Previous Article | Next Article 
Journal of Bacteriology, April 2008, p. 2572-2579, Vol. 190, No. 7
0021-9193/08/$08.00+0 doi:10.1128/JB.01248-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
"Candidatus Cloacamonas Acidaminovorans": Genome Sequence Reconstruction Provides a First Glimpse of a New Bacterial Division
,
Eric Pelletier,1,2,¶
Annett Kreimeyer,1,2,¶
Stéphanie Bocs,1,2,
Zoé Rouy,1,2
Gábor Gyapay,1,2
Rakia Chouari,1,2,
Delphine Rivière,1,2,3,4
Akila Ganesan,1,2
Patrick Daegelen,1,2
Abdelghani Sghir,1,2,3
Georges N. Cohen,5
Claudine Médigue,1,2
Jean Weissenbach,1,2,3 and
Denis Le Paslier1,2*
CEA/Genoscope,1
CNRS-UMR8030,2
Université d'Evry Val d'Essonne, 91057 Evry, France,3
Suez-Environnement CIRSEE, 78230 Le Pecq, France,4
Institut Pasteur, 75015 Paris, France5
Received 2 August 2007/
Accepted 14 January 2008

ABSTRACT
Many microorganisms live in anaerobic environments. Most of
these microorganisms have not yet been cultivated. Here, we
present, from a metagenomic analysis of an anaerobic digester
of a municipal wastewater treatment plant, a reconstruction
of the complete genome of a bacterium belonging to the WWE1
candidate division. In silico proteome analysis indicated that
this bacterium might derive most of its carbon and energy from
the fermentation of amino acids, and hence, it was provisionally
classified as "
Candidatus Cloacamonas acidaminovorans." "
Candidatus Cloacamonas acidaminovorans" is probably a syntrophic bacterium
that is present in many anaerobic digesters. This report highlights
how environmental sequence data might provide genomic and functional
information about a new bacterial clade whose members are involved
in anaerobic digestion.

INTRODUCTION
The use of molecular techniques over the past few decades has
shown the extent of microbial diversity and that the majority
of archaeal and bacterial phyla still lack a cultivable representative
(
18,
24). The recent advent of whole-community genome sequencing,
or metagenomics, is rapidly changing this view and will revolutionize
our understanding of the functional diversity of complex environments.
For instance, a recent study has surprisingly revealed that
ammonia-oxidizing
Crenarchaeota are very abundant in soils (
20).
However, apart from the pioneering work in the Sargasso Sea
(
31) and the recent addition of millions of sequences from the
Global Ocean Sampling expedition that revealed the extent of
the ocean microbial diversity (
25), most of the community sequencing
programs have focused on relatively simple ecosystems. However,
most microbial ecosystems are complex. Anaerobic digestion is
a complex biological process that involves several metabolic
pathways for the decomposition of organic matter into methane
and carbon dioxide. The overall reactions—depolymerization,
primary and secondary fermentation, acidogenesis, acetogenesis,
and methanogenesis—are performed by a complex microbial
community. Despite the industrial, technological, economic,
and ecological importance of this community, little is known
about the roles and activities of the microorganisms that inhabit
anaerobic niches. The anaerobic digestion of organic matter
involved in wastewater processing represents a good example
of a complex and active microflora. During exploration of the
bacterial diversity of an anaerobic mesophilic digester, a new
bacterial candidate division called WWE1 was discovered (
8).
It was found that WWE1 bacteria could represent up to 10% of
the bacterial microflora and thus could be a subdominant group.
Using metagenomic sequence data and a specific genome assembly
procedure, we were able to reconstruct the genome of a representative
bacterium of the WWE1 division. We have for the first time obtained
the complete genome sequence from a complex environment and
from a bacterial candidate division with no cultivated representative.
Because the metabolic pathways of anaerobic bacteria are less
well known than those of aerobes, we focused our analysis on
the presence of enzymes typical of an anoxic lifestyle and on
the metabolic capabilities of the bacterium. This analysis revealed
that the bacterium uses principally fermentation processes as
its carbon and energy sources. It was provisionally classified
as "
Candidatus Cloacamonas acidaminovorans." Finally, the gene
content suggests that "
Candidatus Cloacamonas acidaminovorans"
could be a hydrogen-producing syntroph. The availability of
the genomic sequence, as well as genomic clones, of uncultivated
bacteria is of the utmost importance for further functional
studies and analysis of their metabolic potentials.

MATERIALS AND METHODS
Metagenomic library.
The sludge sample was obtained from an anaerobic mesophilic
digester (7,000 m
3) at the Evry wastewater treatment plant (250,000
population equivalents), located about 35 km south of Paris,
France (48°37' 33.65"N, 2°27'53.34"E). The digester
temperature was 33°C, the pH was 7.2, and the retention
time was 39 ± 10 days. Sampling was performed on 18 March
2002. Total genomic DNA was extracted as described previously
(
28) and then sheared by repeated pipetting until the majority
of DNA fragments were 50 kb in mean size. These DNA fragments
were gel purified using pulsed-field gel electrophoresis and
cloned using the EpiFOS and the CopyControl fosmid library production
kits (Epicenter, Madison, WI) following the manufacturer's protocols.
