Pierre, J. M. Latour, I. Michaud-Soret, and E. Forest. 2001. Conformational changes of the ferric uptake regulation protein upon metal activation and DNA binding; first evidence of structural homologies with the diphtheria toxin repressor. J. Mol. Biol. 310:83-91.[CrossRef][Medline]
    31. 31
  31. Guilhabert, M. R., and B. C. Kirkpatrick. 2005. Identification of Xylella fastidiosa antivirulence genes: hemagglutinin adhesins contribute to X. fastidiosa biofilm maturation and colonization and attenuate virulence. Mol. Plant-Microbe Interact. 18:856-868.[Medline]
    32. 32
  32. Hamza, I., Z. Qi, N. D. King, and M. R. O'Brian. 2000. Fur-independent regulation of iron metabolism by Irr in Bradyrhizobium japonicum. Microbiology 146:669-676.[Abstract/Free Full Text]
    33. 33
  33. Håvarstein, L. S., H. Holo, and I. F. Nes. 1994. The leader peptide of colicin V shares consensus sequences with leader peptides that are common among peptide bacteriocins produced by gram-positive bacteria. Microbiology 140:2383-2389.[Abstract/Free Full Text]
    34. 34
  34. Hendrickson, E. L., J. Plotnikova, S. Mahajan-Miklos, L. G. Rahme, and F. M. Ausubel. 2001. Differential roles of the Pseudomonas aeruginosa PA14 rpoN gene in pathogenicity in plants, nematodes, insects, and mice. J. Bacteriol. 183:7126-7134.[Abstract/Free Full Text]
    35. 35
  35. Holmes, K., F. Mulholland, B. M. Pearson, C. Pin, J. McNicholl-Kennedy, J. M. Ketley, and J. M. Wells. 2005. Campylobacter jejuni gene expression in response to iron limitation and the role of Fur. Microbiology 151:243-257.[Abstract/Free Full Text]
    36. 36
  36. Horsburgh, M. J., M. O. Clements, H. Crossley, E. Ingham, and S. J. Foster. 2001. PerR controls oxidative stress resistance and iron storage proteins and is required for virulence in Staphylococcus aureus. Infect. Immun. 69:3744-3754.[Abstract/Free Full Text]
    37. 37
  37. Ishikawa, T., Y. Mizunoe, S. Kawabata, A. Takade, M. Harada, S. N. Wai, and S. Yoshida. 2003. The iron-binding protein Dps confers hydrogen peroxide stress resistance to Campylobacter jejuni. J. Bacteriol. 185:1010-1017.[Abstract/Free Full Text]
    38. 38
  38. Juhas, M., L. Wiehlmann, B. Huber, D. Jordan, J. Lauber, P. Salunkhe, A. S. Limpert, F. von Gotz, I. Steinmetz, L. Eberl, and B. Tummler. 2004. Global regulation of quorum sensing and virulence by VqsR in Pseudomonas aeruginosa. Microbiology 150:831-841.[Abstract/Free Full Text]
    39. 39
  39. Kahn, D., and G. Ditta. 1991. Modular structure of FixJ: homology of the transcriptional activator domain with the –35 binding domain of sigma factors. Mol. Microbiol. 5:987-997.[CrossRef][Medline]
    40. 40
  40. Koide, T., R. Z. Vencio, and S. L. Gomes. 2006. Global gene expression analysis of the heat shock response in the phytopathogen Xylella fastidiosa. J. Bacteriol. 188:5821-5830.[Abstract/Free Full Text]
    41. 41
  41. Koide, T., P. A. Zaini, L. M. Moreira, R. Z. Vencio, A. Y. Matsukuma, A. M. Durham, D. C. Teixeira, H. El-Dorry, P. B. Monteiro, A. C. da Silva, S. Verjovski-Almeida, A. M. da Silva, and S. L. Gomes. 2004. DNA microarray-based genome comparison of a pathogenic and a nonpathogenic strain of Xylella fastidiosa delineates genes important for bacterial virulence. J. Bacteriol. 186:5442-5449.[Abstract/Free Full Text]
    42. 42
  42. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
    43. 43
  43. Leite, B., M. L. Ishida, E. Alves, H. Carrer, S. F. Pascholati, and E. W. Kitajima. 2002. Genomics and X-ray microanalysis indicate that Ca2+ and thiols mediate the aggregation and adhesion of Xylella fastidiosa. Braz. J. Med. Biol. Res. 35:645-650.[Medline]
    44. 44
