This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow An author's correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holden, M. T. G.
Right arrow Articles by Parkhill, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holden, M. T. G.
Right arrow Articles by Parkhill, J.

 Previous Article  |  Next Article 

Journal of Bacteriology, January 2009, p. 261-277, Vol. 191, No. 1
0021-9193/09/$08.00+0     doi:10.1128/JB.01230-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The Genome of Burkholderia cenocepacia J2315, an Epidemic Pathogen of Cystic Fibrosis Patients {triangledown} ,{dagger}

Matthew T. G. Holden,1* Helena M. B. Seth-Smith,1 Lisa C. Crossman,1 Mohammed Sebaihia,1 Stephen D. Bentley,1 Ana M. Cerdeño-Tárraga,1 Nicholas R. Thomson,1 Nathalie Bason,1 Michael A. Quail,1 Sarah Sharp,1 Inna Cherevach,1 Carol Churcher,1 Ian Goodhead,1,{ddagger} Heidi Hauser,1 Nancy Holroyd,1 Karen Mungall,1 Paul Scott,1 Danielle Walker,1 Brian White,1 Helen Rose,2 Pernille Iversen,3 Dalila Mil-Homens,4 Eduardo P. C. Rocha,5,6 Arsenio M. Fialho,4 Adam Baldwin,7 Christopher Dowson,7 Bart G. Barrell,1 John R. Govan,8 Peter Vandamme,9 C. Anthony Hart,10 Eshwar Mahenthiralingam,2 and Julian Parkhill1

The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus, Cambridge CB10 1SA, United Kingdom,1 Cardiff School of Biosciences, University of Cardiff, Cardiff CF10 3TL, United Kingdom,2 Department of Molecular Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark,3 IBB-Institute for Biotechnology and Bioengineering, Center for Biological and Chemical Engineering, Instituto Superior Técnico, Lisbon 1049-001, Portugal,4 UPMC University of Paris 06, Atelier de BioInformatique, F-75005 Paris, France,5 Institut Pasteur, Microbial Evolutionary Genomics, CNRS, URA2171, F-75015 Paris, France,6 Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom,7 University of Edinburgh Medical School, Little France Crescent, Edinburgh EH16 4SB, United Kingdom,8 Laboratorium voor Microbiologie, Universiteit Gent, Ledeganckstraat 35, B-9000 Ghent, Belgium,9 Division of Medical Microbiology, University of Liverpool, Daulby Street, Liverpool L69 3GA, United Kingdom,10

Received 3 September 2008/ Accepted 27 September 2008


arrow
ABSTRACT
 
Bacterial infections of the lungs of cystic fibrosis (CF) patients cause major complications in the treatment of this common genetic disease. Burkholderia cenocepacia infection is particularly problematic since this organism has high levels of antibiotic resistance, making it difficult to eradicate; the resulting chronic infections are associated with severe declines in lung function and increased mortality rates. B. cenocepacia strain J2315 was isolated from a CF patient and is a member of the epidemic ET12 lineage that originated in Canada or the United Kingdom and spread to Europe. The 8.06-Mb genome of this highly transmissible pathogen comprises three circular chromosomes and a plasmid and encodes a broad array of functions typical of this metabolically versatile genus, as well as numerous virulence and drug resistance functions. Although B. cenocepacia strains can be isolated from soil and can be pathogenic to both plants and man, J2315 is representative of a lineage of B. cenocepacia rarely isolated from the environment and which spreads between CF patients. Comparative analysis revealed that ca. 21% of the genome is unique in comparison to other strains of B. cenocepacia, highlighting the genomic plasticity of this species. Pseudogenes in virulence determinants suggest that the pathogenic response of J2315 may have been recently selected to promote persistence in the CF lung. The J2315 genome contains evidence that its unique and highly adapted genetic content has played a significant role in its success as an epidemic CF pathogen.


arrow
INTRODUCTION
 
Burkholderia cenocepacia is the most clinically important member of B. cepacia complex (BCC) group of opportunistic pathogens to cause lung infections in cystic fibrosis (CF) patients (83, 140). The BCC (originally described as Pseudomonas cepacia) emerged as significant CF pathogens in the early 1980s when a minority of infected patients exhibited rapid clinical deterioration due to necrotizing pneumonia and sepsis, resulting in early death (54). This fatal decline in clinical condition became known as "cepacia syndrome" and has not been observed with any other CF pathogen. The key determinants associated with this syndrome are not clear; clonal isolates can be isolated from patients with or without cepacia syndrome, suggesting that both bacterial and host factors play important roles in determining clinical prognosis (44, 57). During the 1990s a highly transmissible epidemic B. cenocepacia lineage emerged that was readily spread between individuals with CF (44); multilocus enzyme electrophoresis designated it as electrophoretic type 12 (ET12) (56). Subsequent studies showed that this B. cenocepacia strain was widespread across Canadian (80, 126), United Kingdom (44), and European (140) CF communities and was suggested to have spread through patient-to-patient contacts, including those at CF summer camps (44).

At least 17 species comprise the BCC (79, 141, 142), a diverse collection of genetically distinct but phenotypically similar strains that includes bioremediation and biocontrol strains, as well as plant, animal, and human pathogens (83). Although strains from each of the BCC species have been isolated from CF infection (83), epidemics are largely attributed to B. cenocepacia (25, 27) and Burkholderia multivorans (120) strains. Phylogenetic analysis of the recA gene subdivides B. cenocepacia into four distinct subgroups (141), with subgroup IIIA containing the ET12 epidemic strain, associated with "cepacia syndrome" (54), clinical deterioration, increased mortality (44, 57), and the ability to superinfect over existing B. multivorans lung infection (84). Virulence markers, such as the B. cepacia epidemic strain marker and the B. cenocepacia island (CCI), are more frequently associated with B. cenocepacia IIIA strains than other B. cenocepacia recA subgroups (10). In addition, ET12 isolates possess the cable pilus (83, 137). Unlike other B. cenocepacia subgroups, which can frequently be recovered from the natural environment (31, 70), very few environmental B. cenocepacia IIIA strains have been described (8), suggesting a definite shift from a soil saprophyte to host-associated pathogen lifestyle.

The genome of B. cenocepacia strain J2315, a multidrug-resistant CF patient isolate belonging to the ET12 lineage (44, 100), has been sequenced. The genomic analysis of B. cenocepacia J2315 provides insights into the success of this strain and how the ET12 lineage appears to have recently adapted to its clinical niche in human infection.


arrow
MATERIALS AND METHODS
 
Bacterial strains. B. cenocepacia strain J2315 (CF5610) was isolated in 1989 from the sputum of a CF patient in Edinburgh, who was the United Kingdom index case of the highly transmissible ET12 lineage (44). J2315 is resistant to the aminoglycosides amikacin and tobramycin, the macrolide azithromycin, the β-lactams imipenem and piperacillin, and cotrimoxazole (trimethoprim-sulfamethoxazole) and also exhibits intermediate resistance to the fluoroquinolone ciprofloxacin. Strain J2315 has been deposited as LMG 16656 in the BCCM/LMG Bacteria Collection.

Additional B. cenocepacia strains used in the present study were K56-2*, BC7*, LMG 13307 (BCC0162), CEP0791 (BCC0077), LMG 13320 (BCC0179), FC0504 (BCC0313), LMG 18827* (BCC0016), BCC1261, CEP0826 (BCC0222). (An asterisk [*] indicates strains that are part of the published BCC strains panel [81]). All strains had previously been sequence typed (9).

Genome sequencing. (i) Whole-genome sequencing. Strain J2315 was grown, and DNA was extracted exactly as described previously (82). Sequence data were obtained from 215,165 end sequences (giving approximately 11.9-fold coverage) derived from m13mp18 and pUC18 genomic shotgun libraries (with insert sizes of 1 to 6 kb) using BigDye terminator chemistry on ABI 3700 automated sequencers. A total of 4,300 end sequences from a large insert bacterial artificial chromosome library (with insert sizes of 10 to 20 kb) were used as a scaffold. All identified repeats were bridged by read-pairs or end-sequenced PCR products.

The sequence was annotated by using Artemis software (112). Initial coding sequence (CDS) predictions were performed by using Orpheus (40), Glimmer2 (34), and EasyGene (69) software. These predictions were amalgamated, and codon usage, positional base preference methods, and comparisons to the nonredundant protein databases using BLAST (4) and FASTA (106) software were used to refine the predictions. The entire DNA sequence was also compared in all six reading frames against UniProt, using BLASTX (4) to identify any possible CDSs previously missed. Protein motifs were identified by using Pfam (12) and Prosite (37), transmembrane domains were identified with TMHMM (65), and signal sequences were identified with SignalP version 2.0 (98). rRNAs were identified by using BLASTN (4) alignment to defined rRNAs from the EMBL nucleotide database; tRNAs were identified by using tRNAscan-SE (75); stable RNAs were identified by using Rfam (46).

(ii) Comparative genomics. Comparison of genome sequences was facilitated by using Artemis Comparison Tool (22), which enabled visualization of BLASTN and TBLASTX comparisons (4). Orthologous proteins were identified as reciprocal best matches by using FASTA (106) with manual curation. Pseudogenes had one or more mutations that would prevent correct translation; all inactivating mutations were checked against original sequencing data.

The J2315 genome was compared to B. vietnamensis strain G4 (accession numbers CP000614, CP000615, and CP000616) (97), B. contaminans strain 383 (CP000151, CP000152, and CP000153) (127, 141), B. ambifaria strain AMMD (CP000440, CP000441, and CP000442) (26), B. cenocepacia strains AU1054 (CP000378, CP000379, and CP000380) (http://genome.jgi-psf.org/finished_microbes/burca/burca.home.html) and HI2424 (CP000458, CP000459, and CP000460) (70), B. pseudomallei strain K96243 (BX571965 and BX571966) (51), B. mallei strain ATCC 23344 (CP000010 and CP000011) (99), B. thailandensis strain E264 (CP000086 and CP000085) (148), B. xenovorans strain LB400 (CP000270, CP000271, and CP000272) (23), and Ralstonia solanacearum strain GMI1000 (118).

PCR screening. PCR amplification was performed by using Platinum Pfx DNA polymerase (Invitrogen) according to the supplied protocols, with the optional addition of 1/10 enhancer solution. Amplification consisted of 94°C for 10 min, followed by 40 cycles of 94°C for 30 s, a suitable annealing temperature for 30 s, and 68°C for 1 min per kb. A final extension of 10 min at 68°C was used. The primers, along with the annealing temperature(s) used, were as follows: BCAL3125 (AATCGGAACAGGTTGCACTC and AAACTGGAATGCGAAGATGC), 60°C; BCAL3223 (ACCGATGTCTTCCTGTTTGG and AGCGGATGGTTCTTGATGAC), 60 to 68°C; BCAL3517 (GCACGTTGATTGTTTCTTTGC and AATCGGGATCGACCTTGAC), 63 to 68°C; BCAM0856 (TCGAAATACTTGTGCGCTTG and ACAGGAAGTGGTAGCCGATG), 68°C; and BCAM2228 (GAACCTGACGGTGCTGAAC and GTAGACGGACAGGTCGAAGC), 68°C.

EMBL accession numbers. The sequence and annotation of the B. cenocepacia strain J2315 genome have been deposited in the EMBL database under accession numbers AM747720, AM747721, AM747722, and AM747723.


arrow
RESULTS
 
General features of the J2315 genome. The complete genome of B. cenocepacia strain J2315 consists of three circular chromosomes of 3,870,082, 3,217,062, and 875,977 bp and a plasmid of 92,661 bp (Fig. 1). These four replicons encode 3,537, 2,849, 776, and 99 predicted CDSs, respectively (for a summary of the features of the replicons, see Table 1), of which 126 are pseudogenes or partial genes. Identification of essential genes on chromosomes 2 and 3 led to designation of these components of the genome as chromosomes rather than megaplasmids.