A total of 45 DNA ligations and 119 packagings were performed
(Gigapack; Stratagene Europe, Amsterdam, The Netherlands). The
resulting library contained 1 million fosmids. Terminal fosmid
end sequences (FES) were systematically determined using standard
methods and filtered for low-quality bases. Each FES was trimmed
from both ends until the first base had exhibited a Phred quality
greater than 15, and only sequences with a remaining length
of at least 300 bp were retained for subsequent analysis. A
total of 1,741,439 reads (1.12 Gb) were obtained, with a mean
size of 633 bp, and 82% of the fosmid clones had both ends sequenced.
Small-subunit rRNA screening and sequencing.
Fosmid DNA was extracted from 27,648 clones (384 x 72) and spotted in duplicate onto 20- by 20-cm nylon membranes (Hybond N+; GE Healthcare Europe GmbH, Saclay, France). The membranes were successively hybridized with 32P-labeled complex 16S rRNA gene probe mixtures. The probes were either the Eub338 (I, II, and III) oligonucleotide probes (9) or mixtures of 16S rRNA gene PCR products representative of the different archaeal and bacterial lineages described in the wastewater treatment plant of Evry (6, 7, 8). Positive clones were picked, and their 16S rRNA genes were sequenced using internal primers SSM-8F (5' AGAGTTTGATCCTGGCTCAG 3'), TTM-330F (5' ACTCCTACGGGAGGCAGC 3'), ADM-1110R (5' GCAACGAGCGCAACCC 3'), and ACM-1517R (5' GGGCCTTGTACACACCG 3').
"Candidatus Cloacamonas acidaminovorans" genome reconstruction.
An iterative assembly process was set up to allow genomic extension. The first iteration was initiated with a given seed sequence as the query and the complete FES resource, while the subsequent iterations used a selection of contigs generated by the previous iteration as query sequences At each iteration, FES were assigned on the query sequences if they shared more than 99% nucleic acid identity over at least 90% of the length of the read. Assigned FES constituted the pool of sequences to be assembled for this iteration. Existing paired FES of the assigned FES were then added to the pool of sequences to be assembled, which was subjected to standard assembly (Phrap 0.990319 [http://www.phrap.org/]). After assembly, contigs larger than 1,500 bp and constituted of at least eight FES were selected as query sequences for the next cycle. Iterations were stopped when no new sequences were added to the pool of FES to be assembled compared with the pool from the previous iteration. An overview of this iterative assembly process is illustrated in Fig. 1.
WWE1 and "Candidatus Cloacamonas acidaminovorans" PCR detection and quantification.
16S rRNA sequences for WWE1 were obtained after PCR amplification
with Pla46F (5' GGATTAGGCATGCAAGTC 3') and 1181R (5' CTTCCTCTGCGTTGTTAC
3'), as described previously (
8). "
Candidatus Cloacamonas acidaminovorans"
16S rRNA gene was amplified with 18F (5' AGTGTTAATGGTTGAGAG
3') or 25F (5' GCTATTCACGGAAGTGAGTAGTGTT 3') and 1181R. As these
two primer pairs could also amplify "
Candidatus Cloacamonas
acidaminovorans"-like bacteria, a set of "
Candidatus Cloacamonas
acidaminovorans"-specific primers was developed. Oligonucleotides
were chosen in intergenic regions that were larger than 800
bp or in intergenic regions larger than 200 bp flanking a gene
ranging in size from 300 to 800 bp. A total of 180 "
Candidatus Cloacamonas acidaminovorans"-specific regions were found. A
set of 40 regions was used for further analysis, and finally,
30 specific PCR primer pairs, well spaced on the "
Candidatus Cloacamonas acidaminovorans" genome, were used to confirm the
presence of the bacterium in DNA extracted from digester sludge
and enrichment cultures (see Table S1 in the supplemental material
for a complete list and sequences of oligonucleotides). After
testing several "primer couple-probe" systems, the following
were retained for quantitative PCR experiments: Cloam1554-Cloam_23s_1,
forward (5' ATACTCTGCGAAATCTGCGTAAAC 3') and reverse (5' GATGGTACTGCACGGGCAAC
3'), and a Taqman probe (5' AGTAGGTCGCCGCCATCGCTAACG 3').
Genome annotation.
Gene prediction was conducted using AMIGene software (4). A total of 1,820 coding sequences (CDSs) were predicted (and assigned a unique identifier prefixed with "Cloam") and subjected to automatic functional annotation (2, 30). Sequence data for comparative analyses were obtained from the NCBI data bank (RefSeq and WGS [whole-genome shotgun] sections). Putative orthologs and groups of neighbor orthologs were computed between "Candidatus Cloacamonas acidaminovorans" and all other complete genomes as previously described (30). All the data were stored in a relational database called CloacamonaScope, which is publicly available (http://www.genoscope.cns.fr/agc/mage).
Enrichment of "Candidatus Cloacamonas acidaminovorans."
