Pleiotropic Roles of Polyglycerolphosphate Synthase of Lipoteichoic Acid in Growth of Staphylococcus aureus Cells

Lipoteichoic acid (LTA) is one of two anionic polymers on thesurface of the gram-positive bacterium Staphylococcus aureus.LTA is critical for the bacterium-host cell interaction andhas recently been shown to be required for cell growth and division.To determine additional biological roles of LTA, we found itnecessary to identify permissive conditions for the growth ofan LTA-deficient mutant. We found that an LTA-deficient S. aureus ${Delta}$ ltaS mutant could grow at 30°C but not at 37°C. Evenat the permissive temperature, ${Delta}$ ltaS mutant cells had aberrantcell division and separation, decreased autolysis, and reducedlevels of peptidoglycan hydrolases. Upshift of ${Delta}$ ltaS mutant cellsto a nonpermissive temperature caused an inability to excludeSytox green dye. A high-osmolarity growth medium remarkablyrescued the colony-forming ability of the ${Delta}$ ltaS mutant at 37°C,indicating that LTA synthesis is required for growth under low-osmolarityconditions. In addition, the ${Delta}$ ltaS mutation was found to be syntheticallylethal with the ${Delta}$ tagO mutation, which disrupts the synthesisof the other anionic polymer, wall teichoic acid (WTA), at 30°C,suggesting that LTA and WTA compensate for one another in anessential function.

INTRODUCTION

Top

INTRODUCTION

Staphylococcus aureus is a major pathogenic agent of opportunisticinfections. Indeed, S. aureus can cause endocarditis, pneumonia,and septic shock, particularly in immunocompromised patients.The appearance and spread of multiple-drug-resistant strainsof S. aureus make these infections difficult to treat (18).Thus, understanding the physiology of staphylococcal cell growthand pathogenesis is important for knowing how to treat infectiousdiseases and develop novel antibiotics.

On the surfaces of gram-positive S. aureus cells are two negativelycharged polymers: lipoteichoic acid (LTA) and wall teichoicacid (WTA). Together with the peptidoglycan, they form a polyanionicnetwork or matrix. While not all gram-positive bacteria haveconventional LTA and WTA, those without these polymers generallyhave functionally similar anionic polymers, suggesting thatcell wall anionic polymers are important for the growth of theseorganisms (36). WTA in S. aureus consists of repeating unitsof 1,5-D-ribitol phosphate and is attached via a linkage unitto the C-6 position of MurNAc residues of the peptidoglycan.The repeating units of D-ribitol phosphate are joined via phosphodiesterlinkages to form linear chains and are substituted with GlcNAcresidues and D-alanyl esters (2, 4). WTA is critical for cellsurface hydrophobicity, maintenance of cell shape, and adhesionto host cells (36, 51). WTA is also thought to be dispensablefor bacterial cell growth, however, because a WTA-depleted ${Delta}$ tagOmutant is viable (50).

Staphylococcal LTA consists of about 25 repeating units of poly(1-3)-glycerolphosphatelinked to a membrane anchor, a diglycosyldiacylglycerol (12).Additionally, about 60 to 70% of the glycerol residues are D-alanylated.LTA is a major macroamphiphile of gram-positive bacteria thatconstitutes 1/10 to 1/5 of the outer leaflet of the cell membrane.Physicochemical studies have shown that LTA increases the phasetransition temperature of the phospholipid membrane by stabilizingthe membrane (16). In addition, LTA has been proposed to haveroles in the localization and activity of peptidoglycan hydrolaseson the cell surface (53). Moreover, LTA functions in bacterium-hostcell interaction, with roles in directing cell adhesion, phagocytosis,and the induction of inflammatory cytokines (14, 34, 51).

Biochemical analyses have revealed that the polyglycerol phosphateis synthesized by a membrane protein that uses a membrane phospholipid,phosphatidylglycerol (PG), as a substrate (5, 28, 39). Recently,the ltaS (lipoteichoic acid synthase) gene was identified asa gene encoding a polyglycerolphosphate synthase of LTA in S.aureus (15). When LtaS expression was limited in S. aureus cellsat 37°C, the amount of LTA in the cells decreased, cellgrowth was arrested, and abnormalities in cell division andseparation appeared (15). Nonetheless, the exact physiologicalroles of LTA in bacterial cell growth and host cell interactionremain unclear.

We have previously isolated mutant temperature-sensitive S.aureus strains to identify essential genes in S. aureus (22,31). Here we describe how the ltaS gene was identified via adifferent experimental approach; we obtained three mutant strainswith a temperature sensitivity that could be complemented bythe hypothetical gene SA0674 (ltaS). We show that the ltaS geneencodes a polyglycerolphosphate synthase of LTA that uses PGas a substrate and that the ${Delta}$ ltaS mutation results in a completedepletion of LTA from the cells. Notably, we identified permissivegrowth conditions for ${Delta}$ ltaS mutant cells: the ltaS gene is dispensablefor cell growth at 30°C, though cells still exhibit irregularcell division and separation. At 37°C or higher, ltaS isessential for colony formation, viability, and resistance tolow-osmolarity conditions. In addition, we found that syntheticlethality results from the combination of the ${Delta}$ ltaS mutationwith the ${Delta}$ tagO mutation, which eliminates WTA, suggesting thatLTA and WTA have complementing essential functions.