Figure 1
View larger version (82K):
[in this window]
[in a new window]

 
FIG. 1. Schematic circular diagrams of the B. cenocepacia J2315 genome. The circular diagrams for chromosomes 1 (A) and 2 (B) are drawn to scale, whereas those for chromosome 3 (C) and plasmid pBCJ2315 (D) are not drawn to scale. Black circles representing these replicons are drawn to scale. The key for the three chromosomal circular diagrams (A, B, and C; outside to inside), with scale in Mb, is as follows. Annotated CDSs are colored according to the predicted function represented on a pair of concentric circles, representing both coding strands. CDSs in genomic island regions are indicated in green, and other RODs defined by pairwise genome comparisons with other BCC are indicated in red. CDSs with matches identified by reciprocal FASTA with other Burkholderia species—B. cenocepacia HI2424, B. cenocepacia AU1054, B. contaminans 383, B. ambifaria AMMD, B. vietnamiensis G4, B. xenovorans LB400, B. pseudomallei K96243, and B. thailandensis E264—are indicated in dark blue. Orthologues shared with Ralstonia solanacearum GMI1000 are indicated in purple. For the G+C content plot, the GC bias (G–C/G+C) is indicated as >1% in khaki and <1% in purple. (D) The key for the circular diagram for plasmid pBCJ2315 is as described for the chromosomes but lacks the orthologue matches. Color coding for CDS functions: dark blue for pathogenicity/adaptation, black for energy metabolism, red for information transfer, dark green for surface associated, cyan for degradation of large molecules, magenta for degradation of small molecules, yellow for central/intermediary metabolism, pale green for unknown, pale blue for regulators, orange for conserved hypothetical, brown for pseudogenes, pink for phage and IS elements, and gray for miscellaneous.


View this table:
[in this window]
[in a new window]

 
TABLE 1. General properties of the B. cenocepacia J2315 genome

Inter-replicon comparisons revealed very little extended similarity except in the regions of the rRNA clusters (data not shown). Intrareplicon comparison revealed that chromosome 1 contains a 57-kb perfect duplication (BCAL0969 to BCAL1026 and BCAL2901 to BCAL2846). The duplicated regions are at different locations on the chromosome, and each contains 57 CDSs, leading to an increase in the gene dosage of CDSs that encode a diverse collection of functions, including molybdopterin biosynthesis proteins, RNase E, ribosomal protein, fatty acid/phospholipid synthesis proteins, sigma-E factor and regulon, GTP-binding protein LepA, signal peptidase I, RNase III, DNA repair protein RecO, elongation factor P, and CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase.

Analysis of the predicted functions of the CDSs on the chromosomes revealed distinct partitioning of functions, as has been previously seen in other Burkholderiaceae (51): chromosome 1 contains a higher proportion of CDSs involved in core functions (cell division, central metabolism, and other "housekeeping" functions), whereas chromosomes 2 and 3 contain a greater proportion of CDSs encoding accessory functions, such as protective responses and horizontal gene transfer, and a greater proportion of CDSs with unknown functions (Fig. 2).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 2. Relative distribution of CDSs belonging to different functional classes on the three chromosomes of B. cenocepacia J2315. Figures for the distribution of the functional classes on a chromosome are expressed as a ratio of the number of CDSs of a class per replicon against the total number CDSs for that class in the genome, normalized per number of CDS on that replicon.

Comparative genomics. The J2315 genome was compared to five other complete BCC genomes in the public databases: Burkholderia vietnamiensis strain G4, an aromatic hydrocarbon degrading environmental isolate (97); Burkholderia contaminans strain 383, a soil isolate (127, 141); Burkholderia ambifaria strain AMMD, a plant-associated biocontrol strain (26); and B. cenocepacia IIIB strains AU1054 (http://genome.jgi-psf.org/finished_microbes/burca/burca.home.html) and HI2424 (70), isolated from a CF patient and soil, respectively. Both of these B. cenocepacia strains are representatives of the B. cenocepacia PHDC clonal lineage (25) that is widely distributed in the United States (71). In addition, the genomes of four other Burkholderia species were compared: Burkholderia pseudomallei (51) and Burkholderia mallei (99), biothreat agents that cause melioidosis and glanders, respectively; Burkholderia thailandensis (148), a soil saprophyte related to B. pseudomallei and B. mallei; and Burkholderia xenovorans (23), a nonpathogenic soil isolate that degrades polychlorinated biphenyl (PCB) compounds. Ralstonia solanacearum (118), a plant pathogenic member of the Burkholderiaceae, was also included as an outlier.

The number of orthologous CDSs identified by best reciprocal FASTA in the genome of J2315 correlated with taxonomic relatedness (Fig. 3) (141); the largest number of orthologs were identified in the BCC (78 to 63% of total CDSs), followed by other Burkholderia species (56 to 50%), and Ralstonia solanacearum (37%). The distribution of orthologs on the different replicons is similar to that seen in other Burkholderia species, where the level of orthology is greatest on the largest chromosome, with the secondary chromosomes being progressively more divergent (51). The relative diversity of the chromosomes was also evident in pairwise alignments that illustrate regions of similarity and the overall genome structure. A comparison of concatenated genomes of B. cenocepacia J2315, B. pseudomallei K96243, and B. xenovorans LB400 shows that, of all the chromosomes, chromosome 1 displays the greatest level of conservation, both in the number and the order of matches (see Fig. S1 in the supplemental material). The largest chromosomes of these three Burkholderia species contain colinear and inverted blocks of similarity, suggesting that these replicons have undergone several rearrangement events since they diverged from a common ancestor. The second chromosome exhibits lower levels of overall conservation. Although there are matches between the third chromosomes of B. cenocepacia and B. xenovorans (the genome of B. pseudomallei only contains two replicons), there is no detectable conservation of gene order.


Figure 3
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 3. Comparison of the distribution of B. cenocepacia J2315 orthologs. Orthologs were identified in the Burkholderiaceae genomes B. cenocepacia HI2424, B. cenocepacia AU1054, B. contaminans 383, B. ambifaria AMMD, B. vietnamiensis G4, B. xenovorans LB400, B. pseudomallei K96243, and B. thailandensis E264 and in Ralstonia solanacearum GMI1000. Orthologs were identified by best reciprocal FASTA with an identity cutoff of 30% and a length of match cutoff of 80%. The percentages of matches for individual J2315 chromosomes and the total genome are plotted.

RODs in the B. cenocepacia J2315 genome. Pairwise genome comparisons of the B. cenocepacia strain J2315 genome to the other B. cenocepacia strains identified regions of difference (RODs) comprising ca. 21% of the DNA in J2315. These include genomic islands (Table 2 and Fig. 1) that are likely to have arisen from recent horizontal gene transfer (9.3% of the chromosomal DNA) and encompasses mobile genetic elements (MGEs). In addition to the genomic islands, the J2315 genome contains 79 insertion sequence (IS) elements (Table 1 and see Table S1 in the supplemental material). Genomic islands were defined as regions displaying anomalies in %G+C content or dinucleotide frequency signature (which is indicative of very recent lateral transfer) and/or contained CDSs with similarities to genes associated with MGEs such as bacteriophages, transposons, and plasmids. Boundaries of genomic islands were mapped by using comparative genomic analysis. Other RODs in the J2315 genome (11.7% of the chromosomal DNA) include indel regions that represent lineage-specific DNA insertions or deletions and allelic variants that have divergent sequences at the same locus (Fig. 1). For the purpose of our analysis, we have not included RODs that do not include at least one complete CDS. Although these other RODs were identified as being unique in comparison to B. cenocepacia strains AU1054 and HI2424, many of these regions are ancestral regions that have been deleted in the other B. cenocepacia genomes relative to J2315 and the other BCC. For example, if B. contaminans strain 383 is included in the comparison, the unique component of the J2315 genome falls to 7.0% (see Table S2 in the supplemental material).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Genomic islands of B. cenocepacia strain J2315a

The ET12 lineage of B. cenocepacia emerged recently and proved very successful at spreading between patients and causing disease (83). A possible contributory factor in its rise could be the horizontal transfer of DNA. Fourteen regions in the J2315 genome were identified as putative genomic islands (Table 2), all fourteen of which are absent from the genomes of B. cenocepacia AU1054 and HI2424.

The CCI, identified in the J2315 genome as genomic island 11 (BcenGI11; Table 2), has been shown to play a role in infection (10, 84). When originally described, comparative analysis of other BCC genomes was not available to allow the boundaries of the island to be accurately predicted. The current analysis defines the CCI as a 44-kb region, 12 kb and six CDSs larger than its original description (10). New functions attributed to the island include arsenic resistance, antibiotic resistance, ion and sulfate family transporter, and stress response, in addition to the fatty acid metabolism, amino acid transport and utilization, and various regulators that include an N-acyl-homoserine lactone-dependent quorum-sensing system originally described (10).

The genome also provides evidence that the pan genome of B. cenocepacia encompasses elements that may circulate in the wider bacterial population, as several of the genomic islands are similar to elements identified in other Burkholderia species. The J2315 genome contains at least five prophages, one of which, BcenGI1, exhibits extended mosaic similarity to the {phi}K96243 prophage in the B. pseudomallei K96243 genome (BP_GI1; see Fig. S2A in the supplemental material) (51).

Comparative genomic analysis identified related genomic islands that integrate at orthologous sites in different species. BcenGI2 is a 16.4-kb genomic island that contains CDSs with similarity to plasmid conjugal transfer proteins, suggesting that it may be an integrated conjugative element (21). BcenGI2 is integrated at a tRNAAla gene and has some similarity to an island (BP_GI11) integrated at the orthologous site in the B. pseudomallei K96243 genome (see Fig. S2B in the supplemental material). This locus may be a hot spot for the traffic of related islands in Burkholderia.

Genomic inventory of a versatile pathogen. The recent ecology of the ET12 lineage of B. cenocepacia is that of a human-associated pathogen, and as such the genome of strain J2315 appears to be well equipped with functions associated with virulence in the CF lung (for a summary, see Table 3) . There is also evidence in the genome of the wider host associations of this species, underlying its environmental origins. Orthologous matches to putative J2315 virulence factors were found in the other Burkholderia genomes investigated, which included environmental bacteria. For example, ~80% of the J2315 virulence functions have orthologous matches to other B. cenocepacia strains, ~74% have matches to B. contaminans strain 383, and ~68% have matches to B. pseudomallei. Many of these functions therefore represent Burkholderia-wide functions, which may promote survival in challenging and complex environments such as the soil and rhizosphere but may also have utility in the CF lung. In addition, comparative analysis has highlighted virulence determinants in variable regions of the J2315 genome (Table 3 and see Table S2 in the supplemental material), suggesting that this strain may have supplemented its core virulence determinants with accessory virulence functions to enhance its disease causing ability.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Potential virulence functions encoded in the genome of B. cenocepacia strain J2315

Exoenzymes. Exoenzymes produced by B. cenocepacia play an important role in modulating host cell interactions. Two secreted zinc metalloproteases, ZmpA and ZmpB (Table 3), have been found to have proteolytic activity against a range of host molecules and have been implicated in the virulence of B. cenocepacia (29, 62, 63). Phospholipases are widely distributed in bacteria and have been shown to mediate various cellular functions, including membrane maintenance, cellular turnover, and inflammatory response. Production of phospholipase C is linked with CF isolates from patients of poor clinical status (68). The J2315 genome encodes five homologs of Pseudomonas aeruginosa phospholipase C proteins (Table 3). The redundancy of these phospholipid-degrading enzymes suggests that there is some functional specificity. To this end, studies of the Plc-1 and Plc-2 phospholipases C from B. pseudomallei (orthologues of which are present in the J2315 genome; BCAL1046 and BCAM2429, respectively) have demonstrated that although they both hydrolyze phospholipid phosphatidylcholine and sphingomyelin, they exhibit marked differences in their cytotoxicity (64).

In addition to the five phospholipase C homologs the J2315 genome contains a putative phosphatidylinositol-specific phospholipase C (PI-PLC; BCAM1969). Analysis of the taxonomic distribution of proteins containing the PI-PLC domain PF04185 reveals a very limited occurrence; among the gram-negative bacteria, Burkholderia is the only genus within which these proteins have been found, and among the gram-positive bacteria, they have been found in an actinobacterium and some firmicutes, including pathogenic bacilli, Staphylococcus aureus, and Listeria monocytogenes (for the species distribution, see http://pfam.sanger.ac.uk/family?acc=PF00388). In this latter group of pathogens, PI-PLCs have been shown to have a role in virulence (146, 149).

The J2315 genome also contains putative secreted proteins similar to virulence factors produced by bacterial plant pathogens associated with the degradation of plant tissue. Two CDSs encode polygalacturonases, exoproteins that degrade pectin, a major component of plant cell walls; BCAM2783 and BCAS0196 are 69.1 and 31.9% identical to polygalacturonases from R. solanacearum (43) and Agrobacterium vitis (50), respectively. In addition to these degradative enzymes, the genome also contains a locus (BCAM0153 to BCAM0156) encoding additional pectin degradation components.