The medium used for the enrichment of "Candidatus Cloacamonas acidaminovorans" was a synthetic medium in which lysine (25 x 10–3 M) served as the carbon source. The other medium components were Na2HPO4·12H2O (3.1 x 10–2 M), KH2PO4 (2.5 x 10–2 M), MgSO4·7H2O (8 x 10–4 M), FeSO4·7H2O (1.8 x 10–6 M), CaCl2·2H2O (4.1 x 10–4 M); the amino acids leucine, isoleucine, valine, threonine, methionine, proline, arginine, histidine, phenylalanine, cysteine (each at a concentration of 10–4 M), and tryptophan (2 x 10–5 M); and the cofactors DL-pantothenate (2 x 10–6 M), biotin (10–8 M), p-aminobenzoate, pyridoxine hydrochloride, thiamine hydrochloride, lipoic acid, hematin, spermidine (the last six at a concentration of 10–6 M), coenzyme B12 (10–7 M), S-adenosylmethionine (10–7 M), resazurin (0.001% [vol/vol]), and dithiothionate (10–4 M). The amino acids and the cofactors were freshly prepared, filter sterilized, and added to the medium after being autoclaved. The pH was adjusted to 7.0 with KOH (1 M). The headspace was flushed with nitrogen (2 atm). The enrichments were maintained in 100-ml serum vials containing 50 ml of the medium and inoculated with the digester sludge (1% [vol/vol]). The vials were incubated at 33°C in the dark without agitation. Growth of "Candidatus Cloacamonas acidaminovorans" was followed by optical density measurements and PCR amplification with 16S rRNA gene-specific primers and the set of "Candidatus Cloacamonas acidaminovorans"-specific oligonucleotides (see Table S1 in the supplemental material).
Nucleotide sequence accession number.
The "Candidatus Cloacamonas acidaminovorans" nucleotide sequence and annotation data have been deposited in the EMBL data bank under accession number CU466930.

RESULTS
Reconstruction of the complete genome of a WWE1 bacterium, "Candidatus Cloacamonas acidaminovorans."
WWE1 is a recently characterized candidate division deeply branching
from the
Spirochaetes. Dot blot hybridization and fluorescence
in situ hybridization analysis have shown that WWE1 bacteria
are one of the subdominant groups in several anaerobic digesters
(
8). As part of a metagenomic project, we investigated the presence
and diversity of the WWE1 bacteria. Sludge samples were obtained
from a full-scale anaerobic mesophilic digester located in the
municipal wastewater treatment plant in Evry, France. Hybridization
screening of a subset of a fosmid library constructed from this
sludge revealed that 10% of the 16S rRNA gene-containing fosmids
(64/599 clones) were affiliated with the WWE1 division. The
16S rRNA genes of these fosmids were classified into four phylotypes
(based on a 97% identity threshold). In order to evaluate their
genomic diversity, we fully shotgun sequenced 33 of the fosmids.
In addition, we systematically determined the FES from the library
and identified overlapping fosmids under the above-mentioned
stringent matching criteria. The sequence of a phylotype 1 fully
shotgun-sequenced fosmid (clone TCI) was found densely covered
with FES (10- to 12-fold in terms of sequence coverage) and
prompted us to reconstruct the complete tentative genome sequence
of a representative bacterium of division WWE1.
An iterative assembly process was set up (see Materials and Methods) and applied starting from the phylotype 1 TCI fosmid insert sequence. After 31 iterations, the process stopped gathering new FES, and a scaffold was obtained. Completion and circularization of the genome sequence of phylotype 1 ("Candidatus Cloacamonas acidaminovorans") was achieved by standard finishing techniques using fosmid clones as a matrix for PCR amplification and/or direct sequencing.
When applied to fosmids not affiliated with phylotype 1, the iterative assembly process failed to significantly extend the seed contig. Since "Candidatus Cloacamonas acidaminovorans" was not obtained in pure culture, it is difficult to check whether the reconstructed genome is a composite one. However, its reconstruction was probably made possible because of the extremely low sequence polymorphism (1.7 x 10–4) of the "Candidatus Cloacamonas acidaminovorans" dominant phylotype within the WWE1 population, as computed from the occurrence frequency of high-quality individual-read bases of "Candidatus Cloacamonas acidaminovorans" assigned FES differing from the consensus genome sequence.
Genome assembly robustness assessment.
Genome assembly robustness was assessed using fosmid coverage coherence (the relative orientation and spacing of the two FES of each clone localized). From the 1,741,439 available FES, 38,709 reads (2.2%, representing a cumulative 24,998,287 bp, that is, a mean genome coverage of 10.9) coming from 21,621 distinct fosmid clones were localized on the "Candidatus Cloacamonas acidaminovorans" genome using the above-mentioned criteria. Among those clones, 17,088 had their two FES localized. Only a few fosmids seemed to have incoherent features in regard to the "Candidatus Cloacamonas acidaminovorans" genome (172 of 199 rejected clones had one of the extremities localized more than one time [repeated regions], 21 had their end sequences in an incorrect orientation, and 6 were inconsistent in size). The 16,889 correctly localized fosmids allowed us to compute a clone coverage (with a mean value of 302.6 covering clones per base) showing no gap, with a minimum value of 4 over a 507-bp region. The 27 clones displaying incoherent pair end localization on the genome (either incorrect orientation or an insert size out of the normal fosmid range) were neither colocalized nor overlapping and matched in regions otherwise covered by several coherently positioned inserts. On the other hand, the 172 clones with multiply positioned ends were clustered, with all the ambiguous ends corresponding to a repeated region, and therefore were validated during the finishing of the genome. As, after reconstruction, the genome sequence of "Candidatus Cloacamonas acidaminovorans" was subjected to standard finishing, the impact of these reads on the structure of the sequence was carefully examined and ruled out.
Two percent of the (complete) FES library was assigned to the "Candidatus Cloacamonas acidaminovorans" genome, suggesting that the prevalence of the genome in this environment is quite low. It should, however, be noted that FES prevalence as defined gives only an approximation, as the number is dependent on (i) the complete genome size and (ii) the possible cloning biases.