MATERIALS AND METHODS

Top

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions. S. aureus and Escherichia coli strains were grown in Luria-Bertani(LB) medium (1% tryptone, 0.5% yeast extract, and 1% NaCl) containing,where appropriate, 12.5 µg/ml chloramphenicol (Cm), 20µg/ml phleomycin (Phleo), 100 µg/ml ampicillin (Amp),50 µg/ml kanamycin (Km), or 50 µg/ml thymine at30°C or 37°C. The bacterial strains and plasmids usedin this study are listed in Table 1. S. aureus temperature-sensitivemutant cells were derived from RN4220 (37). The plasmid pKE515-derivedlibrary and the E. coli-S. aureus shuttle vector (30) were asdescribed previously (21, 22, 31). Genetic engineering of S.aureus cells (including electroporation, plasmid extraction,insertional deletion of genes, and phage transduction) was conductedas described previously (23, 24, 33, 35). To prepare a phagelysate from the ${Delta}$ tagO mutant cells, a complementing strain wasused, since tagO is required for phage absorption (50). To insertthe Km resistance gene near the ltaS gene, we amplified theSA0667 and SA0668 gene region (5 kb away from ltaS) by PCR usingprimers ACTTCTTTGAAATGTTTTTT and TTATCAATACCAACAACTTG, and theresultant fragment was inserted at the SmaI site of pSF151.The resultant plasmid was introduced into temperature-sensitivemutant cells harboring point mutations in ltaS, and Km-resistanttransformants, generated by site homologous recombination, wereselected. The chromosomal ltaS gene was replaced with a Phleoresistance gene as described previously (9) but with some modifications.First, a DNA fragment of approximately 1.5 kbp from upstreamor downstream of the ltaS gene was amplified by PCR using primersSA0674-P1 (TTCGAAATATGGTCCGGATA) and SA0674-P2 (TATTGGATCCGGAAATTATTTGCATCGGACTC)or SA0674-P3 (GTTCAGCAATCGGCATAGTCATCAAAGCCTTATCAA) and SA0674-P4(GCTTTTGCTCTCCACCAGAT), respectively. Second, the Phleo resistancegene was amplified using primers Phleo-P1 (GGATCCAATAGACCAGTTGCA)and Phleo-P2 (CGATTGCTGAACAGATTAATAA), containing sequencescomplementary to SA0674-P2 and SA0674-P3, respectively, andto the pUC19-upp-phleo template sequence. Next, the three amplifiedfragments were connected by joining PCR (9), and the resultantfragment was inserted at the SmaI site of pSF151, creating pSFltaS.The pSFltaS plasmid was introduced into RN4220 cells harboringpM102-ltaS, and Km-resistant transformants, generated by first-sitehomologous recombination, were selected. From these cells, Km-sensitivestrains with both Phleo resistance and Cm resistance, whichwere formed by a second-site homologous recombination event,were selected and named M0674/pM102-ltaS. The pM102 vector (M.Matsuo et al., unpublished data) is a shuttle vector that canbe propagated in E. coli (Cm^r) or S. aureus (Cm^r), facilitatedby replicons of E. coli pUC19 and S. aureus pN315, respectively.The pM102-ltaS plasmid is a pM102 derivative that harbors theltaS gene. Deletion of the chromosomal ltaS gene in M0674/pM102-ltaSwas confirmed by PCR using primers SA0674-P1 and SA0674-P4 (datanot shown). M0674/pM102-ltaS was transformed with pM101 (Matsuoet al., unpublished), which is incompatible with pM102, sincethey possess the same replicon, but has a different marker frompM102 (namely, Km resistance). A Km-resistant transformant,M0674/pM101, was obtained at 30°C. The loss of pM102-ltaSin M0674/pM101 was confirmed by Cm sensitivity (data not shown).In M0107, the spa gene, which encodes protein A, has been disruptedin RN4220 cells by replacement with a Phleo resistance geneby double-crossover recombination as described above using primersspa-P1 (GGGTCTAGAAAAAAGTCAAGCCTGAAGTCG), spa-P2 (TATTGGATCCAAAGTGGGGCTTTGAATGTG),spa-P3 (CCCGGGTACCTGCAGCGTTATTAGCTGGAC), spa-P4 (GGGGAATTCTAATTGGTGCAACTGGGACA),and Phleo-P1 and Phleo-P3 (GGTACCCGGGCGATTGCTGAA). The pNDX1vector is a derivative of the E. coli-S. aureus shuttle vectorpND50 (54); it has a xyl-tet promoter-operator fusion and thetetR gene from pWH353 (13). pNDXltaS-His is a derivative ofpNDX1 that contains a C-terminally His-tagged LtaS open readingframe (ORF) under the control of the xyl-tet promoter-operator.pSltaS was a derivative of pKE515 obtained from a pKE515-basedgenomic DNA library. pSF151 is a so-called suicide vector forS. aureus (23, 47).

View this table:
[in this window]
[in a new window]

TABLE 1. Strains and plasmids used in this study

Localization analysis of LtaS. To examine the localization of the LtaS protein via subcellularfractionation, the protein A-deficient M0107 ( ${Delta}$ spa::phleo) strainharboring pNDX1 or pNDXltaS-His was first grown at 37°Cto an optical density at 600 nm (OD₆₀₀) of 0.5. Strain M0107was used to diminish any unwanted signal from the interactionof protein A with immunoglobulin G during Western blotting.Next, up to 0.5 µg/ml anhydrotetracycline (ATc) (Sigma-Aldrich)was added, and the cells were further incubated for 2 h. Toprepare the culture medium protein, cells were centrifuged;the supernatant fractions were collected, brought to a finalconcentration of 10% trichloroacetic acid, and incubated overnightat 4°C. Precipitates were collected by centrifugation at10,000 x g for 10 min, washed twice with ice-cold ethanol, dried,and dissolved in 8 M urea and 2 M thiourea as previously described(55). To prepare membrane proteins, precipitated cells werewashed, resuspended in 1 ml of phosphate-buffered saline (PBS),and treated with 200 µg/ml lysostaphin (Wako) at 37°Cfor 30 min. The resulting cell lysate was sonicated and thencentrifuged at 100,000 x g for 30 min at 4°C. The pelletwas resuspended in PBS by sonication. The protein concentrationwas determined by the Lowry method using bovine serum albuminas a standard (32). Membrane (30 µg) and culture medium(3 µg) proteins were analyzed by immunoblotting with aperoxidase-conjugated anti-His monoclonal antibody (NacalaiTesque).

Analysis of LTA using ³²P_i. LTA was extracted from S. aureus cells with phenol and was purifiedusing Octyl-Sepharose as described previously (11). In brief,S. aureus cells were grown at 30°C overnight in LB mediumcontaining up to 10 µCi/ml ³²P_i (GE Healthcare). ³²P_i-labeledcells were suspended in TSS buffer (50 mM Tris-HCl [pH 7.9],150 mM NaCl, 20% sucrose) and lysed with 200 µg/ml lysostaphinat 37°C for 1 h. Spheroplasts were collected by centrifugationand resuspended in PBS. The LTA fraction was extracted withan equal volume of 80% phenol at 70°C for 1 h; the extractwas treated with chloroform; and finally the extract was driedunder a vacuum. The LTA fraction was absorbed to 250 µlof Octyl-Sepharose Fast Flow slurry, washed twice with 500 µlof 15% 1-propanol, and eluted with 50% 1-propanol. ³²P-labeledLTA was dried and dissolved in MilliQ water. ³²P-labeled LTAwas separated by 15% sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (15% SDS-PAGE). The gels were then dried, andthe radioactive bands were detected using BAS1800 (Fuji Film).