  44. Li, W. B., L. Zreik, N. G. Fernandes, V. S. Miranda, D. C. Teixeira, A. J. Ayres, M. Garnier, and J. M. Bov. 1999. A triply cloned strain of Xylella fastidiosa multiplies and induces symptoms of citrus variegated chlorosis in sweet orange. Curr. Microbiol. 39:106-108.[CrossRef][Medline]
    45. 45
  45. Li, Y. X., G. X. Hao, C. D. Galvani, Y. Z. Meng, L. De la Fuente, H. C. Hoch, and T. J. Burr. 2007. Type I and type IV pili of Xylella fastidiosa affect twitching motility, biofilm formation and cell-cell aggregation. Microbiology 153:719-726.[Abstract/Free Full Text]
    46. 46
  46. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–{Delta}{Delta}CT method. Methods 25:402-408.[CrossRef][Medline]
    47. 47
  47. Lory, S. 1986. Effect of iron on accumulation of exotoxin A-specific mRNA in Pseudomonas aeruginosa. J. Bacteriol. 168:1451-1456.[Abstract/Free Full Text]
    48. 48
  48. Luke, N. R., A. J. Howlett, J. Shao, and A. A. Campagnari. 2004. Expression of type IV pili by Moraxella catarrhalis is essential for natural competence and is affected by iron limitation. Infect. Immun. 72:6262-6270.[Abstract/Free Full Text]
    49. 49
  49. Marchler-Bauer, A., and S. H. Bryant. 2004. CD-Search: protein domain annotations on the fly. Nucleic Acids Res. 32:W327-W331.[Abstract/Free Full Text]
    50. 50
  50. Massé, E., F. E. Escorcia, and S. Gottesman. 2003. Coupled degradation of a small regulatory RNA and its mRNA targets in Escherichia coli. Genes Dev. 17:2374-2383.[Abstract/Free Full Text]
    51. 51
  51. Massé, E., and S. Gottesman. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 99:4620-4625.[Abstract/Free Full Text]
    52. 52
  52. Mattick, J. S. 2002. Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289-314.[CrossRef][Medline]
    53. 53
  53. Meng, Y., Y. Li, C. D. Galvani, G. Hao, J. N. Turner, T. J. Burr, and H. C. Hoch. 2005. Upstream migration of Xylella fastidiosa via pilus-driven twitching motility. J. Bacteriol. 187:5560-5567.[Abstract/Free Full Text]
    54. 54
  54. Merrell, D. S., L. J. Thompson, C. C. Kim, H. Mitchell, L. S. Tompkins, A. Lee, and S. Falkow. 2003. Growth phase-dependent response of Helicobacter pylori to iron starvation. Infect. Immun. 71:6510-6525.[Abstract/Free Full Text]
    55. 55
  55. Mey, A. R., E. E. Wyckoff, V. Kanukurthy, C. R. Fisher, and S. M. Payne. 2005. Iron and Fur regulation in Vibrio cholerae and the role of Fur in virulence. Infect. Immun. 73:8167-8178.[Abstract/Free Full Text]
    56. 56
  56. Michel, A., F. Agerer, C. R. Hauck, M. Herrmann, J. Ullrich, J. Hacker, and K. Ohlsen. 2006. Global regulatory impact of ClpP protease of Staphylococcus aureus on regulons involved in virulence, oxidative stress response, autolysis, and DNA repair. J. Bacteriol. 188:5783-5796.[Abstract/Free Full Text]
    57. 57
  57. Nagel, G., A. Lahrz, and P. Dersch. 2001. Environmental control of invasin expression in Yersinia pseudotuberculosis is mediated by regulation of RovA, a transcriptional activator of the SlyA/Hor family. Mol. Microbiol. 41:1249-1269.[CrossRef][Medline]
    58. 58
  58. Naikare, H., K. Palyada, R. Panciera, D. Marlow, and A. Stintzi. 2006. Major role for FeoB in Campylobacter jejuni ferrous iron acquisition, gut colonization, and intracellular survival. Infect. Immun. 74:5433-5444.[Abstract/Free Full Text]
    59. 59
  59. Newman, K. L., R. P. Almeida, A. H. Purcell, and S. E. Lindow. 2004. Cell-cell signaling controls Xylella fastidiosa interactions with both insects and plants. Proc. Natl. Acad. Sci. USA 101:1737-1742.[Abstract/Free Full Text]
    60. 60
  60. Newman, K. L., R. P. Almeida, A. H. Purcell, and S. E. Lindow. 2003. Use of a green fluorescent strain for analysis of Xylella fastidiosa colonization of Vitis vinifera. Appl. Environ. Microbiol. 69:7319-7327.[Abstract/Free Full Text]