"Candidatus Cloacamonas acidaminovorans" genome properties.
The genome of "Candidatus Cloacamonas acidaminovorans" is represented by a single circular chromosome consisting of 2,246,820 nucleotides with a GC content of 37.9% (Fig. 2). We do not know if "Candidatus Cloacamonas acidaminovorans" harbors any plasmid. Two rRNA operons (5S, 16S, and 23S) were identified, together with two small noncoding RNA genes (ssrS, encoding a 6S RNA, and rnpB, encoding the RNA moiety of RNase P). A total of 47 tRNA genes representing all amino acids were annotated. Although only four insertion sequences were found, the fraction of repeated sequences was quite high (8.4%). One of these corresponded to a prophagic region (34.7 kb in length; Cloam0195-0237 and Cloam0474-0509) and displayed a strong GC percent deviation (Fig. 2) and an atypical codon usage compared to the rest of the genome (see Fig. S1 in the supplemental material). Moreover, two large clustered regularly interspaced short palindromic repeats (CRISPR) (12.4 and 6 kb) (17) have been identified. CRISPR, together with associated cas genes, have been found in the majority of bacterial genera and are ubiquitous in Archaea. They provide resistance against phages (3, 5, 21). These regions are free of coding sequences and could be partly responsible for the atypical "Candidatus Cloacamonas acidaminovorans" GC skew (not shown). "Candidatus Cloacamonas acidaminovorans" has a rather low density of protein coding sequences (81%). Among the 1,820 predicted genes, 926 (51%) were assigned a probable biological function. Some 163 (9%) were similar to proteins with unknown functions, and 731 (40%) were unique to "Candidatus Cloacamonas acidaminovorans" (Table 1) . The percentage of genes found in groups of colocalized orthologs shared with other bacteria was generally very small (the maximum value was 15.6%, obtained with Pelobacter carbinolicus) (see Table S2 in the supplemental material), showing that the "Candidatus Cloacamonas acidaminovorans" genome is remote from known microbial genomes. The highest proportion of orthologs was found with anaerobic bacteria, such as Kuenenia stuttgartiensis, Geobacter metallireducens, and Thermoanaerobacter tengcongensis (see Table S2 in the supplemental material). The genetic information necessary for self-maintenance and reproduction in the presence of a full complement of essential nutrients (13) seemed to be present in "Candidatus Cloacamonas acidaminovorans" (see Table S3 in the supplemental material for a detailed analysis) and supported the tentative reconstruction of the present genome assembly. Some interesting features of the "Candidatus Cloacamonas acidaminovorans" genome were noted. First, it harbors proteins with sequences that are more related to their eukaryotic than their prokaryotic counterparts. For example, Cloam0177 is highly similar to the ftdD gene of rat, mouse, and human (identity of 40% on the total length of the protein), a bifunctional enzyme involved in histidine degradation (glutamate formimidoyltransferase fused with formimidoyltetrahydrofolate cyclodeaminase). Secondly, it uses pyrophosphate-dependent enzymes: fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) and pyruvate-phosphate dikinase (EC 2.7.9.1). Finally, the presence of the enzymes involved in the biosynthesis of lipopolysaccharides indicates that "Candidatus Cloacamonas acidaminovorans" is a gram-negative bacterium. This is further confirmed by the detection of the typical signature of gram-negative bacteria found in the dnaK gene (15).
Metabolism.
"
Candidatus Cloacamonas acidaminovorans" does not possess the
enzymes necessary for the synthesis of 12 amino acids: leucine,
isoleucine, valine, threonine, methionine, proline, arginine,
histidine, phenylalanine, tyrosine, tryptophan, and cysteine.
Moreover, it cannot produce polyamines and several cofactors:
thiamine, biotin, lipoic acid, pyrroloquinolinequinone, coenzyme
B12, folic acid, pyridoxine, and heme. Thus, all these compounds
must be obtained from the environment. The in silico proteome
analysis suggests that "
Candidatus Cloacamonas acidaminovorans"
could grow on a medium that includes glucose, alanine, asparagine,
aspartate, glutamate, histidine, lysine, proline, serine, and
certain aliphatic carboxylic acids (succinate, lactate, and
acetate).
Since "Candidatus Cloacamonas acidaminovorans" possesses several proteins typical of anaerobic bacteria (the oxygen-sensitive class III ribonucleoside triphosphate reductase, several ferredoxin oxidoreductases, and radical S-adenosylmethionine-dependent proteins), it seems to be adapted to an anaerobic lifestyle (Table 2; see Table S4 in the supplemental material). However, the presence of the aerotolerant class II ribonucleotide reductase and some enzymes involved in protection against oxidative stress (i.e., superoxide reductase, ruberythrin, and thioredoxin reductase) may enable the bacterium to survive under minimal oxygen concentrations (Table 2).
No electron transfer chain necessary for respiration was found
in "
Candidatus Cloacamonas acidaminovorans," and none of the
classical terminal electron acceptors of anaerobic bacteria
appeared to be used. Therefore, the bacterium seems to get its
energy through the glycolytic Embden-Meyerhof pathway and the
fermentation of amino acids, sugars, and carboxylic acids, as
well as by the excretion of protons and sodium ions coupled
with the reaction of the hydrogenase, the pyrophosphate-energized
proton pump, and the methylmalonyl-coenzyme A (CoA) decarboxylase,
respectively (Table
2). This protein catalyzes a reaction characteristic
of anaerobic prokaryotes. ATP synthesis is performed by a membrane-bound
ATP synthase. More than 30 proteases and peptidases were identified.