Quantification of LTA by ELISA. An enzyme-linked immunosorbent assay (ELISA) of LTA was performedas described previously (48). In brief, S. aureus cells (1 mlof culture) were first collected and resuspended in 1 ml ofPBS. For E. coli harboring pBAD24 (17) or pBADltaS-His, cellswere grown at 37°C to an OD₆₀₀ of 0.5; then L-(+)-arabinose(Sigma-Aldrich) was added to a final concentration of 1%, andthe cells were further incubated for 2 h, collected, and resuspendedin 1 ml of PBS. Cells were lysed with 200 µg/ml lysostaphinfor S. aureus or 200 µg/ml lysozyme for E. coli. LTA wasextracted from the resultant cell lysate with phenol at 70°Cfor 1 h. The extract was then treated with chloroform, driedunder a vacuum, and dissolved in 1 ml of water. Samples werediluted with PBS, and 100 µl of sample was incubated onan Immulon 1B ELISA plate (Dynatech) at 4°C overnight. Afterthree washes with 200 µl of PBST (PBS containing 0.05%Tween 20), the plate was treated with 200 µl of 3% bovineserum albumin in PBST at room temperature for 1 h. After fivewashes with PBST, a 200-fold-diluted anti-S. aureus LTA monoclonalantibody (clone 55; Hycult Biotech) was added and incubatedfor 2 h at room temperature. The plate was washed three timesand then incubated with alkaline phosphatase-conjugated anti-mouseimmunoglobulin G (Promega) at room temperature for 2 h. Thenthe plates were washed three times with PBST and incubated with1 mg/ml p-nitrophenylphosphate (Sigma) in buffer AP (50 mM Tris-HCl[pH 9.0] and 1 mM MgCl₂). The OD₄₀₅ was measured using a microplatereader. LTA from S. aureus (Sigma-Aldrich) was used as a standard.

Preparation of WTA. WTA was prepared as described previously (41). In brief, 200ml of cells grown in LB medium was harvested by centrifugationand washed with 0.9% NaCl. Cells were then resuspended in water,boiled for 30 min, washed with water, and washed twice withacetone. The cells were resuspended in PBS and disrupted usinga French press (35,000 lb/in²; Aminco). The resultant crudecell wall fraction was collected by centrifugation and treatedwith 1 µg/ml DNase I and 10 µg/ml RNase for 18 h,followed by treatment with 200 µg/ml trypsin for 18 h.The cell wall fraction was collected by centrifugation and washedtwice with 0.9% NaCl. WTA was solubilized from the insolublecell wall fraction by treatment with 5% trichloroacetic acidfor 18 h at room temperature, precipitated with 3 volumes ofacetone, and dissolved in water. WTA was separated on an 18%polyacrylamide gel and visualized using 0.5% alcian blue 8GX(Sigma-Aldrich) in 5% acetic acid.

Determining the rate of turnover of PG. S. aureus cells in liquid culture were diluted in 10 ml of LBmedium containing 12.5 µg/ml Cm and were grown at 30°Cto an OD₆₀₀ of 0.1. Then the culture was brought to 30 µCi/ml³²P_i (GE Healthcare) and incubated at 30°C for 1 h. Cellswere collected by centrifugation, washed twice with 1 ml ofLB medium, released, and further incubated at 30°C in freshLB medium. Aliquots (1 ml) of the culture were sampled periodically.Total lipids were extracted by the Bligh-Dyer method and spottedonto a silica gel 60 thin-layer chromatography plate (Merck).The plate was developed using chloroform-methanol-acetic acid(65:25:10) and dried, and the radioactivity of ³²P-labeled PGwas quantified using BAS1500 (Fuji Film) (38).

Autolysis assay. The autolysis assay was performed as described previously (40).In brief, cells growing exponentially in 5 ml of LB medium werecollected by centrifugation, washed, and suspended in 5 ml ofbuffer containing 50 mM Tris-HCl (pH 7.4) and 0.05% Triton X-100.The resultant cell suspension was incubated at 30°C, andOD₆₀₀ values were monitored.

Zymographic analyses. Bacteriolytic activities were measured, using polyacrylamidegels containing heat-killed Micrococcus luteus cells, by a slightmodification of a previously described method (45). The stackinggel contained 3% acrylamide, 0.08% bisacrylamide, 0.125 M Tris-HCl(pH 6.8), 0.2% SDS, 0.25% N,N,N',N'-tetramethylethyenediamine,and 0.05% ammonium persulfate. The separating gel contained7.5% acrylamide, 0.135% bisacrylamide, 0.125 M Tris-HCl (pH8.8), 0.2% SDS, 0.1% N,N,N',N'-tetramethylethyenediamine, 0.1%ammonium persulfate, and 1.0 mg (wet weight)/ml heat-killedM. luteus cells. The sample loading buffer contained 25 mM Tris-HCl(pH 6.8), 2% SDS, 5% glycerol, and 0.04% bromophenol blue. Cellsurface fractions (4% SDS extract) corresponding to 2.5 ml ofculture at an OD₆₀₀ of 1 were used. Electrophoresis was performedat a constant voltage. After electrophoresis, gels were washedin 400 ml of water for 45 min and then incubated in 0.2 M phosphatebuffer (pH 7.0) for 1 to 4 h. Visualization of the zone clearedby cell lysis was enhanced by staining with 0.5% methylene blue,and gels were imaged using a GT-8700 scanner (Epson).

Microscopic analysis. For Sytox Green staining, cells growing exponentially in LBmedium at 30°C were shifted to 37°C or 43°C. Aliquotsof the cells were sampled and stained with 5 µM Sytoxgreen nucleic acid stain (Molecular Probes) in LB medium. Cellswere spread onto glass slides coated with aminopropylsilane(Matsunami) and were observed with a DM4000B fluorescent microscope(Leica) using a 100x objective. Images were taken with a charge-coupleddevice camera (Leica) and processed by Adobe Photoshop Elements.At least 200 cells were counted. Electron microscopic analysiswas performed as described previously (46). In brief, cellsgrowing exponentially in 200 ml of LB medium at 30°C weresampled directly or shifted to 43°C for 3 h. Harvested cellswere washed twice and doubly fixed with 2.5% glutaraldehydeand 1% OsO₄. The samples were then dehydrated using an ethanolseries and were embedded in Spurr's Epon. Ultrathin sectionswere cut with an ultramicrotome and examined using a JEOL JEM-2000EXII electron microscope at 80 or 100 kV.