Secretion. Further evidence of the plant associations of B. cenocepacia are found in the secretion systems. The J2315 genome encodes a type IV secretion system (T4SS) associated with disease in plants; the plasmid-encoded T4SS (Table 3) secretes plant cytotoxic proteins responsible for plant tissue watersoaking (ptw) on onions (35). In addition, there is a cluster on chromosome 2 (Table 3) that is similar to the ptw cluster and other T4SSs. The function of this cluster (vir) is unclear: mutants do not affect expression of the ptw phenotype. The organization of the vir cluster is similar to that of the virB clusters of Brucella abortus and Agrobacterium tumefaciens, although it lacks homologues of virB5 and virB7. The cluster contains two additional CDSs between the virB6 (BCAM0328) and virB8 (BCAM0331) homologues, similar to traF (BCAM0329) and traI (BCAM0330) components of the pSB102 plasmid conjugation system. These tra system components are functionally equivalent to virB5 and virB7. It is unlikely that this cluster is functional in J2315, since the virD4 homologue (BCAM0335) contains a frameshift mutation.

The type III secretion system (T3SS; Table 3) is associated with pathogenesis: mutants in the T3SS demonstrate reduced virulence in a murine model of infection (132) and in a Caenorhabditis elegans killing assay (86). T3SSs have been shown to be important in the intracellular survival of several pathogens; however, there is no evidence that this is the case in B. cenocepacia: internalization and survival of J2315 T3SS mutants in macrophages was the same as for the wild type (67).

There are four type V secretion (T5S) proteins in the genome (Table 3). Two of these autotransporters contain pertactin domains (Pfam PF03212; BCAL3353 and BCAM0183), and the other two contain hemagglutinin repeat domains (Pfam PF05594; BCAM2169 and BCAS0321).

The extensive array of secretion systems has further been enhanced by the identification of a type VI secretion (T6S) system on chromosome 2 (Table 3). Three T6S system clusters have been identified in P. aeruginosa (33), one of which (HSI-I) has been demonstrated to be essential in the chronic rat lung infection model (108). HSI-I exports Hcp1, a hexameric protein that has been detected in pulmonary secretions of CF patients, and Hcp1-specific antibodies detected their in sera (93).

In contrast to the other pathogenic Burkholderia sequenced, B. cenocepacia J2315 does not exhibit a large redundancy of secretion systems. For example, B. mallei, and B. pseudomallei possess four and six T6SSs, respectively (119), and two and three T3SSs, respectively (51, 99).

LPS and exopolysaccharide (EPS). Lipopolysaccharide (LPS) produced by B. cenocepacia has an important role in both disease and resistance to antimicrobial peptides. The LPS of the ET12 strain C1359 has been demonstrated to be endotoxic and to stimulate tumor necrosis factor production in greater quantities than that of P. aeruginosa (121). Three clusters in the J2315 genome are associated with the production of the core (BCAL2402 to BCAL2408), O antigen (BCAL3110 to BCAL3125) (101), and lipid A modification (BCAL1929 to BCAL1935) of LPS. However, strain J2315 has lost its ability to make complete LPS O antigen, due to an IS insertion in the glycosyltransferase BCAL3125 (101).

The structure and composition of B. cenocepacia LPS contributes to the intrinsic resistance to aminoglycoside (30, 91) and polymyxin. The presence of 4-amino-4-deoxy-L-arabinose moieties within the inner core region has been shown to reduce the binding of cationic antibiotics such as polymyxin B to B. cenocepacia LPS (74, 122). A locus on chromosome 1 (BCAL1929 to BCAL1935) is similar to a cluster of six CDSs in E. coli and Salmonella that have been shown to direct the transfer of 4-amino-4-deoxy-L-arabinose to lipid A in polymyxin-resistant mutants (134). Interestingly, in pathogens such as Salmonella, polymyxin B acts as an antagonist of LPS pathological activity; however, in B. cenocepacia this antibiotic enhances its activity (122). A recent study showed that this cluster is essential for the viability of B. cenocepacia and that a reduction in viability was accompanied by changes in cell morphology (102).

A cluster associated with the production of cepacian (B. cenocepacia-specific EPS) has been identified (Table 3) (92). J2135 does not produce cepacian; a CDS (BCAM0856) in the cluster contains a frameshift mutation (11-bp deletion). Although J2315 is described phenotypically as nonmucoid (49), the genome contains several other loci that encode putative EPS-related functions (Table 3), suggesting that J2315 may have the ability to produce capsular material under some environmental conditions. One of these clusters (BCAL3217 to BCAL3246) (105) is similar to the capsular polysaccharide cluster of B. pseudomallei K96243 (51), containing two regions of similarity (BCAL3217 to BCAL3223 and BCAL3240 to BCAL3246) separated by a block of divergent sequence (BCAL3227 to BCAL3239). This cluster is probably not expressed in J2315 since it contains an IS element that disrupts a putative capsule polysaccharide biosynthesis/export protein (BCAL3223).

Pili, fimbriae, and adhesins. The adherence of pathogenic bacteria to host cells is often associated with pili, fimbriae, and adhesins. These surface-expressed structures can modulate interactions with host cells and other bacterial cells and can target cells to a site of infection. Members of the BCC possess an array of different types of appendage pili: electron microscopy studies identified five morphologically distinct classes of appendage pili in BCC strains (42).

The cable pilus is associated with the ET12 B. cenocepacia lineage (130) and modulates binding to host molecules such as cytokeratin 13 (116) and mucins (115) that are abundant in the CF lung. The cable pilus gene cluster is located on chromosome 2 and consists of seven CDSs (Table 3), four of which encode structural and processing components (cblDCAB) and three of which encode regulatory components (cblRTS). The pili are arranged as large peritrichous individual fibers 2 to 4 µm in length and are associated with a 22-kDa adhesion protein (AdhA) (137). Both the cbl cluster and adhA are in RODs, as is one of the three chaperone-usher-type fimbria clusters contained within the J2315 genome (Table 3). The first of these clusters encodes a fimbrial protein (BCAL1677) similar to the type I fimbrial protein FimA from E. coli (60). The other two clusters do not contain homologs of characterized fimbrial proteins, although both clusters contain exported proteins (BCAL1826; BCAL2634a and BCAL2635) which may be fimbrial components.

Type IV pili have been shown to modulate a variety of processes, including adhesion, twitching motility, and biofilm initiation and development (20). In B. pseudomallei a type IV pilin deletion mutant (pilA mutant) was attenuated in mouse and nematode models of virulence (36). Type IV pili have also been shown to play a role in the adherence of B. pseudomallei to eukaryotic cells. Microcolony formation is a key process in cell adherence—an ability reduced in pilA mutants (15). In P. aeruginosa, type IV pili have been shown to bind to human epithelial cells (53), as well as induce apoptosis (55). The observation that these pili also bind DNA (143) suggests that they may play an important role in the formation of biofilms in the CF lung, where DNA is an abundant matrix molecule. There are several loci in the J2315 genome that encode components of a type IVa pilus, as well as two clusters that encode Flp-type pili (Table 3) (58).

The J2315 genome contains eight BuHA family proteins (Table 3), five of which are unique to J2315 and are present in RODs (see Table S2 in the supplemental material). This family of autotransporting membrane proteins contain a C-terminal YadA domain, together with HIM and Hep_Hag domains, a domain architecture that is shared with hemagglutinins and invasins that mediate bacterial interactions with host cells or extracellular matrix proteins. In B. mallei BuHA proteins expressed in vivo during experimental equine glanders infection were found to be immunodominant (131). The distribution of these proteins is widespread in gram-negative bacteria; however, the genomes of Burkholderia species, especially the pathogenic members of the genus, contain greater numbers of members of this family.

Iron metabolism. Iron is vital for life; however, much of the iron in the human body is complexed by compounds such as ferritin. In order for B. cenocepacia to survive in the host, iron must be scavenged via the production and uptake of siderophores. Biosynthesis clusters for ornibactin, salicylic acid (SA), and pyochelin siderophores are present in the J2315 genome (Table 3). B. cenocepacia produce the iron-chelating siderophores ornibactin, pyochelin, and SA in a strain-dependent manner (145). Ornibactin has been shown to be the most important of these in CF lung pathogenesis and consists of a mixture of modified tetrapeptides with three different side groups (128, 145). The ornibactin biosynthetic cluster is located on chromosome 1 (1), whereas the SA and pyochelin clusters are situated on chromosome 2 (111). The ability of J2315 to produce pyochelin is compromised since the pyochelin biosynthesis gene pchF (BCAM2230) contains a frameshift mutation. However, the genes encoding the transport and utilization of pyochelin in J2315 are intact and therefore probably functional.

Motility. Flagella have been shown to play an important role in the pathogenesis of B. cenocepacia, contributing to the invasion of lung epithelial cells (133) and modulating the immune response via the Toll-like receptor 5 (138). Five gene clusters on chromosome 1 together encode the components of a complete flagellum system (Table 3). Two duplicated components of this system are encoded on the other replicons: flagellar basal body protein FlgE2 (BCAM0987; paralog of BCAL0567) and flagellar hook-associated protein FliD2 (BCAS0104; paralog of BCAL0113). In P. aeruginosa two distinct flagellar hook-associated proteins have been identified (6) and shown to be antigenically distinct. In addition to being structural components of the flagella, flagellar cap proteins also bind mucin (7), an important initial event in the colonization of the CF lung. The additional copy of an antigenically distinct fliD therefore provides J2315 with variants, which it may use to evade the host immune system during the initial stage of infection.

Stress response. Intracellular survival of BCC bacteria within macrophages may contribute to bacterial persistence within the lung and airways of patients with CF and to sustained tissue inflammation (17, 87, 113). Resistance to oxidative stress is often associated with the ability of bacterial pathogens to survival within macrophages. Two of the most potent mechanisms utilized by activated macrophages to kill bacteria involve the production of reactive oxygen and reactive nitrogen oxide species. The detoxification of nitric oxide in Salmonella enterica serovar Typhimurium involves the flavohemoglobin HmpA (129), and the J2315 genome contains homologue of hmpA (Table 3). The detoxification of superoxide requires conversion of superoxide to hydrogen peroxide, encoded by sod genes, followed by destruction of the hydrogen peroxide by catalases, encoded by kat genes. The J2315 genome contains homologues of sodB (BCAL2757), sodC (BCAL2643), katA (BCAM2107), and katB (BCAL3299), as well as an additional catalase (BCAM0931) and a manganese-containing catalase (BCAS0635). There are also five NRAMP (natural resistance-associated macrophage protein; Table 3) family proteins in the genome. These divalent transition metal transporters are involved in iron metabolism and play a role in bacterial response to reactive oxygen species (59, 144).

Drug resistance. Strains of BCC exhibit high levels of antibiotic resistance, so much so that some BCC strains can use penicillin G as a sole carbon source (14). The drug resistances of strains infecting CF patients are often considered markers of mortality and in this way are considered virulence factors. In the BCC, resistance to multiple antibiotics is produced by multiple mechanisms that include alterations in cell permeability, the production of modifying or degradatory enzymes, and antibiotic target alteration. Other mechanisms of resistance may also be related to diminished antibiotic access (16), including drug efflux (150). J2315 is resistant to the aminoglycosides amikacin and tobramycin, the macrolide azithromycin, the β-lactams imipenem and piperacillin, and cotrimoxazole (trimethoprim-sulfamethoxazole). The strain also exhibits intermediate resistance to the fluoroquinolone ciprofloxacin.

Resistance to the β-lactam antibiotics appears to be caused by synergistic mechanisms, including the induction of chromosomal β-lactamases (109, 135) and decreased drug access (5, 104). There are at least four β-lactamases encoded in the J2315 genome, including: two class A, one class C, and one class D (Table 4). In addition, there are several β-lactamase family proteins containing β-lactamase Pfam domains (PF00144) that may have antimicrobial resistance functions.