    61. 61
  61. Ocaktan, A., H. Yoneyama, and T. Nakae. 1997. Use of fluorescence probes to monitor function of the subunit proteins of the MexA-MexB-OprM drug extrusion machinery in Pseudomonas aeruginosa. J. Biol. Chem. 272:21964-21969.[Abstract/Free Full Text]
    62. 62
  62. Ochsner, U. A., A. I. Vasil, and M. L. Vasil. 1995. Role of the ferric uptake regulator of Pseudomonas aeruginosa in the regulation of siderophores and exotoxin A expression: purification and activity on iron-regulated promoters. J. Bacteriol. 177:7194-7201.[Abstract/Free Full Text]
    63. 63
  63. Ochsner, U. A., P. J. Wilderman, A. I. Vasil, and M. L. Vasil. 2002. GeneChip expression analysis of the iron starvation response in Pseudomonas aeruginosa: identification of novel pyoverdine biosynthesis genes. Mol. Microbiol. 45:1277-1287.[CrossRef][Medline]
    64. 64
  64. Osiro, D., L. A. Colnago, A. M. Otoboni, E. G. Lemos, A. A. de Souza, H. D. Coletta Filho, and M. A. Machado. 2004. A kinetic model for Xylella fastidiosa adhesion, biofilm formation, and virulence. FEMS Microbiol. Lett. 236:313-318.[CrossRef][Medline]
    65. 65
  65. Osorio, C. R., M. L. Lemos, and V. Braun. 2004. Identification of Fur regulated genes in the bacterial fish pathogen Photobacterium damselae ssp. piscicida using the Fur titration assay. Biometals 17:725-733.[CrossRef][Medline]
    66. 66
  66. Palyada, K., D. Threadgill, and A. Stintzi. 2004. Iron acquisition and regulation in Campylobacter jejuni. J. Bacteriol. 186:4714-4729.[Abstract/Free Full Text]
    67. 67
  67. Parker, D., R. M. Kennan, G. S. Myers, I. T. Paulsen, J. G. Songer, and J. I. Rood. 2006. Regulation of type IV fimbrial biogenesis in Dichelobacter nodosus. J. Bacteriol. 188:4801-4811.[Abstract/Free Full Text]
    68. 68
  68. Pashalidis, S., L. M. Moreira, P. A. Zaini, J. C. Campanharo, L. M. Alves, L. P. Ciapina, R. Z. Vencio, E. G. Lemos, A. M. Da Silva, and A. C. Da Silva. 2005. Whole-genome expression profiling of Xylella fastidiosa in response to growth on glucose. Omics 9:77-90.[CrossRef][Medline]
    69. 69
  69. Poole, K., D. E. Heinrichs, and S. Neshat. 1993. Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine. Mol. Microbiol. 10:529-544.[CrossRef][Medline]
    70. 70
  70. Poole, K., and G. A. McKay. 2003. Iron acquisition and its control in Pseudomonas aeruginosa: many roads lead to Rome. Front. Biosci. 8:d661-d686.[Medline]
    71. 71
  71. Postle, K. 1990. Aerobic regulation of the Escherichia coli tonB gene by changes in iron availability and the fur locus. J. Bacteriol. 172:2287-2293.[Abstract/Free Full Text]
    72. 72
  72. Quatrini, R., C. Lefimil, D. S. Holmes, and E. Jedlicki. 2005. The ferric iron uptake regulator (Fur) from the extreme acidophile Acidithiobacillus ferrooxidans. Microbiology 151:2005-2015.[Abstract/Free Full Text]
    73. 73
  73. Ratledge, C., and L. G. Dover. 2000. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 54:881-941.[CrossRef][Medline]
    74. 74
  74. Reitzer, L., and B. L. Schneider. 2001. Metabolic context and possible physiological themes of {sigma}54-dependent genes in Escherichia coli. Microbiol. Mol. Biol. Rev. 65:422-444.[Abstract/Free Full Text]
    75. 75
  75. Sacco, M., E. Ricca, R. Losick, and S. Cutting. 1995. An additional GerE-controlled gene encoding an abundant spore coat protein from Bacillus subtilis. J. Bacteriol. 177:372-377.[Abstract/Free Full Text]
    76. 76
  76. Sauvage, C., and D. Expert. 1994. Differential regulation by iron of Erwinia chrysanthemi pectate lyases—pathogenicity of iron transport regulatory (Cbr) mutants. Mol. Plant-Microbe Interact. 7:71-77.