RESULTS

Top

RESULTS

Identification of the ltaS gene. To identify genes essential for S. aureus cell growth, we collectedabout 750 temperature-sensitive mutants that grow at 30°Cbut not at 43°C. Genes that complement temperature-sensitivecell growth in these mutant strains were identified by introducinga pKE515-based plasmid library containing chromosomal DNA fragmentsderived from S. aureus strain RN4220. We found three temperature-sensitivemutant strains that could be complemented by pSltaS, a plasmidharboring the hypothetical gene SA0674 (ltaS), but not by theempty vector, pKE515 (Table 2). (The gene identification numberwas assigned in S. aureus strain N315 [29].) The pSltaS genomicinsert did not contain any genes other than ltaS; this geneappears to be encoded in a monocistron. We next compared thenucleotide sequences of the chromosomal ltaS gene and its flankingregions in the mutant strains. We found that each strain hada different single transition or transversion mutation in theLtaS coding region that resulted in an amino acid substitution.Three distinct lesions were identified: G768A (Ser256Asn; strainTS2947), C1055T (Thr351Ile; strain TS2519), and G1062T (Trp354opal;strain TS8643) (Fig. 1A). We named these mutations ltaS2947,ltaS2519, and ltaS8643, respectively.

View this table:
[in this window]
[in a new window]

TABLE 2. Complementation of temperature-sensitive mutant strains^a

View larger version (47K):
[in this window]
[in a new window]

FIG. 1. Isolation of mutations in S. aureus ltaS. (A) Primary structure of LtaS protein. Filled bars and shaded box indicate membrane-spanning regions and the phosphoglycerol transferase-like domain, respectively. Each mutation site identified in temperature-sensitive ltaS mutant strains is indicated by an arrow. (B) Colony formation of ${Delta}$ ltaS mutant cells. M0674 ( ${Delta}$ ltaS::phleo) harboring pM102-ltaS (Cm^r) was transformed with an incompatible plasmid, pM101 (Km^r) or pM101-ltaS (Km^r). Cells were spread onto LB agar plates containing 50 µg/ml Km and 20 µg/ml Phleo and were incubated at 30°C and 43°C for 24 h. (C) Temperature-sensitive cell growth of ${Delta}$ ltaS mutant cells. RN4220/pKE515, M0674/pM101/pKE515, or M0674/pM101/pSltaS cells at 30°C in LB medium were serially diluted 10-fold, and each 2-µl aliquot was spotted onto LB agar plates. Plates were incubated at 30°C, 37°C, or 43°C for 48 h. (D and E) Changes in turbidity and viability of ${Delta}$ ltaS mutant cells (M0674/pM101) after a temperature shift. Cells were diluted and incubated at 30°C in 5 ml of LB medium. At the exponential-growth phase, the temperature either was shifted to 43°C (filled symbols) or 37°C (shaded symbols) or was maintained at 30°C (open symbols). Turbidity was measured (D), and viable cell numbers were counted (E). Data are representative of at least three independent experiments.

To determine if these mutations were really responsible forthe temperature-sensitive growth of these mutant strains, weperformed phage transduction experiments using phage 80alpha.We inserted a selection marker (a kanamycin resistance gene)into a noncoding region between the SA0667 and SA0668 genes,a region that is proximal to ltaS in each of the mutant strains(TS2519, TS2947, and TS8643). For TS2519, 27 of 136 kanamycin-resistanttransductants showed temperature-sensitive cell growth, whereasthe remaining 109 transductants remained temperature resistant(Table 3). A similar link between kanamycin resistance and temperaturesensitivity was observed in TS2947 and TS8643 (Table 3). Aswith the parental mutant strains, pSltaS was able to complementthe temperature sensitivity of the mutant transductants (datanot shown). These results strongly suggest that these ltaS pointmutations are responsible for the temperature-sensitive phenotype.

View this table:
[in this window]
[in a new window]

TABLE 3. Results of phage transduction^a

The ltaS gene encodes a 68-kDa protein with an N-terminal fivemembrane-spanning region and a C-terminal phosphoglycerol transferase-like(or anion binding, sulfatase, alkaline phosphatase-like) domain(Fig. 1A). Notably, each of the three mutations is located withinthe phosphoglycerol transferase-like domain. Sequence alignmentof LtaS orthologues in related species, such as Listeria monocytogenes,Streptococcus pyogenes, and Bacillus subtilis (Table 4), revealedthat Ser256 has been well conserved in S. aureus LtaS and thatThr352 is Thr or Ser in the other organisms. The conservationof these amino acids is consistent with their importance forLtaS protein function.

View this table:
[in this window]
[in a new window]

TABLE 4. Conservation of the ltaS gene among bacteria

Because ltaS8643 is a nonsense mutation, it seems plausibleto imagine that ltaS is dispensable for cell growth at 30°C.To test this hypothesis, the chromosomal ltaS gene was replacedwith a Phleo resistance gene in a strain harboring pM102-ltaS,a complementing plasmid. Plasmid pM102 is a vector containinga replicon of the S. aureus pN315 plasmid and a Cm resistancegene (Matsuo et al., unpublished). This strain, M0674/pM102-ltaS,was transformed with pM101, a Km-resistant plasmid containingthe same pN315 replicon region as pM102, so that pM101 is incompatiblewith pM102-ltaS. Km-resistant transformants (M0674/pM101) wereobtained at 30°C but not at 43°C (Fig. 1B). The lossof the preexisting pM102-ltaS in M0674/pM101 was confirmed.Colonies obtained at 30°C grew more slowly than those ofM0674/pM101-ltaS. Furthermore, the colony-forming ability ofthe M0674/pM101 strain dramatically decreased (to less than10^–5) on agar plates when cells were cultured at 37°Cor 43°C but was recovered by the introduction of pSltaS(Fig. 1C). Upon a temperature upshift of M0674/pM101 cells from30°C in liquid medium, a turbidity increase was detectedat 37°C, but this increase was smaller than that observedat 30°C. When the culture was shifted to 43°C, therewas no further increase in turbidity (Fig. 1D). The number ofviable cells tapered off at 37°C and began to decrease at43°C (Fig. 1E). Taken together, these results indicate thatthe ltaS gene is dispensable for S. aureus cell growth at 30°Cbut essential at temperatures above 37°C.

Loss of LTA synthesis in the ${Delta}$ ltaS mutant. We next sought to reveal the biochemical function of the LtaSprotein. We identified four ltaS orthologues (yflE, yfnI, yqgS,and yvgJ) in Bacillus subtilis. The C-terminal regions of twoof the four proteins, the yflE and yfnI gene products, havebeen reported to be extracellular (1, 19). Consistent with thisresult, the C-terminal region of the S. aureus LtaS proteinwas identified among extracellular proteins in a proteomics-basedanalysis of S. aureus (55). Thus, we postulated that the LtaSC-terminal region containing the phosphoglycerol transferase-likedomain was located outside the cell membrane. Additionally,it seemed likely that the region is cleaved and released tothe culture medium.