View this table:
[in this window]
[in a new window]

 
TABLE 4. Potential drug resistance determinants in the genome of B. cenocepacia strain J2315

Efflux systems can modulate broad-spectrum antibiotic resistance, as well as resistance to specific antimicrobial compounds. Multiple transport systems belonging to six families associated with drug resistance were identified in the J2315 genome: MFS (major facilitator superfamily), ABC (ATP binding cassette) family, RND (resistance nodulation division) family, MATE (multidrug and toxic compound extrusion) family, SMR (small multidrug resistance) family, and fusaric acid resistance family proteins (Table 4). Some of these families have many members in the J2315 genome; however, it is unclear from in silico analysis alone whether or not they play a role in antibiotic resistance. For example, 16 CDSs were identified in the J2315 genome that encode efflux pumps belonging to the RND family. Two of these CDSs belong to systems that have been shown to be associated with drug resistance in B. cenocepacia: BCAM2550 (ceoB) is a component of a system that encodes chloramphenicol, trimethoprim, and ciprofloxacin resistance (19, 95), and BCAS0765 is associated with resistance to the antibiotics fluoroquinolones, tetraphenylphosphonium, and streptomycin, as well as to ethidium bromide (47). In addition, the genome contains orthologues of RND efflux proteins that have been shown to mediate resistance to antibiotics (2, 77, 78, 90, 94), metals (39, 66, 103), and other antimicrobial compounds (48) in other organisms.

Comparisons with other sequenced strains show that the J2315 genome contains strain-specific CDSs (Table 4) that may contribute to its elevated drug resistance, for example: a putative fusaric acid efflux system, RND family efflux systems, an aminoglycoside 3'-phosphotransferase, and a multiple antibiotic resistance protein.

Evolution of virulence in the ET12 lineage. Considering the pathogenic pedigree of J2315, it was surprising that several virulence determinants that have been shown to be important for B. cenocepacia pathogenicity were pseudogenes in J2315 (Table 5). In order to discover how widely distributed these mutations were we screened five of the virulence factor pseudogene loci in B. cenocepacia strains. Multilocus sequence typing was used to select strains as it proved additional resolution for distinguishing strains within, and related to, the ET12 lineage (Table 6) (9). Four strains belonging to the same sequence type (ST) as J2315 (ST28) were screened, along with two other closely related strains (BCC0016 and K56-2) that are single and double locus variants of ST28 (ST29 and ST30, respectively; http://pubmlst.org/bcc).


View this table:
[in this window]
[in a new window]

 
TABLE 5. Pseudogenes in the genome of B. cenocepacia J2315


View this table:
[in this window]
[in a new window]

 
TABLE 6. Distribution of virulence factor pseudogenes in B. cenocepacia IIIA strainsa

Screening of the virulence pseudogenes revealed the likely relative timescales of acquisition of these mutations. For example, pseudogenes that disrupt pyochelin biosynthesis and cepacian capsule functions were identified in all of the ET12 strains tested (Table 6), suggesting that they occurred in an ancestral strain, whereas the O-antigen cluster, T2SS, and uncharacterized EPS cluster pseudogenes were intermittently distributed, indicating that they are recent mutational events.

The observation of independent mutations in the ET12 strain K56-2 uncharacterized EPS CDS suggests ongoing selection for the loss of this potential virulence function in the CF lung. There is further evidence for pathoadaptation involving exopolysaccharide structures in the PHDC lineage of B. cenocepacia (i.e., strains AU1054 and HI2424). In the B. cenocepacia IIIB strains there are divergent clusters at orthologous loci for the LPS O antigen and EPS. In AU1054, both of these clusters are disrupted by IS element insertions, whereas the HI2424 clusters remain intact.

The modification of core functions via point mutation has also contributed to drug resistance in J2315. Trimethoprim interferes with the action of bacterial dihydrofolate reductase (DfrA), inhibiting synthesis of the essential tetrahydrofolic acid. Members of the ET12 lineage exhibit different sensitivities to trimethoprim (100). To investigate the evolution of trimethoprim resistance in the ET12 lineage, we sequenced dfrA from members of this clonal group that have different trimethoprim MICs (K56-2 and BCC0179, MIC < 2 mg/liter; J2315, BCC0016, and BC7, MIC > 32 mg/liter). J2315, BCC0016, and BC7 all contain a single nonsynonymous nucleotide substitution at codon 99 (CTC to ATC), resulting in a leucine-for-isoleucine substitution. In an experiment with E. coli mutator strains exposed to antibiotics, resistance to trimethoprim was shown to be the result of a single point mutation in DfrA, Ile94 to Leu, for which the equivalent residue in B. cenocepacia is exactly Ile99/Leu99 (89).


arrow
DISCUSSION
 
B. cenocepacia is a versatile environmental organism that has emerged as an important pathogen of CF patients. Using the J2315 genome we have been able to investigate the genomic basis for the success of this CF pathogen and examine the evolutionary mechanisms that may lead to its emergence and ongoing spread.

Comparative analysis of Burkholderia genomes reveals that horizontal gene transfer has contributed to the genomic plasticity of this versatile group of organisms. The exchange of MGEs and movement of genomic islands facilitates the spread of genes between genetically diverse bacteria, a process which could be advantageous to the bacterium in its existing environment or allow adaptation to new niches, such as the CF lung. The J2315 genome contains 14 genomic islands that are absent from the other B. cenocepacia strains. Some of the islands share similarity with islands in other Burkholderia spp., suggesting that the extent of the B. cenocepacia pan genome extends well beyond that of the species. The acquisition of genomic islands appears to have been seminal in the evolution of the ET12 lineage, introducing functions that promote survival and pathogenesis in the CF lung. One such island is the CCI (BcenGI11). This island plays a role in infection, is ubiquitous in the ET12 lineage, and is more common in B. cenocepacia IIIA strains than IIIB (10, 84). The contribution of the other genomic islands to the virulence and survival of J2315 in the CF lung remains to be resolved, since many of the functions encoded in the genomic islands are associated with enhancing the metabolic repertoire of the bacterium or are unknown.

Evidence of the pathogenic specialization of the ET12 lineage can be found in the other RODs. These regions do not appear to have the properties of MGEs and as such represent more stable components of the J2315 genome, albeit some may have arisen by horizontal gene transfer in the more distant past. Contained within this unique component of the J2315 genome are the cable pilus locus and the 22-kDa adhesion protein AdhA. These proteins bind cytokeratin 13 (116), a cytoplasmic protein that may become surface exposed during the course of chronic infection in CF (114), and also mucins (115), which are produced in abundance in the CF lung due to poor clearance. The cable pilus/AdhA complex is also associated with the ability of B. cenocepacia to bind to CF lung explant tissue (114) and bind and invade epithelial cells (117). Intriguingly, the CDSs encoding these components are at separate loci on chromosome 2, and orthologs are absent from the other BCC strains examined. This suggests that the pilus and the 22-kDa adhesin may have independent origins, but their concurrence in J2315 has resulted in functional synergy. Other virulence functions found within the J2315-specific RODs include surface polysaccharide biosynthesis, BuHA family putative adhesins, chaperone-usher type fimbriae, and a phospholipase C.

In recent years B. cenocepacia strains have acquired additional resistances to antibiotics commonly used in the treatment of CF patients. In particular, strains from within the ET12 lineage have different sensitivities to ciprofloxacin, tobramycin, tetracycline, and trimethoprim (100). In comparison to other members of the ET12 lineage, J2315 has developed enhanced resistance to a number of antibiotics (100). Indeed, we found that the J2315 genome contains drug resistance in genomic islands and RODs, highlighting the role that horizontal gene transfer has played in the evolution of drug resistance in even the most intrinsically resistant of organisms. The genome also provides evidence for the evolution of drug resistance through point mutation, elucidating a nonsynonymous base change in the dihydrofolate reductase gene that generates trimethoprim resistance.

Although the success of J2315 may be in part due to the acquisition of new functions, gene loss via mutation appears to have also played an important role. J2315 is a formidable pathogen of the CF lung; once infected with ET12, the life expectancy of a patient shortens dramatically (57). It is therefore surprising that the J2315 genome contains pseudogenes, formed via both IS disruption and frameshift mutations, in important B. cenocepacia virulence functions, such as O antigen and capsule (Table 6). Many of the putative virulence determinants identified in J2315 are shared with other BCC strains. These functions may therefore have important roles for the survival of BCC in its natural reservoir rather than in an opportunistic pathogen niche. In the case of J2315, the emergence and patient-to-patient spread of ET12 may mean that many of the functions required for survival in the environment are no longer required and have become superfluous or even disadvantageous. The level of pseudogenes and partial genes in the J2315 genome (1.7% of CDSs) is similar to the level found in most other bacterial genomes (72), suggesting that there is not an elevated level of mutation in this strain.

The screening of the virulence pseudogenes in other ET12 strains showed that some of the J2315 mutations may have occurred early on in the evolution of the ET12 lineage, whereas others represent recent strain-specific mutations. Some of these mutations may therefore represent formative pathoadaptive mutations that contributed to the initial success and emergence of the ET12 lineage, whereas others may be indicative of the ongoing selection pressures in the CF lung.

All of the ET12 strains that we screened contained the same frameshift mutation in the pyochelin siderophore biosynthesis gene pchF. Interestingly, the siderophores produced by CF isolates of B. cenocepacia exhibit strain variation, with SA and ornibactins being the most prevalent, followed by pyochelin (32). In a study that investigated pyochelin production in CF patients from Toronto and Cleveland (125), pyochelin-negative strains were isolated from patients with moderate or mild infections, whereas pyochelin-positive strains were more frequently isolated from patients with severe pulmonary disease going on to suffer high mortality. It is possible that pyochelin production may play an important role in the progress of B. cenocepacia disease in CF patients. Switching off expression of the pyochelin production in ET12 strains may promote persistence in the CF lung and thus the spread of the members of this lineage between patients.

The long-term maintenance of infection in the CF lung may result in the streamlining of a pathogen's virulence and drug resistance functions, since functions required for the initiation of acute infections may be selected against during chronic infections. Evidence for recent pathoadaptive mutations came from the observation of an independent mutation in a glycosyltransferase of an uncharacterized EPS cluster, in K56-2, another member of the ET12 lineage. Further evidence for pathoadaptation involving surface carbohydrates came from the in silico comparison of the B. cenocepacia strains; in the CF epidemic strain there are mutations in the LPS O-antigen cluster and an EPS cluster, whereas the related environmental strain's clusters remain intact. A reduction in glycosylated surface molecules may provide some advantage, such as reducing immunorecognition in the lung, thus promoting the maintenance of a long-term infection. In a study of the EPS production in a collection of 506 B. cenocepacia strains isolated from CF patients in the Vancouver area over a 26-year period, more than half were nonmucoid (151). The study also revealed evidence of phenotype switching in sequential isolates from individual patients, with the conversion from mucoid to nonmucoid being the most prevalent switch. The authors hypothesized that the loss of EPS may reflect adaptation from persistence in the CF lung to increased disease severity.

Evidence for pathoadaptation can also be found in P. aeruginosa, the major pathogen of the CF lung, where the loss of acute virulence determinants has been observed in CF isolates, suggesting that these products are dispensable for long-term maintenance of P. aeruginosa in vivo (76, 147). A recent study by Smith et al. investigated genetic adaptation of P. aeruginosa in CF infections (123). Genomic sequencing of strains isolated from a CF patient 8 years apart, as well as additional chronic infections, identified that virulence factors genes were the most prevalent class of genes mutated during the course of infections. Significantly one of the P. aeruginosa virulence functions that acquired deleterious mutations was the O antigen (123), a function also lost in J2315 (101). One additional virulence mutational adaptation is also shared: mexZ, a negative regulator of the mexXY component of the MexXY-OprM multidrug-efflux pump, is orthologous to a J2315 pseudogene (BCAL1672). In P. aeruginosa, upregulation of this multidrug-efflux pump is associated with resistance to aminoglycoside antibiotics that are routinely used to treat infection in CF patients (124).

Although there are parallels in the potential pathoadaptations of P. aeruginosa and B. cenocepacia, there are also intriguing differences. The high frequency of nonmucoid B. cenocepacia isolated from CF patients (151) is in marked contrast to P. aeruginosa, where isolates from CF patients are more frequently mucoid than nonmucoid (45). In P. aeruginosa the production of the EPS alginate is linked to increased morbidity and mortality (45), whereas strains of B. cenocepacia that are considered to be more virulent, such as those in the ET12 lineage, have been shown not produce EPS (11, 151). These somewhat paradoxical observations point toward subtle differences in the role that the different EPS plays in the mechanism of pathogenicity and host-cell interaction in these two CF pathogens.

