This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Runco, L. M.
Right arrow Articles by Thanassi, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Runco, L. M.
Right arrow Articles by Thanassi, D. G.

 Previous Article  |  Next Article 

Journal of Bacteriology, May 2008, p. 3381-3385, Vol. 190, No. 9
0021-9193/08/$08.00+0     doi:10.1128/JB.01840-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Biogenesis of the Fraction 1 Capsule and Analysis of the Ultrastructure of Yersinia pestis{triangledown}

Lisa M. Runco, Selina Myrczek,{dagger} James B. Bliska, and David G. Thanassi*

Center for Infectious Diseases, Department of Molecular Genetics and Microbiology, Stony Brook University, Stony Brook, New York 11794-5120

Received 21 November 2007/ Accepted 19 February 2008


arrow
ABSTRACT
 
Analysis of a Yersinia pestis {Delta}caf1A mutant demonstrated that the Caf1A usher is required for the assembly and secretion of the fraction 1 capsule. The capsule assembled into thin fibrils and denser aggregates on the bacterial surface. Pilus-like fibers were also detected on the surface of Y. pestis. The capsule occasionally coated these fibers, suggesting how the capsule may cloak surface features to prevent host recognition.


arrow
TEXT
 
The fraction 1 (F1) capsule of Yersinia pestis, the causative agent of plague, is a highly antigenic, virulence-associated surface structure (2, 28). The capsule, encoded by the caf gene cluster (Fig. 1A), has antiphagocytic activity and decreases uptake by macrophages and epithelial cells (7, 17). Capsule biogenesis occurs via the conserved chaperone/usher (CU) pathway (24, 27) and is dependent on the Caf1M periplasmic chaperone and the Caf1A outer membrane usher (13). Caf1R is a transcriptional activator that promotes the expression of the capsule at 37°C (2, 12). The F1 capsule belongs to the nonpilus (F1-G1 long [FGL]) subfamily of CU pathways (10) and assembles as an amorphous structure composed of the Caf1 subunit protein (9, 30). Structural and functional studies of Caf1M-Caf1 and Caf1-Caf1 interactions revealed that these occur by the same mechanisms as those found in the CU pathways involved in the assembly of pilus-type fibers (F1-G1 short [FGS] subfamily) (23, 31, 32). In comparison, little information is available about the Caf1A usher. In the prototypical pilus biogenesis systems, chaperone-subunit complexes must interact with the usher for subunit assembly into the pilus fiber and secretion of the fiber through the usher to the cell surface (6, 20). In contrast, studies by Karlyshev and coworkers with recombinant Escherichia coli strains (13) found that although the Caf1A usher was required for capsule assembly on the bacterial surface, the usher was not required for the secretion of Caf1 subunits to the extracellular medium. This raised the possibility that F1 biogenesis may occur via an altered mechanism whereby Caf1 subunits are secreted by a transporter separate from the usher and then interact with Caf1A on the cell surface to assemble into the capsule.


Figure 1
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 1. CU pathways of Y. pestis. (A) The CU gene clusters are depicted, with the caf (F1) and psa (pH 6) systems at the top and the novel CU pathways below them. Usher gene y1543 is disrupted by an insertion sequence. The usher for the y4060-y4063 pathway is disrupted by a frameshift mutation into two open reading frames (y4061 and y4062). (B) Alignment of the F1-G1 loop region of the Y. pestis chaperones together with the prototypical FGS chaperones FimC and PapD. Each of the novel Y. pestis chaperones has a short F1-G1 loop region, indicating that they belong to the FGS subfamily. In contrast, Caf1M and PsaB have a longer F1-G1 loop region.