"
Candidatus Cloacamonas acidaminovorans" derives most of its
carbon and nitrogen sources from the degradation of proteins.
In addition, the bacterium possesses five different ferredoxin
oxidoreductases, which are principally involved in the fermentation
process of amino acids (Table
2). Among these processes, the
best identified was the lysine fermentation pathway. In fact,
all the enzymes of this pathway except one have been detected.
In contrast, the exact outcome of the fermentation of the other
amino acids is unknown. These catabolic-degradation pathways
are generally coupled with substrate level phosphorylation (ATP
formation) and synthesis of reductants, mainly ferredoxins.
Most of these ferredoxins are shared with anaerobic bacteria,
known or not, to develop syntrophic interactions (see Table
S4 in the supplemental material).
Besides these reducing agents, "Candidatus Cloacamonas acidaminovorans" possesses a remarkable variety of redoxins (thioredoxin, rubredoxin, glutaredoxin, peroxiredoxin, and polyferredoxin). They principally act as hydrogen donors for the reduction of metabolites and of disulfide bonds in proteins and also function as electron carriers for the hydrogenase to form hydrogen. "Candidatus Cloacamonas acidaminovorans" possesses one Fe-only hydrogenase and one putative Fe-only hydrogenase. In addition, an association of another putative hydrogenase with a putative formate dehydrogenase was detected. This complex might function as a simple type of formate hydrogen lyase, generating CO2 and H2 from formate (14). Figure 3 highlights the metabolic specificities likely to be used by "Candidatus Cloacamonas acidaminovorans."
A characteristic metabolic pathway in obligate syntrophic bacteria
is the oxidation of propionate into acetate and carbon dioxide
via methylmalonyl-CoA, succinate, fumarate, malate, oxaloacetate,
pyruvate, and acetyl-CoA as intermediates (
26). This pathway
is thermodynamically favorable only when hydrogen pressure is
low. Thus, propionate-oxidizing bacteria form syntrophic consortia
with hydrogen-scavenging bacteria, such as methanogenic, sulfate-reducing,
and acetogenic bacteria (
1,
22). All the genes involved in this
pathway have been identified in "
Candidatus Cloacamonas acidaminovorans."
One step, the carboxylation of propionyl-CoA, is coupled with
the decarboxylation of oxaloacetate by means of a transcarboxylase.
This protein consists of three subunits: 12S, 5S, and 1.3S.
Interestingly, the two genes encoding the 5S and the 1.3S subunit
were fused. The presence of the oxidative propionate degradation
pathway in "
Candidatus Cloacamonas acidaminovorans," as well
as the ability of the bacterium to produce hydrogen via fermentation
and its Fe-only hydrogenases, makes it likely that "
Candidatus Cloacamonas acidaminovorans" is a syntrophic bacterium. Furthermore,
compared to the other sequenced microbial genomes, the largest
groups of colocalized orthologous genes with "
Candidatus Cloacamonas
acidaminovorans" were found in
P. carbinolicus,
Syntrophobacter fumaroxidans, and
Syntrophus aciditrophicus (see Table S2 in
the supplementary material), which are known to develop syntrophic
interactions (
10,
23,
27).
Detection and culture enrichment.
Trials of enrichment cultures of "Candidatus Cloacamonas acidaminovorans" from activated sludge obtained from the anaerobic digester of Evry were carried out using a synthetic growth medium in which lysine served as a carbon and energy source (see Materials and Methods). A number of experiments were set up in order to obtain enrichment cultures of "Candidatus Cloacamonas acidaminovorans." Although "Candidatus Cloacamonas acidaminovorans" was still detectable in some cases after 1 year of cultivation, quantitative PCR assays showed no detectable increase in the "Candidatus Cloacamonas acidaminovorans" cell numbers.
Moreover, "Candidatus Cloacamonas acidaminovorans" had disappeared or at least had become undetectable by PCR in the digester of Evry at the time (July 2005) we started enrichment cultures. The presence of these bacteria was then checked for monthly. One year later, "Candidatus Cloacamonas acidaminovorans" reappeared. This phenomenon was also observed in another digester (in Creil, France).
The presence of WWE1 and "Candidatus Cloacamonas acidaminovorans" bacteria was checked for by PCR on DNAs extracted from 43 anaerobic digesters (19; see Table S5 in the supplemental material). In addition to a few pilot or laboratory scale digesters, most of them were industrial installations processing wastewater with different amounts of industrial wastes. While WWE1 bacteria were detected in 32 anaerobic digesters, "Candidatus Cloacamonas acidaminovorans" was found in 13 of them. WWE1 and "Candidatus Cloacamonas acidaminovorans" bacteria thus seem to be widespread in anaerobic digesters.