    77. 77
  77. Scarpari, L. M., M. R. Lambais, D. S. Silva, D. M. Carraro, and H. Carrer. 2003. Expression of putative pathogenicity-related genes in Xylella fastidiosa grown at low and high cell density conditions in vitro. FEMS Microbiol. Lett. 222:83-92.[CrossRef][Medline]
    78. 78
  78. Schaible, U. E., and S. H. Kaufmann. 2004. Iron and microbial infection. Nat. Rev. Microbiol. 2:946-953.[CrossRef][Medline]
    79. 79
  79. Simpson, A. J., F. C. Reinach, P. Arruda, F. A. Abreu, M. Acencio, R. Alvarenga, L. M. Alves, J. E. Araya, G. S. Baia, C. S. Baptista, M. H. Barros, E. D. Bonaccorsi, S. Bordin, J. M. Bove, M. R. Briones, M. R. Bueno, A. A. Camargo, L. E. Camargo, D. M. Carraro, H. Carrer, N. B. Colauto, C. Colombo, F. F. Costa, M. C. Costa, C. M. Costa-Neto, L. L. Coutinho, M. Cristofani, E. Dias-Neto, C. Docena, H. El-Dorry, A. P. Facincani, A. J. Ferreira, V. C. Ferreira, J. A. Ferro, J. S. Fraga, S. C. Franca, M. C. Franco, M. Frohme, L. R. Furlan, M. Garnier, G. H. Goldman, M. H. Goldman, S. L. Gomes, A. Gruber, P. L. Ho, J. D. Hoheisel, M. L. Junqueira, E. L. Kemper, J. P. Kitajima, J. E. Krieger, E. E. Kuramae, F. Laigret, M. R. Lambais, L. C. Leite, E. G. Lemos, M. V. Lemos, S. A. Lopes, C. R. Lopes, J. A. Machado, M. A. Machado, A. M. Madeira, H. M. Madeira, C. L. Marino, M. V. Marques, E. A. Martins, E. M. Martins, A. Y. Matsukuma, C. F. Menck, E. C. Miracca, C. Y. Miyaki, C. B. Monteriro-Vitorello, D. H. Moon, M. A. Nagai, A. L. Nascimento, L. E. Netto, A. Nhani, Jr., F. G. Nobrega, L. R. Nunes, M. A. Oliveira, M. C. de Oliveira, R. C. de Oliveira, D. A. Palmieri, A. Paris, B. R. Peixoto, G. A. Pereira, H. A. Pereira, Jr., J. B. Pesquero, R. B. Quaggio, P. G. Roberto, V. Rodrigues, A. J. de Magalhães, Rosa, V. E. de Rosa, Jr., R. G. de Sá, R. V. Santelli, H. E. Sawasaki, A. C. da Silva, A. M. da Silva, F. R. da Silva, W. A. da Silva, Jr., J. F. da Silveira, et al. 2000. The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406:151-157.[CrossRef][Medline]
    80. 80
  80. Sitnikov, D. M., J. B. Schineller, and T. O. Baldwin. 1995. Transcriptional regulation of bioluminesence genes from Vibrio fischeri. Mol. Microbiol. 17:801-812.[CrossRef][Medline]
    81. 81
  81. Thomson, N. R., A. Cox, B. W. Bycroft, G. S. Stewart, P. Williams, and G. P. Salmond. 1997. The rap and hor proteins of Erwinia, Serratia and Yersinia: a novel subgroup in a growing superfamily of proteins regulating diverse physiological processes in bacterial pathogens. Mol. Microbiol. 26:531-544.[CrossRef][Medline]
    82. 82
  82. Todd, J. D., M. Wexler, G. Sawers, K. H. Yeoman, P. S. Poole, and A. W. Johnston. 2002. RirA, an iron-responsive regulator in the symbiotic bacterium Rhizobium leguminosarum. Microbiology 148:4059-4071.[Abstract/Free Full Text]
    83. 83
  83. Touati, D. 2000. Iron and oxidative stress in bacteria. Arch. Biochem. Biophys. 373:1-6.[CrossRef][Medline]
    84. 84