To evaluate the role of the Caf1A usher in capsule assembly and secretion in Y. pestis, we constructed a {Delta}caf1A deletion mutant of strain KIM6+ (29) using the lambda red recombination method (4, 5) and primers ycaf1A_kanF (TCTGGAAATATCGACTTCCGTCTAGAAAAACATAATGGAAAAGAACTTCTTTTGTAGGCTGGAGCTGCTTCG) and ycaf1A_kanR (CCTGGTACCGATTAAGGGTATTTTGCGAGACTGTTATTTGGACAAGGTAAACCAAGATATCAATGGTAA). Proper construction of the {Delta}caf1A mutant was confirmed by PCR (data not shown). We first examined KIM6+ and KIM6+ {Delta}caf1A for F1 capsule assembly on the cell surface by immunofluorescence microscopy. Bacteria were grown in heart infusion (HI) broth at 37°C to logarithmic phase and adsorbed to poly-L-lysine-coated glass coverslips. The capsule was visualized by incubating the bacteria with a monoclonal anti-F1 antibody (RDI) followed by a tetramethyl rhodamine isothiocyanate-conjugated secondary antibody (Sigma). Whereas Caf1 was detected on the surface of KIM6+ bacteria, no capsule was detected on KIM6+ {Delta}caf1A bacteria (Fig. 2A). To complement KIM6+ {Delta}caf1A, we amplified caf1A from Y. pestis by PCR using primers CAFF3226 (TGATGAATTCAAAGGACTAGCGGGAGCACG) and CAFR547 (CGAACTGCAGCGTAGAGAGGGCTTGTGTCC). The amplicon was cloned into the pGEM-T Easy vector (Promega) and then subcloned using EcoRI into the expression vector pMMB66 (19), creating plasmid pCaf1A. The addition of pCaf1A to KIM6+ {Delta}caf1A restored the expression of the capsule (Fig. 2A), confirming that the usher is required for the assembly of F1 on the bacterial surface.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 2. The Caf1A usher is required for the assembly and secretion of the F1 capsule. (A) Phase-contrast and corresponding epifluorescence images of Y. pestis KIM6+, the KIM6+ {Delta}caf1A mutant, and the mutant complemented with pCaf1A. The capsule was detected on intact bacteria using a monoclonal anti-F1 antibody followed by a tetramethyl rhodamine isocyanate-conjugated secondary antibody. Images were taken with a 40x objective. (B) Secretion of Caf1 into the culture medium by KIM6+ and KIM6+ {Delta}caf1A. Supernatant fractions were precipitated with trichloroacetic acid, resuspended in sodium dodecyl sulfate sample buffer, and incubated at 25 or 95°C as indicated. Samples were separated by gel electrophoresis and immunoblotted with monoclonal (25°C) or polyclonal (95°C) F1 antibodies.

We next examined the role of the Caf1A usher in Caf1 secretion in Y. pestis. Culture supernatant fractions were isolated from KIM6+ and KIM6+ {Delta}caf1A grown to logarithmic phase in TMH (pH 7.4) defined medium (26) at 37°C. The supernatant fractions were centrifuged to remove bacteria, passed through a 0.22-µm filter (Millipore), precipitated with 9% trichloroacetic acid, subjected to gel electrophoresis, and immunoblotted with anti-Caf1 antibodies. Caf1 subunits undergo spontaneous polymerization in the periplasm, particularly in the absence of the Caf1A usher (31, 32). Polymerized Caf1 is resistant to dissociation and can be detected by gel electrophoresis if samples are incubated in sodium dodecyl sulfate sample buffer at 25°C (32). The anti-F1 monoclonal antibody reacted strongly with polymerized Caf1 but did not react well with preparations treated at 95°C to generate the denatured monomer (data not shown). In contrast, an anti-F1 rabbit polyclonal antibody (generated using Caf1 protein purified under denaturing conditions from a recombinant E. coli strain) reacted strongly with the denatured monomer. Therefore, to ensure sensitive detection of both forms of the Caf1 subunits, we used the F1 monoclonal antibody to probe samples treated at 25°C and the F1 polyclonal antibody to probe samples treated at 95°C. As shown in Fig. 2B, secreted Caf1 subunits were readily detected in the medium from KIM6+ cultures. However, no Caf1 was detected in the medium from KIM6+ {Delta}caf1A cultures (Fig. 2B). Identical results were obtained by immunoprecipitation of Caf1 from culture supernatant fractions using the monoclonal anti-F1 antibody (data not shown). These findings demonstrate that the Caf1A usher is required for both the assembly and secretion of Caf1 in Y. pestis, in agreement with the model established for the biogenesis of pilus-type fibers by the CU pathway.