DISCUSSION
Complete reconstruction of the genomes of uncultivated microorganisms
remains a challenge, and the majority of the hundred or so bacterial
divisions (
11) are still known only from their 16S rRNA gene
sequences. In a few cases, nearly complete genomes were obtained
after shotgun sequencing of enrichment cultures (
12,
28), symbionts
(
16,
32), or environmental samples (
29), but in these studies,
the predominant microorganisms represented at least 60% of the
microbial population. Reconstructing a genome from a large metagenomic
library requires several conditions, such as (i) limited intraspecies
variation (
29), as genome rearrangement can severely interfere
with the iterative process; (ii) sufficient genome coverage
in the metagenomic library to allow the assembly step; and (iii)
availability of a large clone library with long inserts in order
to allow efficient genome walking through the iterations and
to prevent problems due to the presence of repeats in the genome
sequence. Consequently, this iterative approach is limited to
only a subset of genomes of a given metagenomic study. In this
report, we present for the first time the genome reconstruction
and analysis of an uncultivated bacterium from a candidate bacterial
division that is not predominant in a complex environment. The
"
Candidatus Cloacamonas acidaminovorans" genome represents 2%
of the FES generated from the studied anaerobic digester. The
availability of the complete "
Candidatus Cloacamonas acidaminovorans"
genome gives us the opportunity to investigate the metabolic
potential of this anaerobic bacterium. However, we have seen
that "
Candidatus Cloacamonas acidaminovorans," but not the WWE1
bacteria, disappeared for long periods from two of the studied
digesters, which raises questions about their respective roles
in anaerobic digestion.
This achievement suggests that it should be possible to recover partial or entire microbial genomes from diverse complex environments. This could become an interesting way to circumvent cultivation or enrichment difficulties.
Genome analysis has shown that "Candidatus Cloacamonas acidaminovorans" has a large proportion of genes of unknown function and a low percentage of genes found in groups of colocalized orthologs shared with other species. "Candidatus Cloacamonas acidaminovorans" and WWE1 bacteria are remote from known microbial genomes. In silico proteome analysis suggests that "Candidatus Cloacamonas acidaminovorans" is probably a syntrophic bacterium. However, despite the fact that "Candidatus Cloacamonas acidaminovorans" survived for a 1-year period in some cultures, we have not yet been able to enrich or isolate the bacterium or any other representative of the WWE1 candidate division. The selective enrichment of "Candidatus Cloacamonas acidaminovorans" was also unsuccessfully tried in a stable mixed culture with potential syntrophic partners, such as Desulfovibrio desulfuricans and Methanobacterium formicicum. Perhaps the syntrophic partners of "Candidatus Cloacamonas acidaminovorans" are microorganisms that have not yet been cultivated.
WWE1 bacteria in general and "Candidatus Cloacamonas acidaminovorans" in particular were detected in a number of anaerobic digesters. An extension of the investigation to many other digesters and also to diverse anaerobic environments, such as sediments and soils, should be worthwhile, allowing us to gain a better knowledge of WWE1 bacteria and "Candidatus Cloacamonas acidaminovorans" obligate companions.

ACKNOWLEDGMENTS
This study was partly supported by a grant from the European
Union for Research project WIRES (EVK1-CT2000-00050) and by
MRT/ACI IMPBio 2004.
We are very grateful to Susan Cure for reading the manuscript, to Stephane Cruveiller for help in preparing the figures, to the Genoscope sequencing team for the sequence data, and to P. Camacho, D. Dehon, S. Frenette, P. Ginestet, J. J. Godon, and S. Trouvé for providing sludge samples.

FOOTNOTES
* Corresponding author. Mailing address: CEA/Genoscope, CNRS-UMR8030, 2 rue Gaston Crémieux, 91057 Evry, France. Phone: 33 1 60 87 25 98. Fax: 33 1 60 87 25 14. E-mail:
denis{at}genoscope.cns.fr 
Published ahead of print on 1 February 2008. 
Supplemental material for this article may be found at http://jb.asm.org/. 
¶ E.P. and A.K. contributed equally to this work. 
Present address: UMR DAP-CIRAD, 34398 Montpellier Cedex 5, France. 
Present address: Faculté des Sciences de Bizerte, 7021 Zarzouna, Bizerte, Tunisia. 