To test this possibility, we expressed a version of LtaS witha His tag on the C terminus under the control of the ATc-induciblepromoter in a protein A-deficient S. aureus strain (M0107).Immunoblotting revealed that a 68-kDa protein could be detectedin the membrane fraction in a manner dependent on the presenceof ATc (see Fig. S1A in the supplemental material). This sizeis consistent with the predicted molecular mass of a full-lengthLtaS-His, and this result supports the idea that LtaS is a membraneprotein. As expected, a C-terminal 48-kDa protein fragment containingthe phosphoglycerol transferase-like domain was detected inan extracellular protein fraction (see Fig. S1A in the supplementalmaterial). The ratio of the amount of full-length protein presentin the membrane fraction to the amount of the C-terminal fragmentin the extracellular protein fraction was about 6:1 in exponentiallygrowing cells. These results suggest that the C-terminal region,containing the phosphoglycerol transferase-like domain, is orientedtoward the extracellular space on the cell membrane and thatthis region is cleaved and released into the culture medium(see Fig. S1B in the supplemental material).

Since the phosphoglycerol transferase-like domain of LtaS appearsto be oriented to the extracellular space, we next asked ifthe ${Delta}$ ltaS mutant strain was depleted of any cell surface constituents,including LTA. The mutant and parent cells were metabolicallylabeled with ³²P_i, and the ³²P-labeled LTA was extracted byphenol and purified by Octyl-Sepharose column chromatographyas described previously (11). In the ${Delta}$ ltaS mutant (M0674/pM101/pKE515),no ³²P-labeled LTA was detected (Fig. 2A, lane 2), and its losswas complemented by the introduction of plasmid pSltaS intothe mutant (Fig. 2A, lane 3). The loss of LTA in the ${Delta}$ ltaS mutantwas also confirmed by an ELISA (Fig. 2B), in which an anti-LTAmonoclonal antibody directed against polyglycerolphosphate wasused. In contrast, the amount of WTA in the ${Delta}$ ltaS mutant strain(M0674/pM101) was similar to that in the parental strain (Fig.2C). These results indicate that ltaS is required for the biosynthesisof the polyglycerolphosphate chain present in LTA. The extracellularlocalization of the phosphoglycerol transferase-like domainof LtaS is consistent with the idea that polyglycerolphosphateof LTA is synthesized on the outer leaflet of the cell membranein gram-positive bacteria (36).

View larger version (19K):
[in this window]
[in a new window]

FIG. 2. Essential nature of the ltaS gene for LTA biosynthesis. (A) Loss of LTA in ${Delta}$ ltaS mutant cells. Cells were metabolically labeled with ³²P_i, and ³²P-labeled LTA was extracted, separated by 15% SDS-PAGE, and detected by autoradiography. Lanes: 1, RN4220/pKE515; 2, M0674 ( ${Delta}$ ltaS)/pM101/pKE515; 3, M0674/pM101/pSltaS. (B) Quantification of LTA by ELISA. Levels of LTA in S. aureus cell culture were quantified by ELISA using an anti-polyglycerolphosphate antibody. Means from three independent experiments are presented along with standard deviations. Bars: 1, RN4220/pKE515; 2, M0674/pM101/pKE515; 3, M0674/pM101/pSltaS. (C) The ltaS gene is dispensable for WTA biosynthesis. WTA was extracted from stationary-phase S. aureus cells, separated by PAGE (18%), and visualized by 0.5% alcian blue staining. Lanes: 1, RN4220; 2, M0674/pM101; 3, M0702 ( ${Delta}$ tagO). (D) Decreased turnover rate of membrane PG in an S. aureus ${Delta}$ ltaS mutant. Cells were metabolically pulse-labeled with ³²P_i for 1 h and incubated further in fresh medium for the indicated periods. Total lipids were extracted and separated by silica gel thin-layer chromatography (chloroform-methanol-acetic acid, 65:25:10). ³²P-labeled PG was quantified by autoradiography. Filled circle, RN4220/pKE515; open circle, M0674/pM101/pKE515; filled triangle, M0674/pM101/pSltaS. Data are means and standard deviations from three independent experiments.

Previous biochemical studies have demonstrated that membranePG is a substrate for the biosynthesis of the polyglycerolphosphatepresent in LTA. We tested this idea by using the ${Delta}$ ltaS mutantstrain. By a pulse-chase experiment using ³²P_i (Fig. 2D), thehalf-life (t_1/2) of PG in the parental strain (RN4220/pKE515)was found to be 19 min, consistent with previously reporteddata (28). In contrast, in the ${Delta}$ ltaS mutant (M0674/pM101/pKE515),the t_1/2 for PG was more than 120 min. The introduction of pSltaSinto the ${Delta}$ ltaS mutant strain decreased the t_1/2 to 32 min. Theseresults are consistent with the previous biochemical observationsand suggest that PG is really a substrate for polyglycerolphosphatebiosynthesis of LTA. Additionally, our data clearly reveal thata large proportion of the PG in S. aureus cells is used forthe biosynthesis of LTA.

Induction of LTA synthesis in E. coli cells via ectopic expression of LtaS. Next, we tested if the ectopic expression of LtaS in E. colicells could induce the biosynthesis of polyglycerolphosphate.Since E. coli has the substrate PG but not LTA and the S. aureus ${Delta}$ ypfP mutant strain lacks the glycolipid anchor of LTA and insteadis able to synthesize polyglycerolphosphate on diacylglycerol(10, 27), we postulated that the expression of LtaS in E. colimight induce the synthesis of polyglycerolphosphate. To testthis idea, an E. coli pgsA3 mutant strain, which has severedefects in PG biosynthesis, and its isogenic parent strain (3)were transformed with pBADltaS-His harboring the LtaS ORF witha C-terminal His tag under the control of the arabinose promoter.The induction of LtaS in the parent E. coli strain by the additionof L-arabinose caused synthesis of polyglycerolphosphate (Fig.3A), as measured by an ELISA for LTA as described for Fig. 2B.In contrast, much lower levels of LTA synthesis were inducedin the pgsA3 mutant (Fig. 3A). Arabinose-dependent expressionof LtaS in both strains was confirmed by immunoblotting forthe His tag (Fig. 3B). These results strongly suggest that ltaSencodes a polyglycerolphosphate synthase that uses PG as a substrate.The role of the LtaS protein in the LTA biosynthetic pathwayis diagramed in Fig. 3C.