The genome sequence of J2315 has afforded a tantalizing glimpse of components of the genome that may promote growth in the CF lung and provided clues to the potency and spread of ET12 in recent decades. Evidence from comparative genomics suggests that loss of functions through mutation and gain of functions via horizontal gene transfer appear to promote growth and persistence in the CF lung and contribute to the success of J2315. Much remains to be learned, however, as the pathology of B. cenocepacia infections and the physiology of the CF lung are both complex. The complete genome sequence will therefore be a valuable resource for future investigation into disease caused by B. cenocepacia.


arrow
ACKNOWLEDGMENTS
 
We thank the Sanger Institute's Pathogen Production Group for shotgun and finishing sequencing and the Informatics Group. We are grateful to the Joint Genome Institute for making the HI2424 and AU1054 sequences available before scientific publication and to Tom Coeyne, Dominic Campopiano, and Alan Brown for useful comments regarding the manuscript. M.T.G.H. thanks Alan Smyth for useful discussions.

This study was supported by the Wellcome Trust through its Beowulf Genomics initiative.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge CB10 1SA, United Kingdom. Phone: 44 (0)1223 494975. Fax: 44 (0)1223 494919. E-mail: mh3{at}sanger.ac.uk Back

{triangledown} Published ahead of print on 17 October 2008. Back

{dagger} Supplemental material for this article may be found at http://jb.asm.org/. Back

{ddagger} Present address: School of Biological Sciences, University of Liverpool, Liverpool L69 7ZB, United Kingdom. Back