REFERENCES
1 - Ariesyady, H. D., T. Ito, K. Yoshiguchi, and S. Okabe. 2007. Phylogenetic and functional diversity of propionate-oxidizing bacteria in an anaerobic digester sludge. Appl. Microbiol. Biotechnol. 75:673-683.[CrossRef][Medline]
2 - Barbe, V., D. Vallenet, N. Fonknechten, A. Kreimeyer, S. Oztas, L. Labarre, S. Cruveiller, C. Robert, S. Duprat, P. Wincker, L. N. Ornston, J. Weissenbach, P. Marlière, G. N. Cohen, and C. Médigue. 2004. Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium. Nucleic Acids Res. 32:5766-5779.[Abstract/Free Full Text]
3 - Barrangou, R., C. Fremaux, H. Deveau, M. Richards, P. Boyaval, S. Moineau, D. A. Romero, and P. Horvath. 2007. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709-1712.[Abstract/Free Full Text]
4 - Bocs, S., S. Cruveiller, D. Vallenet, G. Nuel, and C. Médigue. 2003. AMIGene: Annotation of MIcrobial Genes. Nucleic Acids Res. 31:3723-3726.[Abstract/Free Full Text]
5 - Bolotin, A., B. Quinquis, A. Sorokin, and S. D. Ehrlich. 2005. Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151:2551-2561.[Abstract/Free Full Text]
6 - Chouari, R., D. Le Paslier, P. Daegelen, P. Ginestet, J. Weissenbach, and A. Sghir. 2003. Molecular evidence for novel planctomycete diversity in a municipal wastewater treatment plant. Appl. Environ. Microbiol. 69:7354-7363.[Abstract/Free Full Text]
7 - Chouari, R., D. Le Paslier, P. Daegelen, P. Ginestet, J. Weissenbach, and A. Sghir. 2005. Novel predominant archaeal and bacterial groups revealed by molecular analysis of an anaerobic sludge digester. Environ. Microbiol. 7:1104-1115.[CrossRef][Medline]
8 - Chouari, R., D. Le Paslier, C. Dauga, P. Daegelen, J. Weissenbach, and A. Sghir. 2005. Novel major bacterial candidate division within a municipal anaerobic sludge digester. Appl. Environ. Microbiol. 71:2145-2153.[Abstract/Free Full Text]
9 - Daims, H., A. Bruhl, R. Amann, K. H. Schleifer, and M. Wagner. 1999. The domain-specific probe EUB338 is insufficient for the detection of all Bacteria: development and evaluation of a more comprehensive probe set. Syst. Appl. Microbiol. 22:434-444.[Medline]
10 - de Bok, F. A., M. L. Luijten, and A. J. Stams. 2002. Biochemical evidence for formate transfer in syntrophic propionate-oxidizing cocultures of Syntrophobacter fumaroxidans and Methanospirillum hungatei. Appl. Environ. Microbiol. 68:4247-4252.[Abstract/Free Full Text]
11 - DeSantis, T. Z., P. Hugenholtz, N. Larsen, M. Rojas, E. L. Brodie, K. Keller, T. Huber, D. Dalevi, P. Hu, and G. L. Andersen. 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72:5069-5072.[Abstract/Free Full Text]
12 - Garcia Martin, H., N. Ivanova, V. Kunin, F. Warnecke, K. W. Barry, A. C. McHardy, C. Yeates, S. He, A. A. Salamov, E. Szeto, E. Dalin, N. H. Putnam, H. J. Shapiro, J. L. Pangilinan, I. Rigoutsos, N. C. Kyrpides, L. L. Blackall, K. D. McMahon, and P. Hugenholtz. 2006. Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities. Nat. Biotechnol. 24:1263-1269.[CrossRef][Medline]
13 - Gil, R., F. J. Silva, J. Pereto, and A. Moya. 2004. Determination of the core of a minimal bacterial gene set. Microbiol. Mol. Biol. Rev. 68:518-537.[Abstract/Free Full Text]
14 - Graentzdoerffer, A., D. Rauh, A. Pich, and J. R. Andreesen. 2003. Molecular and biochemical characterization of two tungsten- and selenium-containing formate dehydrogenases from Eubacterium acidaminophilum that are associated with components of an iron-only hydrogenase. Arch. Microbiol. 179:116-130.[Medline]
15 - Gupta, R. S. 1998. Protein phylogenies and signature sequences: a reappraisal of evolutionary relationships among archaebacteria, eubacteria, and eukaryotes. Microbiol. Mol. Biol. Rev. 62:1435-1491.[Abstract/Free Full Text]
16 - Hallam, S. J., K. T. Konstantinidis, N. Putnam, C. Schleper, Y. Watanabe, J. Sugahara, C. Preston, J. de la Torre, P. M. Richardson, and E. F. DeLong. 2006. Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosum. Proc. Natl. Acad. Sci. USA 103:18296-18301.[Abstract/Free Full Text]
17 - Jansen, R., J. D. Embden, W. Gaastra, and L. M. Schouls. 2002. Identification of genes that are associated with DNA repeats in prokaryotes. Mol. Microbiol. 43:1565-1575.[CrossRef][Medline]
18 - Keller, M., and K. Zengler. 2004. Tapping into microbial diversity. Nat. Rev. Microbiol. 2:141-150.[CrossRef][Medline]
19 - Leclerc, M., J. P. Delgenes, and J. J. Godon. 2004. Diversity of the archaeal community in 44 anaerobic digesters as determined by single strand conformation polymorphism analysis and 16S rDNA sequencing. Environ. Microbiol. 6:809-819.[CrossRef][Medline]
20 - Leininger, S., T. Urich, M. Schloter, L. Schwark, J. Qi, G. W. Nicol, J. I. Prosser, S. C. Schuster, and C. Schleper. 2006. Archaea predominate among ammonia-oxidizing prokaryotes in soils. Nature 442:806-809.[CrossRef][Medline]
21 - Makarova, K. S., N. V. Grishin, S. A. Shabalina, Y. I. Wolf, and E. V. Koonin. 2006. A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol. Direct. 1:7.[CrossRef][Medline]
22 - Megonigal, J. P., M. E. Hines, and P. T. Visscher. 2004. Anaerobic metabolism: linkages to trace gases and aerobic processes, p. 317-424. In W. H. Schlesinger (ed.), Biochemistry. Elsevier-Pergamon, Oxford, United Kingdom.