Our results differ from those of a previous study by Karlyshev and coworkers of recombinant E. coli strains, which found that the Caf1A usher was not required for F1 secretion (13). In fact, we also observed that the usher was not required for Caf1 secretion in recombinant E. coli strains (L. M. Runco and D. G. Thanassi, unpublished data). In additional experiments, we noted that whereas the level of Caf1 in the periplasm of Y. pestis decreased in the absence of the usher, periplasmic Caf1 levels increased in E. coli (Runco and Thanassi, unpublished). This buildup of Caf1 subunits in E. coli in the absence of the usher likely results in nonspecific release of Caf1 into the culture medium. This also implies that Y. pestis possesses a mechanism to sense and respond to the inappropriate accumulation of Caf1 subunits in the periplasm.

We examined the ultrastructure of the Y. pestis capsule by whole-bacterium, negative-stain transmission electron microscopy (transmission EM). Bacteria were grown in HI broth or TMH (pH 7.4) to logarithmic phase at 37°C, adsorbed to polyvinyl formal carbon-coated grids (Ernest F. Fullam, Inc.), fixed with 1% glutaraldehyde, washed successively with phosphate-buffered saline (PBS) and water, and then stained with 0.5% phosphotungstic acid (Ted Pella, Inc.). The appearance of the capsule was more distinct than reported in previous studies, in which the capsule generally appeared as an amorphous haze or dense mass surrounding the bacteria (3, 7, 17). KIM6+ grown in TMH consistently produced an extended halo composed of thin fibrils and interspersed denser aggregates (Fig. 3A). The {Delta}caf1A deletion mutant never expressed similar structures (Fig. 3E and G). Occasionally with Y. pestis grown in TMH, but more consistently with bacteria grown in HI broth, the capsule appeared as a dense structure that more closely resembled previously reported images (Fig. 3D) (3, 7, 17). This dense capsular material, likely composed of aggregates of the thin fibrils, sometimes extended out from the bacterial surface in long strands (Fig. 3D, H, and I). The thin, fibrillar appearance of the F1 capsule resembles structures previously reported for other members of the FGL subfamily of CU pathways, including the pH 6 antigen of Yersinia (11, 16) and the CS3 and CS6 pili of enterotoxigenic E. coli (14, 15). This suggests a common structure and assembly mechanism for members of the FGL subfamily.


Figure 3
View larger version (138K):
[in this window]
[in a new window]

  		FIG. 3. Whole-bacterium, negative-stain transmission EM of Y. pestis. (A) KIM6+ grown in TMH, showing the F1 capsule as a fine, fibrillar network. (B) KIM6+ grown in TMH. The bacterium on the left is expressing multiple pilus-like fibers (black arrows), while the bacterium on the right is expressing capsular material. (C) KIM6+ grown in TMH, showing bacteria lacking the F1 capsule but expressing multiple pilus-like fibers. (D) KIM6+ grown in HI broth, showing the F1 capsule as a denser structure with extended strands. (E) KIM6+ {Delta}caf1A grown in TMH. No surface structures are present. (F) Immunogold EM of KIM6+ grown in TMH and incubated with monoclonal F1 antibody. The capsular material is extensively labeled with gold particles. (G) Immunogold EM KIM6+ {Delta}caf1A grown in TMH and incubated with the monoclonal F1 antibody. No gold labeling was detected despite the presence of pilus-like fibers. (H and I) Immunogold EM of KIM6+ grown in HI broth and incubated with monoclonal F1 antibody. Labeled capsular material (white arrows) is present along with unlabeled pilus-like fibers (black arrows). The capsule appears to coat some pilus fibers. Bars = 500 nm.