arrow
REFERENCES
 
    1
  1. Agnoli, K., C. A. Lowe, K. L. Farmer, S. I. Husnain, and M. S. Thomas. 2006. The ornibactin biosynthesis and transport genes of Burkholderia cenocepacia are regulated by an extracytoplasmic function sigma factor which is a part of the Fur regulon. J. Bacteriol. 188:3631-3644.[Abstract/Free Full Text]
  2. 2
  3. Aires, J. R., T. Kohler, H. Nikaido, and P. Plesiat. 1999. Involvement of an active efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob. Agents Chemother. 43:2624-2628.[Abstract/Free Full Text]
  4. 3
  5. Allard, J. D., and K. P. Bertrand. 1992. Membrane topology of the pBR322 tetracycline resistance protein: TetA-PhoA gene fusions and implications for the mechanism of TetA membrane insertion. J. Biol. Chem. 267:17809-17819.[Abstract/Free Full Text]
  6. 4
  7. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
  8. 5
  9. Aronoff, S. C. 1988. Outer membrane permeability in Pseudomonas cepacia: diminished porin content in a β-lactam resistant mutant and in resistant cystic fibrosis isolates. Antimicrob. Agents Chemother. 32:1636-1639.[Abstract/Free Full Text]
  10. 6
  11. Arora, S. K., N. Dasgupta, S. Lory, and R. Ramphal. 2000. Identification of two distinct types of flagellar cap proteins, FliD, in Pseudomonas aeruginosa. Infect. Immun. 68:1474-1479.[Abstract/Free Full Text]
  12. 7
  13. Arora, S. K., B. W. Ritchings, E. C. Almira, S. Lory, and R. Ramphal. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect. Immun. 66:1000-1007.[Abstract/Free Full Text]
  14. 8
  15. Baldwin, A., E. Mahenthiralingam, P. Drevinek, P. Vandamme, J. R. Govan, D. J. Waine, J. J. LiPuma, L. Chiarini, C. Dalmastri, D. A. Henry, D. P. Speert, D. Honeybourne, M. C. Maiden, and C. G. Dowson. 2007. Environmental Burkholderia cepacia complex isolates in human infections. Emerg. Infect. Dis. 13:458-461.[Medline]
  16. 9
  17. Baldwin, A., E. Mahenthiralingam, K. M. Thickett, D. Honeybourne, M. C. Maiden, J. R. Govan, D. P. Speert, J. J. Lipuma, P. Vandamme, and C. G. Dowson. 2005. Multilocus sequence typing scheme that provides both species and strain differentiation for the Burkholderia cepacia complex. J. Clin. Microbiol. 43:4665-4673.[Abstract/Free Full Text]
  18. 10
  19. Baldwin, A., P. A. Sokol, J. Parkhill, and E. Mahenthiralingam. 2004. The Burkholderia cepacia epidemic strain marker is part of a novel genomic island encoding both virulence and metabolism-associated genes in Burkholderia cenocepacia. Infect. Immun. 72:1537-1547.[Abstract/Free Full Text]
  20. 11
  21. Bartholdson, S. J., A. R. Brown, B. R. Mewburn, D. J. Clarke, S. C. Fry, D. J. Campopiano, and J. R. Govan. 2008. Plant host and sugar alcohol induced exopolysaccharide biosynthesis in the Burkholderia cepacia complex. Microbiology 154:2513-2521.[Abstract/Free Full Text]
  22. 12
  23. Bateman, A., E. Birney, L. Cerruti, R. Durbin, L. Etwiller, S. R. Eddy, S. Griffiths-Jones, K. L. Howe, M. Marshall, and E. L. L. Sonnhammer. 2002. The Pfam protein families database. Nucleic Acids Res. 30:276-280.[Abstract/Free Full Text]
  24. 13
  25. Beck, E., G. Ludwig, E. A. Auerswald, B. Reiss, and H. Schaller. 1982. Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from transposon Tn5. Gene 19:327-336.[CrossRef][Medline]
  26. 14
  27. Beckman, W., and T. G. Lessie. 1979. Response of Pseudomonas cepacia to β-lactam antibiotics: utilization of penicillin G as the carbon source. J. Bacteriol. 140:1126-1128.[Abstract/Free Full Text]
  28. 15
  29. Boddey, J. A., C. P. Flegg, C. J. Day, I. R. Beacham, and I. R. Peak. 2006. Temperature-regulated microcolony formation by Burkholderia pseudomallei requires pilA and enhances association with cultured human cells. Infect. Immun. 74:5374-5381.[Abstract/Free Full Text]
  30. 16
  31. Burns, J. L., L. A. Hedin, and D. M. Lien. 1989. Chloramphenicol resistance in Pseudomonas cepacia because of decreased permeability. Antimicrob. Agents Chemother. 33:136-141.[Abstract/Free Full Text]
  32. 17
  33. Burns, J. L., M. Jonas, E. Y. Chi, D. K. Clark, A. Berger, and A. Griffith. 1996. Invasion of respiratory epithelial cells by Burkholderia (Pseudomonas) cepacia. Infect. Immun. 64:4054-4059.[Abstract]
  34. 18
  35. Burns, J. L., D. M. Lien, and L. A. Hedin. 1989. Isolation and characterization of dihydrofolate reductase from trimethoprim-susceptible and trimethoprim-resistant Pseudomonas cepacia. Antimicrob. Agents Chemother. 33:1247-1251.[Abstract/Free Full Text]
  36. 19
  37. Burns, J. L., C. D. Wadsworth, J. J. Barry, and C. P. Goodall. 1996. Nucleotide sequence analysis of a gene from Burkholderia (Pseudomonas) cepacia encoding an outer membrane lipoprotein involved in multiple antibiotic resistance. Antimicrob. Agents Chemother. 40:307-313.[Abstract]
  38. 20
  39. Burrows, L. L. 2005. Weapons of mass retraction. Mol. Microbiol. 57:878-888.[CrossRef][Medline]
  40. 21
  41. Burrus, V., G. Pavlovic, B. Decaris, and G. Guedon. 2002. The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid 48:77-97.[CrossRef][Medline]
  42. 22
  43. Carver, T. J., K. Rutherford, M. Berriman, M. A. Rajandream, B. Barrell, and J. Parkhill. 2005. ACT: the Artemis comparison tool. Bioinformatics 21:3422-3423.[Abstract/Free Full Text]
  44. 23
  45. Chain, P. S., V. J. Denef, K. T. Konstantinidis, L. M. Vergez, L. Agullo, V. L. Reyes, L. Hauser, M. Cordova, L. Gomez, M. Gonzalez, M. Land, V. Lao, F. Larimer, J. J. Lipuma, E. Mahenthiralingam, S. A. Malfatti, C. J. Marx, J. J. Parnell, A. Ramette, P. Richardson, M. Seeger, D. Smith, T. Spilker, W. J. Sul, T. V. Tsoi, L. E. Ulrich, I. B. Zhulin, and J. M. Tiedje. 2006. Inaugural article: Burkholderia xenovorans LB400 harbors a multi-replicon, 9.73-Mbp genome shaped for versatility. Proc. Natl. Acad. Sci. USA 103:15280-15287.[Abstract/Free Full Text]
  46. 24
  47. Chan, Y. Y., T. M. Tan, Y. M. Ong, and K. L. Chua. 2004. BpeAB-OprB, a multidrug efflux pump in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 48:1128-1135.[Abstract/Free Full Text]
  48. 25
  49. Chen, J. S., K. A. Witzmann, T. Spilker, R. J. Fink, and J. J. LiPuma. 2001. Endemicity and inter-city spread of Burkholderia cepacia genomovar III in cystic fibrosis. J. Pediatr. 139:643-649.[CrossRef][Medline]
  50. 26
  51. Coenye, T., E. Mahenthiralingam, D. Henry, J. J. LiPuma, S. Laevens, M. Gillis, D. P. Speert, and P. Vandamme. 2001. Burkholderia ambifaria sp. nov., a novel member of the Burkholderia cepacia complex including biocontrol and cystic fibrosis-related isolates. Int. J. Syst. Evol. Microbiol. 51:1481-1490.[Abstract]
  52. 27
  53. Coenye, T., T. Spilker, A. Van Schoor, J. J. LiPuma, and P. Vandamme. 2004. Recovery of Burkholderia cenocepacia strain PHDC from cystic fibrosis patients in Europe. Thorax 59:952-954.[Abstract/Free Full Text]
  54. 28
  55. Cohen, S. P., H. Hachler, and S. B. Levy. 1993. Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli. J. Bacteriol. 175:1484-1492.[Abstract/Free Full Text]
  56. 29
  57. Corbett, C. R., M. N. Burtnick, C. Kooi, D. E. Woods, and P. A. Sokol. 2003. An extracellular zinc metalloprotease gene of Burkholderia cepacia. Microbiology 149:2263-2271.[Abstract/Free Full Text]
  58. 30
  59. Cox, A. D., and S. G. Wilkinson. 1991. Ionizing groups in lipopolysaccharides of Pseudomonas cepacia in relation to antibiotic resistance. Mol. Microbiol. 5:641-646.[CrossRef][Medline]
  60. 31
  61. Dalmastri, C., A. Baldwin, S. Tabacchioni, A. Bevivino, E. Mahenthiralingam, L. Chiarini, and C. Dowson. 2007. Investigating Burkholderia cepacia complex populations recovered from Italian maize rhizosphere by multilocus sequence typing. Environ. Microbiol. 9:1632-1639.[CrossRef][Medline]
  62. 32
  63. Darling, P., M. Chan, A. D. Cox, and P. A. Sokol. 1998. Siderophore production by cystic fibrosis isolates of Burkholderia cepacia. Infect. Immun. 66:874-877.[Abstract/Free Full Text]
  64. 33
  65. Das, S., and K. Chaudhuri. 2003. Identification of a unique IAHP (IcmF-associated homologous proteins) cluster in Vibrio cholerae and other proteobacteria through in silico analysis. In Silico Biol. 3:287-300.[Medline]
  66. 34
  67. Delcher, A. L., D. Harmon, S. Kasif, O. White, and S. L. Salzberg. 1999. Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 27:4636-4641.[Abstract/Free Full Text]
  68. 35
  69. Engledow, A. S., E. G. Medrano, E. Mahenthiralingam, J. J. LiPuma, and C. F. Gonzalez. 2004. Involvement of a plasmid-encoded type IV secretion system in the plant tissue watersoaking phenotype of Burkholderia cenocepacia. J. Bacteriol. 186:6015-6024.[Abstract/Free Full Text]
  70. 36
  71. Essex-Lopresti, A. E., J. A. Boddey, R. Thomas, M. P. Smith, M. G. Hartley, T. Atkins, N. F. Brown, C. H. Tsang, I. R. Peak, J. Hill, I. R. Beacham, and R. W. Titball. 2005. A type IV pilin, PilA, Contributes To Adherence of Burkholderia pseudomallei and virulence in vivo. Infect. Immun. 73:1260-1264.[Abstract/Free Full Text]
  72. 37
  73. Falquet, L., M. Pagni, P. Bucher, N. Hulo, C. J. A. Sigrist, K. Hofmann, and A. Bairoch. 2002. The PROSITE database, its status in 2002. Nucleic Acids Res. 30:235-238.[Abstract/Free Full Text]
  74. 38
  75. Fehlner-Gardiner, C. C., and M. A. Valvano. 2002. Cloning and characterization of the Burkholderia vietnamiensis norM gene encoding a multi-drug efflux protein. FEMS Microbiol. Lett. 215:279-283.[CrossRef][Medline]
  76. 39
  77. Franke, S., G. Grass, and D. H. Nies. 2001. The product of the ybdE gene of the Escherichia coli chromosome is involved in detoxification of silver ions. Microbiology 147:965-972.[Abstract/Free Full Text]
  78. 40
  79. Frishman, D., A. Mironov, H. W. Mewes, and M. Gelfand. 1998. Combining diverse evidence for gene recognition in completely sequenced bacterial genomes. Nucleic Acids Res. 26:2941-2947.[Abstract/Free Full Text]
  80. 41
  81. Fujisaki, S., S. Ohnuma, T. Horiuchi, I. Takahashi, S. Tsukui, Y. Nishimura, T. Nishino, M. Kitabatake, and H. Inokuchi. 1996. Cloning of a gene from Escherichia coli that confers resistance to fosmidomycin as a consequence of amplification. Gene 175:83-87.[CrossRef][Medline]
  82. 42
  83. Goldstein, R., L. Sun, R. Z. Jiang, U. Sajjan, J. F. Forstner, and C. Campanelli. 1995. Structurally variant classes of pilus appendage fibers coexpressed from Burkholderia (Pseudomonas) cepacia. J. Bacteriol. 177:1039-1052.[Abstract/Free Full Text]
  84. 43
  85. Gonzalez, E. T., and C. Allen. 2003. Characterization of a Ralstonia solanacearum operon required for polygalacturonate degradation and uptake of galacturonic acid. Mol. Plant-Microbe Interact. 16:536-544.[Medline]
  86. 44
  87. Govan, J. R., P. H. Brown, J. Maddison, C. J. Doherty, J. W. Nelson, M. Dodd, A. P. Greening, and A. K. Webb. 1993. Evidence for transmission of Pseudomonas cepacia by social contact in cystic fibrosis. Lancet 342:15-19.[CrossRef][Medline]
  88. 45
  89. Govan, J. R., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev. 60:539-574.[Abstract/Free Full Text]
  90. 46
  91. Griffiths-Jones, S., A. Bateman, M. Marshall, A. Khanna, and S. R. Eddy. 2003. Rfam: an RNA family database. Nucleic Acids Res. 31:439-441.[Abstract/Free Full Text]
  92. 47
  93. Guglierame, P., M. R. Pasca, E. De Rossi, S. Buroni, P. Arrigo, G. Manina, and G. Riccardi. 2006. Efflux pump genes of the resistance-nodulation-division family in Burkholderia cenocepacia genome. BMC Microbiol. 6:66.[CrossRef][Medline]
  94. 48
  95. Hansen, L. H., E. Johannesen, M. Burmolle, A. H. Sorensen, and S. J. Sorensen. 2004. Plasmid-encoded multidrug efflux pump conferring resistance to olaquindox in Escherichia coli. Antimicrob. Agents Chemother. 48:3332-3337.[Abstract/Free Full Text]
  96. 49
  97. Herasimenka, Y., P. Cescutti, G. Impallomeni, S. Campana, G. Taccetti, N. Ravenni, F. Zanetti, and R. Rizzo. 2007. Exopolysaccharides produced by clinical strains belonging to the Burkholderia cepacia complex. J. Cyst. Fibros. 6:145-152.[CrossRef][Medline]
  98. 50
  99. Herlache, T. C., A. T. Hotchkiss, Jr., T. J. Burr, and A. Collmer. 1997. Characterization of the Agrobacterium vitis pehA gene and comparison of the encoded polygalacturonase with the homologous enzymes from Erwinia carotovora and Ralstonia solanacearum. Appl. Environ. Microbiol. 63:338-346.[Abstract]
  100. 51
  101. Holden, M. T., R. W. Titball, S. J. Peacock, A. M. Cerdeno-Tarraga, T. Atkins, L. C. Crossman, T. Pitt, C. Churcher, K. Mungall, S. D. Bentley, M. Sebaihia, N. R. Thomson, N. Bason, I. R. Beacham, K. Brooks, K. A. Brown, N. F. Brown, G. L. Challis, I. Cherevach, T. Chillingworth, A. Cronin, B. Crossett, P. Davis, D. DeShazer, T. Feltwell, A. Fraser, Z. Hance, H. Hauser, S. Holroyd, K. Jagels, K. E. Keith, M. Maddison, S. Moule, C. Price, M. A. Quail, E. Rabbinowitsch, K. Rutherford, M. Sanders, M. Simmonds, S. Songsivilai, K. Stevens, S. Tumapa, M. Vesaratchavest, S. Whitehead, C. Yeats, B. G. Barrell, P. C. Oyston, and J. Parkhill. 2004. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Proc. Natl. Acad. Sci. USA 101:14240-14245.[Abstract/Free Full Text]
  102. 52
  103. Hollingshead, S., and D. Vapnek. 1985. Nucleotide sequence analysis of a gene encoding a streptomycin/spectinomycin adenylyltransferase. Plasmid 13:17-30.[CrossRef][Medline]
  104. 53
  105. Irvin, R. T., P. Doig, K. K. Lee, P. A. Sastry, W. Paranchych, T. Todd, and R. S. Hodges. 1989. Characterization of the Pseudomonas aeruginosa pilus adhesin: confirmation that the pilin structural protein subunit contains a human epithelial cell-binding domain. Infect. Immun. 57:3720-3726.[Abstract/Free Full Text]
  106. 54
  107. Isles, A., I. Maclusky, M. Corey, R. Gold, C. Prober, P. Fleming, and H. Levison. 1984. Pseudomonas cepacia infection in cystic fibrosis: an emerging problem. J. Pediatr. 104:206-210.[Medline]
  108. 55
  109. Jendrossek, V., S. Fillon, C. Belka, I. Muller, B. Puttkammer, and F. Lang. 2003. Apoptotic response of Chang cells to infection with Pseudomonas aeruginosa strains PAK and PAO-I: molecular ordering of the apoptosis signaling cascade and role of type IV pili. Infect. Immun. 71:2665-2673.[Abstract/Free Full Text]
  110. 56
  111. Johnson, W. M., S. D. Tyler, and K. R. Rozee. 1994. Linkage analysis of geographic and clinical clusters in Pseudomonas cepacia infections by multilocus enzyme electrophoresis and ribotyping. J. Clin. Microbiol. 32:924-930.[Abstract/Free Full Text]
  112. 57
  113. Jones, A. M., M. E. Dodd, J. R. Govan, V. Barcus, C. J. Doherty, J. Morris, and A. K. Webb. 2004. Burkholderia cenocepacia and Burkholderia multivorans: influence on survival in cystic fibrosis. Thorax 59:948-951.[Abstract/Free Full Text]
  114. 58
  115. Kachlany, S. C., P. J. Planet, R. DeSalle, D. H. Fine, D. H. Figurski, and J. B. Kaplan. 2001. flp-1, the first representative of a new pilin gene subfamily, is required for nonspecific adherence of Actinobacillus actinomycetemcomitans. Mol. Microbiol. 40:542-554.[CrossRef][Medline]
  116. 59
  117. Kehres, D. G., M. L. Zaharik, B. B. Finlay, and M. E. Maguire. 2000. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol. Microbiol. 36:1085-1100.[CrossRef][Medline]
  118. 60
  119. Klemm, P. 1984. The fimA gene encoding the type-1 fimbrial subunit of Escherichia coli: nucleotide sequence and primary structure of the protein. Eur. J. Biochem. 143:395-399.[Medline]
  120. 61
  121. Kobayashi, N., K. Nishino, and A. Yamaguchi. 2001. Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J. Bacteriol. 183:5639-5644.[Abstract/Free Full Text]
  122. 62
  123. Kooi, C., C. R. Corbett, and P. A. Sokol. 2005. Functional analysis of the Burkholderia cenocepacia ZmpA metalloprotease. J. Bacteriol. 187:4421-4429.[Abstract/Free Full Text]
  124. 63
  125. Kooi, C., B. Subsin, R. Chen, B. Pohorelic, and P. A. Sokol. 2006. Burkholderia cenocepacia ZmpB is a broad-specificity zinc metalloprotease involved in virulence. Infect. Immun. 74:4083-4093.[Abstract/Free Full Text]
  126. 64
  127. Korbsrisate, S., A. P. Tomaras, S. Damnin, J. Ckumdee, V. Srinon, I. Lengwehasatit, M. L. Vasil, and S. Suparak. 2007. Characterization of two distinct phospholipase C enzymes from Burkholderia pseudomallei. Microbiology 153:1907-1915.[Abstract/Free Full Text]
  128. 65
  129. Krogh, A., B. Larsson, G. von Heijne, and E. L. L. Sonnhammer. 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305:567-580.[CrossRef][Medline]
  130. 66
  131. Kunito, T., T. Kusano, H. Oyaizu, K. Senoo, S. Kanazawa, and S. Matsumoto. 1996. Cloning and sequence analysis of czc genes in Alcaligenes sp. strain CT14. Biosci. Biotechnol. Biochem. 60:699-704.
  132. 67
  133. Lamothe, J., K. K. Huynh, S. Grinstein, and M. A. Valvano. 2007. Intracellular survival of Burkholderia cenocepacia in macrophages is associated with a delay in the maturation of bacteria-containing vacuoles. Cell Microbiol. 9:40-53.[CrossRef][Medline]
  134. 68
  135. Lanotte, P., L. Mereghetti, B. Lejeune, P. Massicot, and R. Quentin. 2003. Pseudomonas aeruginosa and cystic fibrosis: correlation between exoenzyme production and patient's clinical state. Pediatr. Pulmonol. 36:405-412.[CrossRef][Medline]
  136. 69
  137. Larsen, T. S., and A. Krogh. 2003. EasyGene: a prokaryotic gene finder that ranks ORFs by statistical significance. BMC Bioinform. 4:21.[Medline]
  138. 70
  139. LiPuma, J. J., T. Spilker, T. Coenye, and C. F. Gonzalez. 2002. An epidemic Burkholderia cepacia complex strain identified in soil. Lancet 359:2002-2003.[CrossRef][Medline]
  140. 71
  141. Liu, L., T. Spilker, T. Coenye, and J. J. LiPuma. 2003. Identification by subtractive hybridization of a novel insertion element specific for two widespread Burkholderia cepacia genomovar III strains. J. Clin. Microbiol. 41:2471-2476.[Abstract/Free Full Text]
  142. 72
  143. Liu, Y., P. M. Harrison, V. Kunin, and M. Gerstein. 2004. Comprehensive analysis of pseudogenes in prokaryotes: widespread gene decay and failure of putative horizontally transferred genes. Genome Biol. 5:R64.[CrossRef][Medline]
  144. 73
  145. Lomovskaya, O., and K. Lewis. 1992. Emr, an Escherichia coli locus for multidrug resistance. Proc. Natl. Acad. Sci. USA 89:8938-8942.[Abstract/Free Full Text]
  146. 74
  147. Loutet, S. A., R. S. Flannagan, C. Kooi, P. A. Sokol, and M. A. Valvano. 2006. A complete lipopolysaccharide inner core oligosaccharide is required for resistance of Burkholderia cenocepacia to antimicrobial peptides and bacterial survival in vivo. J. Bacteriol. 188:2073-2080.[Abstract/Free Full Text]
  148. 75
  149. Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964.[Abstract/Free Full Text]
  150. 76
  151. Luzar, M. A., and T. C. Montie. 1985. Avirulence and altered physiological properties of cystic fibrosis strains of Pseudomonas aeruginosa. Infect. Immun. 50:572-576.[Abstract/Free Full Text]
  152. 77
  153. Ma, D., D. N. Cook, M. Alberti, N. G. Pon, H. Nikaido, and J. E. Hearst. 1993. Molecular cloning and characterization of acrA and acrE genes of Escherichia coli. J. Bacteriol. 175:6299-6313.[Abstract/Free Full Text]
  154. 78
  155. Magnet, S., P. Courvalin, and T. Lambert. 2001. Resistance-nodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob. Agents Chemother. 45:3375-3380.[Abstract/Free Full Text]
  156. 79
  157. Mahenthiralingam, E., A. Baldwin, and C. G. Dowson. 2008. Burkholderia cepacia complex bacteria: opportunistic pathogens with important natural biology. J. Appl. Microbiol. 104:1539-1551.