23 - Peters, F., Y. Shinoda, M. J. McInerney, and M. Boll. 2007. Cyclohexa-1,5-diene-1-carbonyl-coenzyme A (CoA) hydratases of Geobacter metallireducens and Syntrophus aciditrophicus: evidence for a common benzoyl-CoA degradation pathway in facultative and strict anaerobes. J. Bacteriol. 189:1055-1060.[Abstract/Free Full Text]
24 - Rappé, M. S., and S. J. Giovannoni. 2003. The uncultured microbial majority. Annu. Rev. Microbiol. 57:369-394.[CrossRef][Medline]
25 - Rusch, D. B., A. L. Halpern, G. Sutton, K. B. Heidelberg, S. Williamson, S. Yooseph, D. Wu, J. A. Eisen, J. M. Hoffman, K. Remington, K. Beeson, B. Tran, H. Smith, H. Baden-Tillson, C. Stewart, J. Thorpe, J. Freeman, C. Andrews-Pfannkoch, J. E. Venter, K. Li, S. Kravitz, J. F. Heidelberg, T. Utterback, Y. H. Rogers, L. I. Falcon, V. Souza, G. Bonilla-Rosso, L. E. Eguiarte, D. M. Karl, S. Sathyendranath, T. Platt, E. Bermingham, V. Gallardo, G. Tamayo-Castillo, M. R. Ferrari, R. L. Strausberg, K. Nealson, R. Friedman, M. Frazier, and J. C. Venter. 2007. The Sorcerer II Global Ocean Sampling Expedition: Northwest Atlantic through Eastern Tropical Pacific. PLoS Biol. 5:e77.[CrossRef][Medline]
26 - Schink, B. 1997. Energetics of syntrophic cooperation in methanogenic degradation. Microbiol. Mol. Biol. Rev. 61:262-280.[Abstract]
27 - Scholten, J. C., D. E. Culley, F. J. Brockman, G. Wu, and W. Zhang. 2007. Evolution of the syntrophic interaction between Desulfovibrio vulgaris and Methanosarcina barkeri: involvement of an ancient horizontal gene transfer. Biochem. Biophys. Res. Commun. 352:48-54.[CrossRef][Medline]
28 - Strous, M., E. Pelletier, S. Mangenot, T. Rattei, A. Lehner, M. W. Taylor, M. Horn, H. Daims, D. Bartol-Mavel, P. Wincker, V. Barbe, N. Fonknechten, D. Vallenet, B. Ségurens, C. Schenowitz-Truong, C. Médigue, A. Collingro, B. Snel, B. E. Dutilh, H. J. Op den Camp, C. van der Drift, I. Cirpus, K. T. van de Pas-Schoonen, H. R. Harhangi, L. van Niftrik, M. Schmid, J. Keltjens, J. van de Vossenberg, B. Kartal, H. Meier, D. Frishman, M. A. Huynen, H. W. Mewes, J. Weissenbach, M. S. Jetten, M. Wagner, and D. Le Paslier. 2006. Deciphering the evolution and metabolism of an anammox bacterium from a community genome. Nature 440:790-794.[CrossRef][Medline]
29 - Tyson, G. W., J. Chapman, P. Hugenholtz, E. E. Allen, R. J. Ram, P. M. Richardson, V. V. Solovyev, E. M. Rubin, D. S. Rokhsar, and J. F. Banfield. 2004. Community structure and metabolism through reconstruction of microbial genomes from the environment. Nature 428:37-43.[CrossRef][Medline]
30 - Vallenet, D., L. Labarre, Z. Rouy, V. Barbe, S. Bocs, S. Cruveiller, A. Lajus, G. Pascal, C. Scarpelli, and C. Médigue. 2006. MaGe: a microbial genome annotation system supported by synteny results. Nucleic Acids Res. 34:53-65.[Abstract/Free Full Text]
31 - Venter, J. C., K. Remington, J. F. Heidelberg, A. L. Halpern, D. Rusch, J. A. Eisen, D. Wu, I. Paulsen, K. E. Nelson, W. Nelson, D. E. Fouts, S. Levy, A. H. Knap, M. W. Lomas, K. Nealson, O. White, J. Peterson, J. Hoffman, R. Parsons, H. Baden-Tillson, C. Pfannkoch, Y. H. Rogers, and H. O. Smith. 2004. Environmental genome shotgun sequencing of the Sargasso Sea. Science 304:66-74.[Abstract/Free Full Text]
32 - Woyke, T., H. Teeling, N. N. Ivanova, M. Huntemann, M. Richter, F. O. Gloeckner, D. Boffelli, I. J. Anderson, K. W. Barry, H. J. Shapiro, E. Szeto, N. C. Kyrpides, M. Mussmann, R. Amann, C. Bergin, C. Ruehland, E. M. Rubin, and N. Dubilier. 2006. Symbiosis insights through metagenomic analysis of a microbial consortium. Nature 443:950-955.[CrossRef][Medline]
Journal of Bacteriology, April 2008, p. 2572-2579, Vol. 190, No. 7
0021-9193/08/$08.00+0 doi:10.1128/JB.01248-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Fonknechten, N., Perret, A., Perchat, N., Tricot, S., Lechaplais, C., Vallenet, D., Vergne, C., Zaparucha, A., Le Paslier, D., Weissenbach, J., Salanoubat, M.
(2009). A Conserved Gene Cluster Rules Anaerobic Oxidative Degradation of L-Ornithine. J. Bacteriol.
191: 3162-3167
[Abstract]
[Full Text]
-
Kunin, V., Copeland, A., Lapidus, A., Mavromatis, K., Hugenholtz, P.
(2008). A Bioinformatician's Guide to Metagenomics. Microbiol. Mol. Biol. Rev.
72: 557-578
[Abstract]
[Full Text]