The identity of the material on the surface of KIM6+ as the F1 capsule was confirmed by immunogold EM. After being fixed with glutaraldehyde, the grids were washed with PBS, blocked with PBS plus 1% bovine serum albumin, and incubated with the monoclonal or polyclonal anti-F1 antibodies described above at dilutions of 1:200 or 1:5,000, respectively. The grids were washed again and incubated with 1:50 secondary antibody conjugated to 12-nm gold particles (Sigma). The material present on KIM6+ grown in either TMH or HI broth was extensively labeled with gold particles, confirming the identity of these structures as the F1 capsule (Fig. 3F, H, and I). No gold labeling was detected on strain KIM6+ {Delta}caf1A (Fig. 3G), and no gold labeling was detected when an isotype-matched control monoclonal antibody or the preimmune rabbit serum was used in place of the anti-F1 antibodies (data not shown). The pH 6 antigen (1), encoded by the psa gene cluster (Fig. 1A), should be repressed under our culture conditions, and examination of the Y. pestis {Delta}psa strain DSY13 (17) by EM revealed the same F1 structures as detected on KIM6+ (data not shown), confirming that the pH 6 antigen does not contribute to these structures.

In addition to bacteria being completely surrounded by the F1 capsule, ~10 to 15% of the KIM6+ bacteria were only partly coated with capsular material or lacked the F1 capsule altogether (Fig. 3A to C). Notably, long, thin, pilus-like fibers were apparent and were most often observed on bacteria not expressing the F1 capsule (Fig. 3B and C). KIM6+ {Delta}caf1A produced the same pilus-like fibers, which were not labeled by the anti-F1 antibody (Fig. 3G). The {Delta}psa strain DSY13 also produced similar fibers (data not shown), demonstrating that these fibers are not related to the capsule or the pH 6 antigen. In agreement with this, a recent study noted the presence of isolated, pilus-like fibers on the surface of a Y. pestis {Delta}caf {Delta}psa double mutant (17). Y. pestis contains eight putative CU gene clusters in addition to the caf and psa gene clusters (Fig. 1A) (21). Alignment of the chaperones from these novel CU gene clusters shows that they group with the prototypical FSG chaperones PapD and FimC in the F1-G1 strand region (Fig. 1B). Therefore, the novel CU gene clusters belong to the FGS subfamily that assembles pilus-type structures, suggesting that one or more of these pathways could encode the fibers observed by EM. Indeed, analysis of the novel Y. pestis CU gene clusters expressed in E. coli revealed that they are capable of assembling pili (8). The pilus fibers could serve as adhesins or invasins of Y. pestis, which lacks the proteins known to provide these functions in Yersinia pseudotuberculosis and Yersinia enterocolitica (18, 22, 25).

Interestingly, in KIM6+ strains expressing both the F1 capsule and the pilus-like fibers, the capsule sometimes appeared to coat the pilus-like fibers. This was particularly so for strains grown in HI broth, where the capsule adopted the more-condensed form, resulting in the capsule extending away from the bacterial surface in long strands (Fig. 3H and I). These extensions were clearly labeled by anti-F1-directed gold particles, while the pilus-type fibers were unlabeled or labeled by gold particles only where capsular material was present (Fig. 3H and I). Expression of the F1 capsule is known to inhibit the adhesion of Y. pestis to epithelial cells and to decrease uptake by macrophages (7, 17). The ability of the F1 capsule to cover even extended surface structures such as the pilus fibers suggests a mechanism whereby the capsule physically cloaks surface features of Y. pestis to prevent its recognition or uptake by host cells.


arrow
ACKNOWLEDGMENTS
 
We thank Dieter M. Schifferli (University of Pennsylvania, Philadelphia, PA) for comments on the manuscript and providing strain DSY13. We thank Susan Van Horn (Stony Brook University, Stony Brook, NY) and the Central Microscopy Imaging Center for assistance with EM. We thank Gloria Monsalve (Stony Brook University) for generating the anti-F1 polyclonal antibody and Karen Chave of the Northeast Biodefense Center Protein Expression Core (Wadsworth Center, Albany, NY) for providing purified Caf1 protein.