  158. 80
  159. Mahenthiralingam, E., M. E. Campbell, D. A. Henry, and D. P. Speert. 1996. Epidemiology of Burkholderia cepacia infection in patients with cystic fibrosis: analysis by randomly amplified polymorphic DNA fingerprinting. J. Clin. Microbiol. 34:2914-2920.[Abstract]
  160. 81
  161. Mahenthiralingam, E., T. Coenye, J. W. Chung, D. P. Speert, J. R. Govan, P. Taylor, and P. Vandamme. 2000. Diagnostically and experimentally useful panel of strains from the Burkholderia cepacia complex. J. Clin. Microbiol. 38:910-913.[Abstract/Free Full Text]
  162. 82
  163. Mahenthiralingam, E., D. A. Simpson, and D. P. Speert. 1997. Identification and characterization of a novel DNA marker associated with epidemic Burkholderia cepacia strains recovered from patients with cystic fibrosis. J. Clin. Microbiol. 35:808-816.[Abstract]
  164. 83
  165. Mahenthiralingam, E., T. A. Urban, and J. B. Goldberg. 2005. The multifarious, multireplicon Burkholderia cepacia complex. Nat. Rev. Microbiol. 3:144-156.[CrossRef][Medline]
  166. 84
  167. Mahenthiralingam, E., P. Vandamme, M. E. Campbell, D. A. Henry, A. M. Gravelle, L. T. Wong, A. G. Davidson, P. G. Wilcox, B. Nakielna, and D. P. Speert. 2001. Infection with Burkholderia cepacia complex genomovars in patients with cystic fibrosis: virulent transmissible strains of genomovar III can replace Burkholderia multivorans. Clin. Infect. Dis. 33:1469-1475.[CrossRef][Medline]
  168. 85
  169. Mammeri, H., L. Poirel, P. Bemer, H. Drugeon, and P. Nordmann. 2004. Resistance to cefepime and cefpirome due to a 4-amino-acid deletion in the chromosome-encoded AmpC beta-lactamase of a Serratia marcescens clinical isolate. Antimicrob. Agents Chemother. 48:716-720.[Abstract/Free Full Text]
  170. 86
  171. Markey, K. M., K. J. Glendinning, J. A. Morgan, C. A. Hart, and C. Winstanley. 2006. Caenorhabditis elegans killing assay as an infection model to study the role of type III secretion in Burkholderia cenocepacia. J. Med. Microbiol. 55:967-969.[Free Full Text]
  172. 87
  173. Martin, D. W., and C. D. Mohr. 2000. Invasion and intracellular survival of Burkholderia cepacia. Infect. Immun. 68:24-29.[Abstract/Free Full Text]
  174. 88
  175. Mazodier, P., P. Cossart, E. Giraud, and F. Gasser. 1985. Completion of the nucleotide sequence of the central region of Tn5 confirms the presence of three resistance genes. Nucleic Acids Res. 13:195-205.[Abstract/Free Full Text]
  176. 89
  177. Miller, K., A. J. O'Neill, and I. Chopra. 2004. Escherichia coli mutators present an enhanced risk for emergence of antibiotic resistance during urinary tract infections. Antimicrob. Agents Chemother. 48:23-29.[Abstract/Free Full Text]
  178. 90
  179. Moore, R. A., D. DeShazer, S. Reckseidler, A. Weissman, and D. E. Woods. 1999. Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 43:465-470.[Abstract/Free Full Text]
  180. 91
  181. Moore, R. A., and R. E. W. Hancock. 1986. Involvement of outer membrane of Pseudomonas cepacia in aminoglycoside and polymyxin resistance. Antimicrob. Agents Chemother. 30:923-926.[Abstract/Free Full Text]
  182. 92
  183. Moreira, L. M., P. A. Videira, S. A. Sousa, J. H. Leitao, M. V. Cunha, and I. Sa-Correia. 2003. Identification and physical organization of the gene cluster involved in the biosynthesis of Burkholderia cepacia complex exopolysaccharide. Biochem. Biophys. Res. Commun. 312:323-333.[CrossRef][Medline]
  184. 93
  185. Mougous, J. D., M. E. Cuff, S. Raunser, A. Shen, M. Zhou, C. A. Gifford, A. L. Goodman, G. Joachimiak, C. L. Ordonez, S. Lory, T. Walz, A. Joachimiak, and J. J. Mekalanos. 2006. A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science 312:1526-1530.[Abstract/Free Full Text]
  186. 94
  187. Nagakubo, S., K. Nishino, T. Hirata, and A. Yamaguchi. 2002. The putative response regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug exporter system, MdtABC. J. Bacteriol. 184:4161-4167.[Abstract/Free Full Text]
  188. 95
  189. Nair, B. M., K. J. Cheung, Jr., A. Griffith, and J. L. Burns. 2004. Salicylate induces an antibiotic efflux pump in Burkholderia cepacia complex genomovar III (B. cenocepacia). J. Clin. Investig. 113:464-473.[CrossRef][Medline]
  190. 96
  191. Navas, J., J. Leon, M. Arroyo, and J. M. Garcia Lobo. 1990. Nucleotide sequence and intracellular location of the product of the fosfomycin resistance gene from transposon Tn2921. Antimicrob. Agents Chemother. 34:2016-2018.[Abstract/Free Full Text]
  192. 97
  193. Nelson, M. J., S. O. Montgomery, W. R. Mahaffey, and P. H. Pritchard. 1987. Biodegradation of trichloroethylene and involvement of an aromatic biodegradative pathway. Appl. Environ. Microbiol. 53:949-954.[Abstract/Free Full Text]
  194. 98
  195. Nielsen, H., J. Engelbrecht, S. Brunak, and G. vonHeijne. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10:1-6.[Abstract/Free Full Text]
  196. 99
  197. Nierman, W. C., D. DeShazer, H. S. Kim, H. Tettelin, K. E. Nelson, T. Feldblyum, R. L. Ulrich, C. M. Ronning, L. M. Brinkac, S. C. Daugherty, T. D. Davidsen, R. T. Deboy, G. Dimitrov, R. J. Dodson, A. S. Durkin, M. L. Gwinn, D. H. Haft, H. Khouri, J. F. Kolonay, R. Madupu, Y. Mohammoud, W. C. Nelson, D. Radune, C. M. Romero, S. Sarria, J. Selengut, C. Shamblin, S. A. Sullivan, O. White, Y. Yu, N. Zafar, L. Zhou, and C. M. Fraser. 2004. Structural flexibility in the Burkholderia mallei genome. Proc. Natl. Acad. Sci. USA 101:14246-14251.[Abstract/Free Full Text]
  198. 100
  199. Nzula, S., P. Vandamme, and J. R. Govan. 2002. Influence of taxonomic status on the in vitro antimicrobial susceptibility of the Burkholderia cepacia complex. J. Antimicrob. Chemother. 50:265-269.[Abstract/Free Full Text]
  200. 101
  201. Ortega, X., T. A. Hunt, S. Loutet, A. D. Vinion-Dubiel, A. Datta, B. Choudhury, J. B. Goldberg, R. Carlson, and M. A. Valvano. 2005. Reconstitution of O-specific lipopolysaccharide expression in Burkholderia cenocepacia strain J2315, which is associated with transmissible infections in patients with cystic fibrosis. J. Bacteriol. 187:1324-1333.[Abstract/Free Full Text]
  202. 102
  203. Ortega, X. P., S. T. Cardona, A. R. Brown, S. A. Loutet, R. S. Flannagan, D. J. Campopiano, J. R. Govan, and M. A. Valvano. 2007. A putative gene cluster for aminoarabinose biosynthesis is essential for Burkholderia cenocepacia viability. J. Bacteriol. 189:3639-3644.[Abstract/Free Full Text]
  204. 103
  205. Outten, F. W., D. L. Huffman, J. A. Hale, and T. V. O'Halloran. 2001. The independent cue and cus systems confer copper tolerance during aerobic and anaerobic growth in Escherichia coli. J. Biol. Chem. 276:30670-30677.[Abstract/Free Full Text]
  206. 104
  207. Parr, T. R., R. A. Moore, L. V. Moore, and R. E. W. Hancock. 1987. Role of porins in intrinsic antibiotic resistance of Pseudomonas cepacia. Antimicrob. Agents Chemother. 31:121-123.[Abstract/Free Full Text]
  208. 105
  209. Parsons, Y. N., R. Banasko, M. G. Detsika, K. Duangsonk, L. Rainbow, C. A. Hart, and C. Winstanley. 2003. Suppression-subtractive hybridisation reveals variations in gene distribution amongst the Burkholderia cepacia complex, including the presence in some strains of a genomic island containing putative polysaccharide production genes. Arch. Microbiol. 179:214-223.[Medline]
  210. 106
  211. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448.[Abstract/Free Full Text]
  212. 107
  213. Philippon, L. N., T. Naas, A. T. Bouthors, V. Barakett, and P. Nordmann. 1997. OXA-18, a class D clavulanic acid-inhibited extended-spectrum beta-lactamase from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 41:2188-2195.[Abstract]
  214. 108
  215. Potvin, E., D. E. Lehoux, I. Kukavica-Ibrulj, K. L. Richard, F. Sanschagrin, G. W. Lau, and R. C. Levesque. 2003. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environ. Microbiol. 5:1294-1308.[CrossRef][Medline]
  216. 109
  217. Prince, A., M. S. Wood, G. S. Cacalano, and N. X. Chin. 1988. Isolation and characterization of a penicillinase from Pseudomonas cepacia 249. Antimicrob. Agents Chemother. 32:838-843.[Abstract/Free Full Text]
  218. 110
  219. Quan, S., H. Venter, and E. R. Dabbs. 1997. Ribosylative inactivation of rifampin by Mycobacterium smegmatis is a principal contributor to its low susceptibility to this antibiotic. Antimicrob. Agents Chemother. 41:2456-2460.[Abstract]
  220. 111
  221. Reimmann, C., L. Serino, M. Beyeler, and D. Haas. 1998. Dihydroaeruginoic acid synthetase and pyochelin synthetase, products of the pchEF genes, are induced by extracellular pyochelin in Pseudomonas aeruginosa. Microbiology 144(Pt. 11):3135-3148.[Abstract/Free Full Text]
  222. 112
  223. Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M. A. Rajandream, and B. Barrell. 2000. Artemis: sequence visualization and annotation. Bioinformatics 16:944-945.[Abstract/Free Full Text]
  224. 113
  225. Saini, L. S., S. B. Galsworthy, M. A. John, and M. A. Valvano. 1999. Intracellular survival of Burkholderia cepacia complex isolates in the presence of macrophage cell activation. Microbiology 145(Pt. 12):3465-3475.[Abstract/Free Full Text]
  226. 114
  227. Sajjan, U., Y. Wu, G. Kent, and J. Forstner. 2000. Preferential adherence of cable-piliated Burkholderia cepacia to respiratory epithelia of CF knockout mice and human cystic fibrosis lung explants. J. Med. Microbiol. 49:875-885.[Abstract/Free Full Text]
  228. 115
  229. Sajjan, U. S., M. Corey, M. A. Karmali, and J. F. Forstner. 1992. Binding of Pseudomonas cepacia to normal human intestinal mucin and respiratory mucin from patients with cystic fibrosis. J. Clin. Investig. 89:648-656.[Medline]
  230. 116
  231. Sajjan, U. S., and J. F. Forstner. 1993. Role of a 22-kilodalton pilin protein in binding of Pseudomonas cepacia to buccal epithelial cells. Infect. Immun. 61:3157-3163.[Abstract/Free Full Text]
  232. 117
  233. Sajjan, U. S., H. Xie, M. D. Lefebre, M. A. Valvano, and J. F. Forstner. 2003. Identification and molecular analysis of cable pilus biosynthesis genes in Burkholderia cepacia. Microbiology 149:961-971.[Abstract/Free Full Text]
  234. 118
  235. Salanoubat, M., S. Genin, F. Artiguenave, J. Gouzy, S. Mangenot, M. Arlat, A. Billault, P. Brottier, J. C. Camus, L. Cattolico, M. Chandler, N. Choisne, C. Claudel-Renard, S. Cunnac, N. Demange, C. Gaspin, M. Lavie, A. Moisan, C. Robert, W. Saurin, T. Schiex, P. Siguier, P. Thebault, M. Whalen, P. Wincker, M. Levy, J. Weissenbach, and C. A. Boucher. 2002. Genome sequence of the plant pathogen Ralstonia solanacearum. Nature 415:497-502.[CrossRef][Medline]
  236. 119
  237. Schell, M. A., R. L. Ulrich, W. J. Ribot, E. E. Brueggemann, H. B. Hines, D. Chen, L. Lipscomb, H. S. Kim, J. Mrazek, W. C. Nierman, and D. DeShazer. 2007. Type VI secretion is a major virulence determinant in Burkholderia mallei. Mol. Microbiol. 64:1466-1485.[CrossRef][Medline]
  238. 120
  239. Segonds, C., T. Heulin, N. Marty, and G. Chabanon. 1999. Differentiation of Burkholderia species by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene and application to cystic fibrosis isolates. J. Clin. Microbiol. 37:2201-2208.[Abstract/Free Full Text]
  240. 121
  241. Shaw, D., I. R. Poxton, and J. R. Govan. 1995. Biological activity of Burkholderia (Pseudomonas) cepacia lipopolysaccharide. FEMS Immunol. Med. Microbiol. 11:99-106.[CrossRef][Medline]
  242. 122
  243. Shimomura, H., M. Matsuura, S. Saito, Y. Hirai, Y. Isshiki, and K. Kawahara. 2003. Unusual interaction of a lipopolysaccharide isolated from Burkholderia cepacia with polymyxin B. Infect. Immun. 71:5225-5230.[Abstract/Free Full Text]
  244. 123
  245. Smith, E. E., D. G. Buckley, Z. N. Wu, C. Saenphimmachak, L. R. Hoffman, D. A. D'Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz, J. L. Burns, R. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 103:8487-8492.[Abstract/Free Full Text]
  246. 124
  247. Sobel, M. L., G. A. McKay, and K. Poole. 2003. Contribution of the MexXY multidrug transporter to aminoglycoside resistance in Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 47:3202-3207.[Abstract/Free Full Text]
  248. 125
  249. Sokol, P. A. 1986. Production and utilization of pyochelin by clinical isolates of Pseudomonas cepacia. J. Clin. Microbiol. 23:560-562.[Abstract/Free Full Text]
  250. 126
  251. Speert, D. P., D. Henry, P. Vandamme, M. Corey, and E. Mahenthiralingam. 2002. Epidemiology of Burkholderia cepacia complex in patients with cystic fibrosis, Canada. Emerg. Infect. Dis. 8:181-187.[Medline]
  252. 127
  253. Stanier, R. Y., N. J. Palleroni, and M. Doudoroff. 1966. The aerobic pseudomonads: a taxonomic study. J. Gen. Microbiol. 43:159-271.[Abstract/Free Full Text]
  254. 128
  255. Stephan, H., S. Freund, W. Beck, G. Jung, J. M. Meyer, and G. Winkelmann. 1993. Ornibactins: a new family of siderophores from Pseudomonas. Biometals 6:93-100.[Medline]
  256. 129
  257. Stevanin, T. M., R. K. Poole, E. A. G. Demoncheaux, and R. C. Read. 2002. Flavohemoglobin Hmp protects Salmonella enterica serovar Typhimurium from nitric oxide-related killing by human macrophages. Infect. Immun. 70:4399-4405.[Abstract/Free Full Text]
  258. 130
  259. Sun, L., R. Z. Jiang, S. Steinbach, A. Holmes, C. Campanelli, J. Forstner, U. Sajjan, Y. Tan, M. Riley, and R. Goldstein. 1995. The emergence of a highly transmissible lineage of cbl+ Pseudomonas (Burkholderia) cepacia causing CF centre epidemics in North America and Britain. Nat. Med. 1:661-666.[CrossRef][Medline]
  260. 131
  261. Tiyawisutsri, R., M. T. Holden, S. Tumapa, S. Rengpipat, S. R. Clarke, S. J. Foster, W. C. Nierman, N. P. Day, and S. J. Peacock. 2007. Burkholderia Hep_Hag autotransporter (BuHA) proteins elicit a strong antibody response during experimental glanders but not human melioidosis. BMC Microbiol. 7:19.[CrossRef][Medline]
  262. 132
  263. Tomich, M., A. Griffith, C. A. Herfst, J. L. Burns, and C. D. Mohr. 2003. Attenuated virulence of a Burkholderia cepacia type III secretion mutant in a murine model of infection. Infect. Immun. 71:1405-1415.[Abstract/Free Full Text]
  264. 133
  265. Tomich, M., C. A. Herfst, J. W. Golden, and C. D. Mohr. 2002. Role of flagella in host cell invasion by Burkholderia cepacia. Infect. Immun. 70:1799-1806.[Abstract/Free Full Text]
  266. 134
  267. Trent, M. S., A. A. Ribeiro, S. Lin, R. J. Cotter, and C. R. Raetz. 2001. An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J. Biol. Chem. 276:43122-43131.[Abstract/Free Full Text]
  268. 135
  269. Trepanier, S., A. Prince, and A. Huletsky. 1997. Characterization of the penA and penR genes of Burkholderia cepacia 249 which encode the chromosomal class A penicillinase and its LysR-type transcriptional regulator. Antimicrob. Agents Chemother. 41:2399-2405.[Abstract]
  270. 136
  271. Tribuddharat, C., R. A. Moore, P. Baker, and D. E. Woods. 2003. Burkholderia pseudomallei class a beta-lactamase mutations that confer selective resistance against ceftazidime or clavulanic acid inhibition. Antimicrob. Agents Chemother. 47:2082-2087.[Abstract/Free Full Text]
  272. 137
  273. Urban, T. A., J. B. Goldberg, J. F. Forstner, and U. S. Sajjan. 2005. Cable pili and the 22-kilodalton adhesin are required for Burkholderia cenocepacia binding to and transmigration across the squamous epithelium. Infect. Immun. 73:5426-5437.[Abstract/Free Full Text]
  274. 138
  275. Urban, T. A., A. Griffith, A. M. Torok, M. E. Smolkin, J. L. Burns, and J. B. Goldberg. 2004. Contribution of Burkholderia cenocepacia flagella to infectivity and inflammation. Infect. Immun. 72:5126-5134.[Abstract/Free Full Text]
  276. 139
  277. Utsumi, R., T. Yagi, S. Katayama, K. Katsuragi, K. Tachibana, H. Toyoda, S. Ouchi, K. Obata, Y. Shibano, and M. Noda. 1991. Molecular cloning and characterization of the fusaric acid-resistance gene from Pseudomonas cepacia. Agric. Biol. Chem. 55:1913-1918.[Medline]
  278. 140
  279. Vandamme, P., B. Holmes, T. Coenye, J. Goris, E. Mahenthiralingam, J. J. LiPuma, and J. R. Govan. 2003. Burkholderia cenocepacia sp. nov.: a new twist to an old story. Res. Microbiol. 154:91-96.[Medline]
  280. 141
  281. Vanlaere, E., A. Baldwin, D. Gevers, D. Henry, E. De Brandt, J. J. LiPuma, E. Mahenthiralingam, D. P. Speert, C. G. Dowson, and P. Vandamme. 2008. Taxon K, a complex within the Burkholderia cepacia complex, comprises at least two novel species: Burkholderia contaminans sp. nov. and Burkholderia lata sp. nov. Int. J. Syst. Evol. Microbiol. 58:1580-1590.[CrossRef]
  282. 142
  283. Vanlaere, E., J. J. Lipuma, A. Baldwin, D. Henry, E. De Brandt, E. Mahenthiralingam, D. Speert, C. Dowson, and P. Vandamme. 2008. Burkholderia latens sp. nov., Burkholderia diffusa sp. nov., Burkholderia arboris sp. nov., Burkholderia seminalis sp. nov., and Burkholderia metallica sp. nov., novel species within the Burkholderia cepacia complex. Int. J. Syst. Evol. Microbiol. 58:1580-1590.[Abstract/Free Full Text]
  284. 143
  285. van Schaik, E. J., C. L. Giltner, G. F. Audette, D. W. Keizer, D. L. Bautista, C. M. Slupsky, B. D. Sykes, and R. T. Irvin. 2005. DNA binding: a novel function of Pseudomonas aeruginosa type IV pili. J. Bacteriol. 187:1455-1464.[Abstract/Free Full Text]
  286. 144
  287. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, and P. Gros. 1993. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 73:469-485.[CrossRef][Medline]
  288. 145
  289. Visser, M. B., S. Majumdar, E. Hani, and P. A. Sokol. 2004. Importance of the ornibactin and pyochelin siderophore transport systems in Burkholderia cenocepacia lung infections. Infect. Immun. 72:2850-2857.[Abstract/Free Full Text]
  290. 146
  291. Wadsworth, S. J., and H. Goldfine. 2002. Mobilization of protein kinase C in macrophages induced by Listeria monocytogenes affects its internalization and escape from the phagosome. Infect. Immun. 70:4650-4660.[Abstract/Free Full Text]
  292. 147
  293. Woods, D. E., M. S. Schaffer, H. R. Rabin, G. D. Campbell, and P. A. Sokol. 1986. Phenotypic comparison of Pseudomonas aeruginosa strains isolated from a variety of clinical sites. J. Clin. Microbiol. 24:260-264.[Abstract/Free Full Text]
  294. 148
  295. Yu, Y., H. S. Kim, H. H. Chua, C. H. Lin, S. H. Sim, D. Lin, A. Derr, R. Engels, D. DeShazer, B. Birren, W. C. Nierman, and P. Tan. 2006. Genomic patterns of pathogen evolution revealed by comparison of Burkholderia pseudomallei, the causative agent of melioidosis, to avirulent Burkholderia thailandensis. BMC Microbiol. 6:46.[CrossRef][Medline]
  296. 149
  297. Zenewicz, L. A., Z. Wei, H. Goldfine, and H. Shen. 2005. Phosphatidylinositol-specific phospholipase C of Bacillus anthracis down-modulates the immune response. J. Immunol. 174:8011-8016.[Abstract/Free Full Text]
  298. 150
  299. Zhang, L., X. Z. Li, and K. Poole. 2001. Fluoroquinolone susceptibilities of efflux-mediated multidrug-resistant Pseudomonas aeruginosa, Stenotrophomonas maltophilia, and Burkholderia cepacia. J. Antimicrob. Chemother. 48:549-552.[Abstract/Free Full Text]
  300. 151
  301. Zlosnik, J. E., T. J. Hird, M. C. Fraenkel, L. M. Moreira, D. A. Henry, and D. P. Speert. 2008. Differential mucoid exopolysaccharide production by members of the Burkholderia cepacia complex. J. Clin. Microbiol. 46:1470-1473.[Abstract/Free Full Text]