View larger version (28K):
[in this window]
[in a new window]

FIG. 3. PG-dependent induction of LTA synthesis in E. coli cells by ectopic expression of S. aureus LtaS. (A) pgsA-dependent LTA synthesis in E. coli. Exponentially growing E. coli cells were brought to a final concentration of 1% L-arabinose and were further incubated for 3 h. LTA levels in a phenol extract of the E. coli cells were quantified by ELISA as described for Fig. 2B. The results shown are representative of at least three independent experiments. Strains used were JE5513Tc (pgsA⁺) and YA5513Tc (pgsA3), which is deficient in PG biosynthesis, each harboring pBADltaS-His (LtaS-His) or pBAD24 (vector). (B) Expression of LtaS-His in E. coli cells. Whole-cell extracts of E. coli cells were prepared as described for panel A, and LtaS-His protein was detected by immunoblotting with an anti-His antibody. (C) Proposed LTA biosynthetic pathway. YpfP catalyzes the transfer of two glucose molecules to diacylglycerol (DAG) from UDP-glucose (UDP-Glc), and the resultant diglycosyldiacylglycerol is transported to the outer leaflet of the membrane by the putative membrane permease, LtaA. Glycerol phosphate residues are transferred by LtaS using PG as a donor.

The ltaS gene has been conserved among low-GC-content gram-positivebacteria, which have glycerol phosphate type LTA, includingstaphylococci, bacilli, listeriae, lactobacilli, enterococci,and streptococcal groups A and B (Table 4; also data not shown).Streptococcus pneumoniae, in which LTA has a repeating unitof ribitol phosphate and tetrasaccharide instead of polyglycerolphosphate(8), does not have an identifiable ltaS orthologue (Table 4).Thus, the conservation of the gene is consistent with the ideathat LtaS catalyzes polyglycerolphosphate synthesis of LTA.

Aberrant cell division and separation in ${Delta}$ ltaS mutant cells. To further characterize the physiological roles of the ltaSgene, analyses of the mutant cells were performed by electronmicroscopy. When grown at 30°C, ${Delta}$ ltaS mutant cells irregularlypositioned the division septa; they had parallel but not perpendiculardivision septa (Fig. 4). In addition, daughter cells often remainedconnected to each other. Furthermore, cells were enlarged, andtheir cell walls were thicker than those of wild-type cells(Fig. 4). A similar phenotype was observed for ${Delta}$ ltaS mutant cellscultured at 43°C for 4 h (Fig. 4). Fluorescent light microscopyof 4',6-diamidino-2-phenylindole (DAPI)-stained temperature-sensitiveltaS point mutant cells revealed that cells were enlarged andharbored multiple nucleoids at their restrictive temperature(data not shown). The introduction of pSltaS into these strainssuppressed these phenotypes (data not shown). These resultsclearly indicate that LTA synthesis by LtaS is required forcomplete cell division and separation and for proper cell wallmetabolism.

View larger version (109K):
[in this window]
[in a new window]

FIG. 4. Aberrant cell division and separation in ${Delta}$ ltaS mutant cells. Exponentially growing cells at 30°C (top) or cells after a shift to 43°C for 3 h (bottom) were fixed and observed by transmission electron microscopy. (Left) RN4220; (center and right) M0674/pM101 ( ${Delta}$ ltaS).

Decreased autolysis in ${Delta}$ ltaS mutant cells. The thickened cell wall and irregular cell separation in ${Delta}$ ltaSmutant cells resemble phenotypes that have been observed for ${Delta}$ atl and ${Delta}$ sle1 peptidoglycan hydrolase mutants (25, 46). Thus,we supposed that a ${Delta}$ ltaS mutant might express lower peptidoglycanhydrolase activity on its cell surface. To test this hypothesis,we performed a Triton X-100-mediated autolysis assay. Cellsgrowing exponentially at 30°C were harvested and suspendedin a buffer containing 0.05% Triton X-100; then changes in turbiditydue to autolysis were monitored. There was an observable decreasein turbidity in ${Delta}$ ltaS mutant cells; this decrease was smallerthan that for the parent strain (Fig. 5A). In addition, a zymographyassay, in which peptidoglycan hydrolase activity is monitoredby in-gel digestion of heat-killed Micrococcus luteus cells,revealed that the levels of peptidoglycan hydrolases in thecell wall fraction were lower in ${Delta}$ ltaS mutant cells than in parentcells (Fig. 5B). The introduction of pSltaS into the ${Delta}$ ltaS mutantrescued the peptidoglycan hydrolase activity (Fig. 5B). Thus,LTA is also critical for maintaining normal levels of peptidoglycanhydrolase activity on the bacterial cell surface.

View larger version (32K):
[in this window]
[in a new window]

FIG. 5. Decrease in peptidoglycan hydrolase activity in ${Delta}$ ltaS mutant cells. (A) Monitoring of autolysis of ${Delta}$ ltaS mutant cells. Exponentially growing cells at 30°C were harvested, suspended in 50 mM Tris-HCl (pH 7.4) buffer containing 0.05% Triton X-100, and incubated at 30°C. The OD₆₀₀ was determined at the indicated times. Open circles, RN4220; filled circles, M0674/pM101 ( ${Delta}$ ltaS). Data are means and standard deviations for at least three independent experiments. (B) Zymographic analysis of peptidoglycan hydrolases. A cell wall fraction was prepared and separated by SDS-PAGE (10%) with a gel containing 1 mg/ml heat-killed M. luteus cells. The gel was incubated in 0.2 M phosphate buffer, and visualization of the cleared zone was enhanced by staining with 0.5% methylene blue. Lanes: 1, RN4220/pKE515; 2, M0674/pM101/pKE515; 3, M0674/pM101/pSltaS.

Inability to exclude a dye from ${Delta}$ ltaS mutant cells at high temperatures. The aberrant cell division and separation and the decrease inpeptidoglycan hydrolase activity in ${Delta}$ ltaS mutant cells were observedunder permissive conditions (i.e., at 30°C). Because ${Delta}$ ltaSmutant cells stop the increase in turbidity after a temperatureupshift to 43°C, we supposed that another defect in cellularfunction, in addition to the phenotypes described above, contributesto the loss of colony formation under nonpermissive conditions(i.e., at 37°C or 43°C). Based on previous reports thatLTA occupies 1/10 to 1/5 of the available lipid molecules inthe outer leaflet of the cell membrane and that LTA increasesthe phase transition temperature of the cell membrane, leadingto stabilization of the membrane (16), we speculated that lossof the stabilizing effect of LTA on the cell membrane at hightemperatures would damage the cell membrane severely enoughto account for the decrease in cell viability. To test for membranedamage in ${Delta}$ ltaS mutant cells, we used the fluorescent dye Sytoxgreen, which is excluded from intact cell membranes but canpermeate membrane-damaged cells and render the cells fluorescentby binding to nucleic acids inside the cell (42). As shown inFig. 6A, parent cells did not fluoresce at either temperature;about 10% of the ${Delta}$ ltaS mutant cells fluoresced at 30°C, andthis percentage of Sytox green-positive cells increased aftera temperature upshift (Fig. 6A). To lessen the membrane stress,we added 7.5% NaCl or 40% sucrose to the nutrient agar platesand found that either treatment remarkably suppressed the growthdefect of ${Delta}$ ltaS mutant cells at 37°C (Fig. 6B). One possibleinterpretation of these results is that the growth defect ofthe ${Delta}$ ltaS mutant at high temperatures is caused, at least inpart, by loss of membrane integrity due to the loss of LTA.