  84. Van Sluys, M. A., M. C. de Oliveira, C. B. Monteiro-Vitorello, C. Y. Miyaki, L. R. Furlan, L. E. Camargo, A. C. da Silva, D. H. Moon, M. A. Takita, E. G. Lemos, M. A. Machado, M. I. Ferro, F. R. da Silva, M. H. Goldman, G. H. Goldman, M. V. Lemos, H. El-Dorry, S. M. Tsai, H. Carrer, D. M. Carraro, R. C. de Oliveira, L. R. Nunes, W. J. Siqueira, L. L. Coutinho, E. T. Kimura, E. S. Ferro, R. Harakava, E. E. Kuramae, C. L. Marino, E. Giglioti, I. L. Abreu, L. M. Alves, A. M. do Amaral, G. S. Baia, S. R. Blanco, M. S. Brito, F. S. Cannavan, A. V. Celestino, A. F. da Cunha, R. C. Fenille, J. A. Ferro, E. F. Formighieri, L. T. Kishi, S. G. Leoni, A. R. Oliveira, V. E. Rosa, Jr., F. T. Sassaki, J. A. Sena, A. A. de Souza, D. Truffi, F. Tsukumo, G. M. Yanai, L. G. Zaros, E. L. Civerolo, A. J. Simpson, N. F. Almeida, Jr., J. C. Setubal, and J. P. Kitajima. 2003. Comparative analyses of the complete genome sequences of Pierce's disease and citrus variegated chlorosis strains of Xylella fastidiosa. J. Bacteriol. 185:1018-1026.[Abstract/Free Full Text]
    85. 85
  85. Vêncio, R. Z., and T. Koide. 2005. HTself: self-self based statistical test for low replication microarray studies. DNA Res. 12:211-214.[Abstract/Free Full Text]
    86. 86
  86. Wan, X. F., N. C. Verberkmoes, L. A. McCue, D. Stanek, H. Connelly, L. J. Hauser, L. Wu, X. Liu, T. Yan, A. Leaphart, R. L. Hettich, J. Zhou, and D. K. Thompson. 2004. Transcriptomic and proteomic characterization of the Fur modulon in the metal-reducing bacterium Shewanella oneidensis. J. Bacteriol. 186:8385-8400.[Abstract/Free Full Text]
    87. 87
  87. Waters, V. L., and J. H. Crosa. 1991. Colicin V virulence plasmids. Microbiol. Rev. 55:437-450.[Abstract/Free Full Text]
    88. 88
  88. Whitmire, J. M., H. Gancz, and D. S. Merrell. 2007. Balancing the double-edged sword: metal ion homeostasis and the ulcer bug. Curr. Med. Chem. 14:469-478.[CrossRef][Medline]
    89. 89
  89. Wilderman, P. J., N. A. Sowa, D. J. FitzGerald, P. C. FitzGerald, S. Gottesman, U. A. Ochsner, and M. L. Vasil. 2004. Identification of tandem duplicate regulatory small RNAs in Pseudomonas aeruginosa involved in iron homeostasis. Proc. Natl. Acad. Sci. USA 101:9792-9797.[Abstract/Free Full Text]
    90. 90
  90. Wolfe, A. J., D. S. Millikan, J. M. Campbell, and K. L. Visick. 2004. Vibrio fischeri {sigma}54 controls motility, biofilm formation, luminescence, and colonization. Appl. Environ. Microbiol. 70:2520-2524.[Abstract/Free Full Text]
    91. 91
  91. Wu, K. H., and P. C. Tai. 2004. Cys32 and His105 are the critical residues for the calcium-dependent cysteine proteolytic activity of CvaB, an ATP-binding cassette transporter. J. Biol. Chem. 279:901-909.[Abstract/Free Full Text]

Journal of Bacteriology, April 2008, p. 2368-2378, Vol. 190, No. 7
0021-9193/08/$08.00+0     doi:10.1128/JB.01495-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zaini, P. A.
Right arrow Articles by da Silva, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zaini, P. A.
Right arrow Articles by da Silva, A. M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»