The Expression Core is supported by Northeast Biodefense Center grant U54-AI057158-Lipkin. This work was supported by National Institutes of Health grants AI055621 (to D.G.T. and J.B.B.) and U54-AI057158-Lipkin (to J.B.B.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 242 Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120. Phone: (631) 632-4549. Fax: (631) 632-4294. E-mail: David.Thanassi{at}stonybrook.edu Back

{triangledown} Published ahead of print on 29 February 2008. Back

{dagger} Present address: Institute of Clinical Microbiology, Immunology and Hygiene, University Hospital Erlangen, Wasserturmstr. 3-5, D-91054 Erlangen, Germany. Back


arrow
REFERENCES
 
    1
  1. Ben-Efraim, S., M. Aronson, and L. Bichowsky-Slomnicki. 1961. New antigenic component of Pasteurella pestis formed under specified conditions of pH and temperature. J. Bacteriol. 81:704-714.[Free Full Text]
    2. 2
  2. Brubaker, R. R. 1972. The genus Yersinia: biochemistry and genetics of virulence. Curr. Top. Microbiol. Immunol. 57:111-158.[Medline]
    3. 3
  3. Chen, T. H., and S. S. Elberg. 1977. Scanning electron microscopic study of virulent Yersinia pestis and Yersinia pseudotuberculosis type 1. Infect. Immun. 15:972-977.[Abstract/Free Full Text]
    4. 4
  4. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
    5. 5
  5. Derbise, A., B. Lesic, D. Dacheux, J. M. Ghigo, and E. Carniel. 2003. A rapid and simple method for inactivating chromosomal genes in Yersinia. FEMS Immunol. Med. Microbiol. 38:113-116.[CrossRef][Medline]
    6. 6
  6. Dodson, K. W., F. Jacob-Dubuisson, R. T. Striker, and S. J. Hultgren. 1993. Outer-membrane PapC molecular usher discriminately recognizes periplasmic chaperone-pilus subunit complexes. Proc. Natl. Acad. Sci. USA 90:3670-3674.[Abstract/Free Full Text]
    7. 7
  7. Du, Y., R. Rosqvist, and A. Forsberg. 2002. Role of fraction 1 antigen of Yersinia pestis in inhibition of phagocytosis. Infect. Immun. 70:1453-1460.[Abstract/Free Full Text]
    8. 8
  8. Felek, S., L. M. Runco, D. G. Thanassi, and E. S. Krukonis. 2007. Characterization of six novel chaperone/usher systems in Yersinia pestis. Adv. Exp. Med. Biol. 603:97-105.[Medline]
    9. 9
  9. Galyov, E. E., O. Smirnov, A. V. Karlishev, K. I. Volkovoy, A. I. Denesyuk, I. V. Nazimov, K. S. Rubtsov, V. M. Abramov, S. M. Dalvadyanz, and V. P. Zav'yalov. 1990. Nucleotide sequence of the Yersinia pestis gene encoding F1 antigen and the primary structure of the protein. Putative T and B cell epitopes. FEBS Lett. 277:230-232.[CrossRef][Medline]
    10. 10
  10. Hung, D. L., S. D. Knight, R. M. Woods, J. S. Pinkner, and S. J. Hultgren. 1996. Molecular basis of two subfamilies of immunoglobulin-like chaperones. EMBO J. 15:3792-3805.[Medline]
    11. 11
  11. Iriarte, M., J. C. Vanooteghem, I. Delor, R. Diaz, S. Knutton, and G. R. Cornelis. 1993. The Myf fibrillae of Yersinia enterocolitica. Mol. Microbiol. 9:507-520.[Medline]
    12. 12
  12. Karlyshev, A. V., E. E. Galyov, V. M. Abramov, and V. P. Zav'yalov. 1992. Caf1R gene and its role in the regulation of capsule formation of Y. pestis. FEBS Lett. 305:37-40.[CrossRef][Medline]
    13. 13
  13. Karlyshev, A. V., E. E. Galyov, O. Smirnov, A. P. Guzayev, V. M. Abramov, and V. P. Zav'yalov. 1992. A new gene of the f1 operon of Y. pestis involved in the capsule biogenesis. FEBS Lett. 297:77-80.[CrossRef][Medline]
    14. 14
  14. Knutton, S., M. M. McConnell, B. Rowe, and A. S. McNeish. 1989. Adhesion and ultrastructural properties of human enterotoxigenic Escherichia coli producing colonization factor antigens III and IV. Infect. Immun. 57:3364-3371.[Abstract/Free Full Text]
    15. 15
  15. Levine, M. M., P. Ristaino, G. Marley, C. Smyth, S. Knutton, E. Boedeker, R. Black, C. Young, M. L. Clements, C. Cheney, and R. Patnaik. 1984. Coli surface antigens 1 and 3 of colonization factor antigen II-positive enterotoxigenic Escherichia coli: morphology, purification, and immune responses in humans. Infect. Immun. 44:409-420.[Abstract/Free Full Text]