View larger version (38K):
[in this window]
[in a new window]

FIG. 6. Inability to exclude Sytox green dye at high temperatures in ${Delta}$ ltaS mutant cells. (A) Exponentially growing RN4220 and M0674/pM101 ( ${Delta}$ ltaS) cells at 30°C were shifted to the indicated temperatures and sampled at the indicated times. Cells were then stained with 5 µM Sytox green, and the percentage of Sytox green-stained cells was determined under a microscope. At least 200 cells were counted. Data are means and standard deviation from three independent experiments. (B) Effect of high osmolarity on colony formation by ${Delta}$ ltaS mutant cells. Fully grown RN4220 and M0674/pM101 cells at 30°C in LB medium were serially 10-fold diluted, and each 2-µl aliquot was spotted onto LB agar (1% NaCl), LB agar with 7.5% NaCl, or LB agar with 40% sucrose. Plates were incubated at 30°C, 37°C, or 43°C for 48 h.

Accumulation of LTA intermediates cannot explain the growth defect of ${Delta}$ ltaS mutant cells. It has been proposed that the accumulation of intermediatesin WTA synthesis leads to impaired cell growth in B. subtilisand S. aureus (6, 7). This idea is based on the fact that thetagO gene, which catalyzes the first reaction of WTA biosynthesis,is dispensable for cell growth, whereas the tagBDF genes, whichact in subsequent steps of WTA biosynthesis, are indispensable.We thought that it would be interesting to know if a similarsituation exists for LTA synthesis—that is, if the accumulationof LTA intermediates (specifically glycolipids) in ${Delta}$ ltaS mutantcells may cause the growth defect at high temperatures. To testthis possibility, we generated an ltaS ypfP double mutant; theypfP gene is responsible for the synthesis of the glycolipidanchor of LTA and is dispensable for cell growth (27). Specifically,we deleted the chromosomal ypfP gene in the M0674/pM102-ltaSstrain via phage transduction, which created the YO1001/pM102-ltaSstrain; then we replaced pM102-ltaS with pM101 to remove ltaSfunction. The resultant ${Delta}$ ltaS ${Delta}$ ypfP double-mutant strain YO1001/pM101formed colonies at 30°C but not at 43°C, similar towhat was seen for the ${Delta}$ ltaS single-mutant strain M0674/pM101(data not shown). This result demonstrates that the ${Delta}$ ypfP mutationcannot suppress the growth defect of ${Delta}$ ltaS mutant cells at hightemperatures, thus arguing against the rationale that the temperaturesensitivity of ${Delta}$ ltaS is related to the accumulation of glycolipidintermediates of LTA biosynthesis.

Loss of both LTA and WTA leads to synthetic lethality in S. aureus. Wall anionic polymers of bacteria have been thought to be importantfor growth (36). To examine the requirement of WTA for the growthof LTA-depleted mutant cells, we next tested the effect of removingWTA from the S. aureus ${Delta}$ ltaS mutant. To perform this experiment,a ${Delta}$ tagO::erm construct was transduced into M0674/pM102-ltaS byusing phage 80alpha. The resultant YO1003/pM102-ltaS strainwas transformed with pM101 to remove ltaS function. The ${Delta}$ tagO ${Delta}$ ltaS double mutant, in which pM102-ltaS was successfully replacedby pM101, could not be obtained under any condition tested,including growth at 30°C on LB agar alone and on LB agarwith 40% sucrose (Table 5). This result suggests that the simultaneousdepletion of LTA and WTA leads to synthetic lethality at 30°C,thus providing evidence that S. aureus requires the presenceof at least one of these two anionic polymers for growth at30°C.

View this table:
[in this window]
[in a new window]

TABLE 5. Deficiency of both LTA and WTA leads to synthetic lethality

DISCUSSION

Top

DISCUSSION

The polyglycerolphosphate chain of LTA was recently shown tobe synthesized by LtaS. Because of the limited study of LTA-depletedcells, however, the biological roles of LTA in cell growth andthe pathogenic-bacterium-host cell interaction have not beendetermined clearly. In this study, we show that a ${Delta}$ ltaS mutationin S. aureus resulted in the depletion of LTA and a dramaticdecrease in the turnover of membrane PG. We also show that ectopicexpression of the S. aureus LtaS protein in E. coli inducedpolyglycerolphosphate synthesis in a manner dependent on pgsA,which is required for PG production. Taken together, these datastrongly suggest that ltaS encodes the polyglycerolphosphatesynthase of LTA and uses PG as a substrate. The ${Delta}$ ltaS mutantcells were viable at 30°C but not at 37°C or 43°C;thus, LTA synthesis is required for S. aureus cell growth attemperatures of 37°C and higher.

When ${Delta}$ ltaS mutant cells were shifted from 30°C to 43°C,turbidity did not continue to increase as it would for normallygrowing cells, and the number of viable cells decreased. Itshould be noted, however, that cell lysis caused by a generalattenuation of peptidoglycan biosynthesis or its degradationdoes not necessarily account for the decrease in cell viability,because ${Delta}$ ltaS mutant cells at 43°C maintained a constantturbidity and a lower autolysis activity. Moreover, levels ofpeptidoglycan hydrolase activity on the cell surface were alsodecreased. Another finding of note is that ${Delta}$ ltaS mutant cellsbecame permeable to Sytox green fluorescent dye after the temperatureupshift. Furthermore, we observed that conditions of high osmolarityremarkably suppressed the cell growth defects of ${Delta}$ ltaS mutantcells at 37°C. Therefore, LTA is required for the resistanceof low osmolarity. We also observed this phenomenon at 30°C;indeed, we found that the growth of ${Delta}$ ltaS mutant cells couldbe largely attenuated by decreasing the concentration of NaClin the LB medium from 1% to 0.5% (data not shown).