Journal of Bacteriology, January 2009, p. 261-277, Vol. 191, No. 1
0021-9193/09/$08.00+0     doi:10.1128/JB.01230-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Deng, Y., Boon, C., Eberl, L., Zhang, L.-H. (2009). Differential Modulation of Burkholderia cenocepacia Virulence and Energy Metabolism by the Quorum-Sensing Signal BDSF and Its Synthase. J. Bacteriol. 191: 7270-7278 [Abstract] [Full Text]  
  • Ortega, X., Silipo, A., Saldias, M. S., Bates, C. C., Molinaro, A., Valvano, M. A. (2009). Biosynthesis and Structure of the Burkholderia cenocepacia K56-2 Lipopolysaccharide Core Oligosaccharide: TRUNCATION OF THE CORE OLIGOSACCHARIDE LEADS TO INCREASED BINDING AND SENSITIVITY TO POLYMYXIN B. J. Biol. Chem. 284: 21738-21751 [Abstract] [Full Text]  
  • Ryan, R. P., McCarthy, Y., Watt, S. A., Niehaus, K., Dow, J. M. (2009). Intraspecies Signaling Involving the Diffusible Signal Factor BDSF (cis-2-Dodecenoic Acid) Influences Virulence in Burkholderia cenocepacia. J. Bacteriol. 191: 5013-5019 [Abstract] [Full Text]  
  • Loutet, S. A., Bartholdson, S. J., Govan, J. R. W., Campopiano, D. J., Valvano, M. A. (2009). Contributions of two UDP-glucose dehydrogenases to viability and polymyxin B resistance of Burkholderia cenocepacia. Microbiology 155: 2029-2039 [Abstract] [Full Text]  
  • Malott, R. J., O'Grady, E. P., Toller, J., Inhulsen, S., Eberl, L., Sokol, P. A. (2009). A Burkholderia cenocepacia Orphan LuxR Homolog Is Involved in Quorum-Sensing Regulation. J. Bacteriol. 191: 2447-2460 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow An author's correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holden, M. T. G.
Right arrow Articles by Parkhill, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holden, M. T. G.
Right arrow Articles by Parkhill, J.