    16. 16
  16. Lindler, L. E., and B. D. Tall. 1993. Yersinia pestis pH 6 antigen forms fimbriae and is induced by intracellular association with macrophages. Mol. Microbiol. 8:311-324.[Medline]
    17. 17
  17. Liu, F., H. Chen, E. M. Galván, M. A. Lasaro, and D. M. Schifferli. 2006. Effects of Psa and F1 on the adhesive and invasive interactions of Yersinia pestis with human respiratory tract epithelial cells. Infect. Immun. 74:5636-5644.[Abstract/Free Full Text]
    18. 18
  18. Miller, V. L., J. J. Farmer III, W. E. Hill, and S. Falkow. 1989. The ail locus is found uniquely in Yersinia enterocolitica serotypes commonly associated with disease. Infect. Immun. 57:121-131.[Abstract/Free Full Text]
    19. 19
  19. Morales, V. M., A. Backman, and M. Bagdasarian. 1991. A series of wide-host-range low-copy-number vectors that allow direct screening for recombinants. Gene 97:39-47.[CrossRef][Medline]
    20. 20
  20. Norgren, M., M. Baga, J. M. Tennent, and S. Normark. 1987. Nucleotide sequence, regulation and functional analysis of the papC gene required for cell surface localization of Pap pili of uropathogenic Escherichia coli. Mol. Microbiol. 1:169-178.[CrossRef][Medline]
    21. 21
  21. Parkhill, J., B. W. Wren, N. R. Thomson, R. W. Titball, M. T. Holden, M. B. Prentice, M. Sebaihia, K. D. James, C. Churcher, K. L. Mungall, S. Baker, D. Basham, S. D. Bentley, K. Brooks, A. M. Cerdeno-Tarraga, T. Chillingworth, A. Cronin, R. M. Davies, P. Davis, G. Dougan, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Leather, S. Moule, P. C. Oyston, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413:523-527.[CrossRef][Medline]
    22. 22
  22. Rosqvist, R., M. Skurnik, and H. Wolf-Watz. 1988. Increased virulence of Yersinia pseudotuberculosis by two independent mutations. Nature 334:522-524.[CrossRef][Medline]
    23. 23
  23. Sauer, F. G., J. S. Pinkner, G. Waksman, and S. J. Hultgren. 2002. Chaperone priming of pilus subunits facilitates a topological transition that drives fiber formation. Cell 111:543-551.[CrossRef][Medline]
    24. 24
  24. Sauer, F. G., H. Remaut, S. J. Hultgren, and G. Waksman. 2004. Fiber assembly by the chaperone-usher pathway. Biochim. Biophys. Acta 1694:259-267.[Medline]
    25. 25
  25. Simonet, M., B. Riot, N. Fortineau, and P. Berche. 1996. Invasin production by Yersinia pestis is abolished by insertion of an IS200-like element within the inv gene. Infect. Immun. 64:375-379.[Abstract]
    26. 26
  26. Straley, S. C., and W. S. Bowmer. 1986. Virulence genes regulated at the transcriptional level by Ca2+ in Yersinia pestis include structural genes for outer membrane proteins. Infect. Immun. 51:445-454.[Abstract/Free Full Text]
    27. 27
  27. Thanassi, D. G., E. T. Saulino, and S. J. Hultgren. 1998. The chaperone/usher pathway: a major terminal branch of the general secretory pathway. Curr. Opin. Microbiol. 1:223-231.[CrossRef][Medline]
    28. 28
  28. Titball, R. W., and E. D. Williamson. 2001. Vaccination against bubonic and pneumonic plague. Vaccine 19:4175-4184.[CrossRef][Medline]
    29. 29
  29. Une, T., and R. R. Brubaker. 1984. In vivo comparison of avirulent Vwa– and Pgm– or Pstr phenotypes of yersiniae. Infect. Immun. 43:895-900.[Abstract/Free Full Text]
    30. 30
  30. Vorontsov, E. D., A. G. Dubichev, L. N. Serdobintsev, and A. V. Naumov. 1990. Association-dissociation processes and supermolecular organisation of the capsule antigen (protein F1) of Yersinia pestis. Biomed. Sci. 1:391-396.[Medline]
    31. 31
  31. Zavialov, A. V., J. Berglund, A. F. Pudney, L. J. Fooks, T. M. Ibrahim, S. MacIntyre, and S. D. Knight. 2003. Structure and biogenesis of the capsular F1 antigen from Yersinia pestis: preserved folding energy drives fiber formation. Cell 113:587-596.[CrossRef][Medline]
    32. 32
  32. Zavialov, A. V., J. Kersley, T. Korpela, V. P. Zav'yalov, S. MacIntyre, and S. D. Knight. 2002. Donor strand complementation mechanism in the biogenesis of nonpilus systems. Mol. Microbiol. 45:983-995.[CrossRef][Medline]