One explanation both for the inability to exclude the dye athigh temperatures and for the high-osmolarity requirement ofthe ${Delta}$ ltaS mutant is that a protein(s) involved directly or indirectlyin systems for excluding the dye requires LTA or high osmolarityfor its structure or function. Another explanation is that LTAis required for membrane integrity. Because LTA is one of theconstituents of membrane lipids and has been reported to stabilizecell membranes by increasing the phase transition temperature(16), this cell membrane-stabilizing effect of LTA might functionin maintaining the membrane integrity, and thus the cell viability,of S. aureus at higher temperatures. Alternatively, LTA in cooperationwith peptidoglycan and WTA might be needed to compose a cellwall structure adequate to resist intracellular osmotic pressureacross the cell membrane. The high-osmolarity requirement ofthe ${Delta}$ ltaS mutant seems consistent with this notion.

An idea for the role of LTA in resisting low osmolarity is thatLTA is important for osmotic regulation in S. aureus and otherLTA-containing gram-positive bacteria, a role similar to thatof membrane-derived oligosaccharides (MDOs) in E. coli and relatedgram-negative bacteria. E. coli MDOs are located in the periplasmicspace and are a family of soluble glucans of 5 to 12 glucosemolecules that are substituted with phosphoglycerol and phosphoethanolaminegroups (43). It is thought that MDOs release fixed anions intothe periplasmic space and that negatively charged MDOs and theircounter-ions are the principal source of the osmotic pressurein the space of cells (26). LTA contains anionic polymers ofphosphoglycerol and thus releases fixed anions on the outsideof the cell membrane. LTA and its counter-ions could providelocal osmotic pressure on the outside of the cell membrane andcould thus reduce osmotic stress; this idea could explain thehigh-osmolarity requirement of the ${Delta}$ ltaS mutant. The expectedroles of LTA described above might function in combination.Further studies to uncover the roles of LTA in resisting lowosmolarity are needed.

LTA and WTA are negatively charged polymers and are thoughtto have similar functions on the cell surface. We have shownthat deletion of both ltaS and tagO leads to synthetic lethalityat 30°C. Thus, WTA appears to compensate for a loss of LTA,and vice versa. This genetic evidence demonstrates the essentialnature of wall anionic polymers for the growth of S. aureus.

While LTA-depleted S. aureus mutant cells were temperature sensitive,no increase in the LTA content was observed in normal cellsafter a temperature upshift (data not shown). Recently, it wasreported that LTA was reduced to 1/10 of its normal levels in ${Delta}$ ypfP mutant cells, which nevertheless grew normally (10). Thus,the amount of LTA required for normal cell growth is much smallerthan its typical content in wild-type cells; this finding couldhelp explain why the LTA content did not increase at highertemperatures.

The ${Delta}$ ltaS mutation resulted in aberrant cell division and separation,lower levels of peptidoglycan hydrolase activity on the cellsurface than in parent cells, and decreased autolysis. Interestingly,the irregularity in cell separation that we observed in ${Delta}$ ltaScells is similar to that observed for the ${Delta}$ atl peptidoglycanhydrolase autolysin mutant and the ${Delta}$ sle1 peptidoglycan amidasemutant (25, 46). The S. aureus Atl protein is known to localizeto the cell division plane and the predicted cell division site;the binding of Atl to LTA is predicted to be involved in septallocalization (53). Thus, it seems reasonable that LTA mightbe involved in cell separation by maintaining the amount andlocalization of peptidoglycan hydrolases on the cell surface.Moreover, we speculate that LtaS may localize to the cell divisionplane, where it would act to synthesize nascent LTA chains atthe septum. Support for this idea comes from a previous reportthat YpfP, which is required for glycolipid anchor synthesis,is localized to the cell division plane (49).

Our measurement of the t_1/2 of PG revealed that LTA synthesishas a dramatic effect on membrane phospholipid metabolism, suggestingthat about half the PG molecules on the cell membrane are usedfor LTA synthesis in one doubling time. Concomitant with LTAsynthesis, a large quantity of diacylglycerol is produced onthe outer leaflet of the cell membrane. These molecules mustbe translocated to the cytoplasmic side of the cell membraneso that they can be used for phosphatidic acid production. Thisprocess requires the translocation of a large number of molecules.Thus, phospholipid metabolism might have a role in the maintenanceof cell physiology and cell cycle events, since the activityof the replication initiator protein DnaA is sensitive to acidicphospholipids (20, 44, 52). In the future, it will be interestingto learn more about the role of LTA synthesis in cell divisionand separation.

Because the catalytic domain of LtaS is oriented toward theextracellular space, inhibitors of LtaS would not need to permeatethe bacterial cell membrane; thus, soluble compounds, whichhave favorable pharmacological properties, could be consideredin the design of therapeutics. In addition, since S. aureusis a normal constituent of the resident flora in animals, thefact that ${Delta}$ ltaS mutant cells cannot grow at the physiologicaltemperature of 37°C is interesting. Moreover, the LtaS proteinhas been conserved among those gram-positive pathogenic bacteriathat have glycerol phosphate-type LTA. These factors make LtaSan attractive target for the development of antimicrobial agents.

We have uncovered permissive conditions for ${Delta}$ ltaS mutant cells.The identification of the temperature-sensitive nature of ${Delta}$ ltaSmutant cells is important, because it enables us to cultureLTA-depleted mutant cells and thus makes it possible to analyzethe physiological roles of LTA in bacterium-host cell interactions.

ACKNOWLEDGMENTS

We thank T. Santa and R. Taguchi (University of Tokyo) for theirkind help with HPLC and MS analyses of lipids, respectively.We also thank W. Hillen, S. Yasuda, K. Hiramatsu, and J. J.Ferretti for kindly providing pWH353, pBAD24, pN315, and pSF151,respectively.

This work was supported in part by the Japan Science and TechnologyAgency (2005) and by the Industrial Technology Research GrantProgram of the New Energy and Industrial Technology DevelopmentOrganization of Japan (2004).

FOOTNOTES

* Corresponding author. Mailing address: Laboratory of Microbiology, Graduate School of Pharmaceutical Sciences, University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Phone: 81-3-5841-4821. Fax: 81-3-5684-2973. E-mail: kurokawa{at}mol.f.u-tokyo.ac.jp

Published ahead of print on 24 October 2008.

Supplemental material for this article may be found at http://jb.asm.org/.

Present address: Wellcome Trust Centre for Gene Regulation andExpression, College of Life Sciences, University of Dundee,Dundee DD1 5EH, United Kingdom.

Present address: Department of Bacteriology, Faculty of Medicine,Juntendo University, Bunkyo-ku, Tokyo 113-8421, Japan.

REFERENCES

Top