Journal of Bacteriology, May 2008, p. 3381-3385, Vol. 190, No. 9
0021-9193/08/$08.00+0     doi:10.1128/JB.01840-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Cornelius, C. A., Quenee, L. E., Elli, D., Ciletti, N. A., Schneewind, O. (2009). Yersinia pestis IS1541 Transposition Provides for Escape from Plague Immunity. Infect. Immun. 77: 1807-1816 [Abstract] [Full Text]  
  • Sebbane, F., Jarrett, C., Gardner, D., Long, D., Hinnebusch, B. J. (2009). The Yersinia pestis caf1M1A1 Fimbrial Capsule Operon Promotes Transmission by Flea Bite in a Mouse Model of Bubonic Plague. Infect. Immun. 77: 1222-1229 [Abstract] [Full Text]  
  • Ivanov, M. I., Noel, B. L., Rampersaud, R., Mena, P., Benach, J. L., Bliska, J. B. (2008). Vaccination of Mice with a Yop Translocon Complex Elicits Antibodies That Are Protective against Infection with F1- Yersinia pestis. Infect. Immun. 76: 5181-5190 [Abstract] [Full Text]  
  • Lilo, S., Zheng, Y., Bliska, J. B. (2008). Caspase-1 Activation in Macrophages Infected with Yersinia pestis KIM Requires the Type III Secretion System Effector YopJ. Infect. Immun. 76: 3911-3923 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Runco, L. M.
Right arrow Articles by Thanassi, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Runco, L. M.
Right arrow Articles by Thanassi, D. G.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»