Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xicohtencatl-Cortes, J. Articles by Girón, J. A. Search for Related Content PubMed PubMed Citation Articles by Xicohtencatl-Cortes, J. Articles by Girón, J. A.

 Previous Article  |  Next Article 

Journal of Bacteriology, January 2009, p. 411-421, Vol. 191, No. 1
0021-9193/09/$08.00+0     doi:10.1128/JB.01306-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

The Type 4 Pili of Enterohemorrhagic Escherichia coli O157:H7 Are Multipurpose Structures with Pathogenic Attributes

Juan Xicohtencatl-Cortes,^1, Valério Monteiro-Neto,^1,2 Zeus Saldaña,¹ Maria A. Ledesma,¹ Jose Luís Puente,³ and Jorge A. Girón^1*

Department of Immunobiology, University of Arizona, 15101 N. Campbell Ave., Tucson, Arizona,¹ Centro de Ciências da Saúde, Centro Universitário do Maranhão, São Luís, Maranhão, Brazil,² Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional de México, Cuernavaca, México³

Received 16 September 2008/ Accepted 16 October 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Enterohemorrhagic Escherichia coli (EHEC) O157:H7 produces long bundles of polar type 4 pili (T4P) called HCP (for hemorrhagic coli pili) that form physical bridges between bacteria associating with human and animal epithelial cells. Here, we sought to further investigate whether HCP possessed other pathogenicity attributes associated with T4P production. Comparative studies performed with wild-type EHEC EDL933 and an isogenic hcpA mutant revealed that HCP play different roles in the biology of this organism. We found that in addition to promoting bacterial attachment to host cells, HCP mediate (i) invasion of epithelial cells, (ii) hemagglutination of rabbit erythrocytes, (iii) interbacterial connections conducive to biofilm formation, (iv) specific binding to host extracellular matrix proteins laminin and fibronectin but not collagen, and (v) twitching motility. Nonadherent laboratory E. coli strain HB101 complemented with hcpABC genes on plasmid pJX22, which specifies for HCP overproduction in EDL933, became hyperadherent and invasive and produced a thick biofilm, suggesting that the presence of HCP confers HB101(pJX22) new attributes otherwise not exhibited by HB101. Analogous to other bacteria in which T4P are involved in the pathogenesis of several infectious diseases, our data strongly suggest that HCP display multiple functions that may contribute to EHEC colonization of different hosts and to virulence, survival, and transmission of this food-borne pathogen.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Type 4 pili (T4P) represent a unique class of adhesive pili described as long bundles of flexible and filamentous polymers, whose pilin subunits are mounted in a helical fashion and exposed on the surface of several of gram-negative bacteria of clinical, industrial, and environmental importance. These pili are defined on the basis of their structural, biochemical, morphological, and antigenic characteristics. Some are considerably highly conserved in different bacteria and share several major features, including a short conserved signal peptide, a hydrophobic amino-terminal domain, and a carboxy-terminal disulfide bond (57).

T4P have been described in Escherichia coli pathogroups such as enteropathogenic E. coli (17), enterotoxigenic E. coli (18), and enterohemorrhagic E. coli (EHEC) (66), as well as in other gram-negative pathogenic bacteria, including Moraxella catarrhalis (30), species of Neisseria (36), Pseudomonas aeruginosa (32), and Vibrio cholerae (60). A number of cellular functions associated with pathogenicity have been attributed to T4P, such as adhesion to host cells, microcolony and biofilm formation, bacterial aggregation, receptors for phages, immune evasion, twitching motility, DNA uptake, and cell signaling (9).

EHEC O157:H7 is an emerging and significant food-borne pathogen that has been implicated in many outbreaks in the United States and other countries (21, 50). The clinical manifestations of EHEC infections range from self-limiting diarrhea to hemorrhagic colitis, which can evolve to severe complications known as hemolytic uremic syndrome (19, 59). Adherence to and destruction of the gut epithelium and production of two Shiga toxins are considered the major key aspects of EHEC O157:H7 pathogenesis. Whereas extensive data have accumulated regarding many cellular and molecular aspects of both toxins (43), the mechanisms of colonization of EHEC on both human and animal tissues are not entirely defined. It is known, however, that the bacteria attach firmly to epithelial cells through an outer membrane protein called intimin encoded on a pathogenicity island called the locus of enterocyte effacement (LEE) (15, 33, 55). The LEE also contains the genes required for assembly of a type 3 secretion system, a receptor for intimin called Tir, virulence regulators, and many effector molecules. Together, these elements act in concert to produce attaching and effacing lesions on the intestinal epithelium. Several reports have demonstrated the ability of EHEC strains to invade epithelial cells in vitro, albeit in small numbers, but no "invasin" per se has been described (6, 28, 29, 34, 39, 54, 63). Other, less well characterized surface proteins (38, 42, 58, 62) and several fimbrial structures (5, 22, 26, 56, 61) have been proposed in association with EHEC adherence properties. However, these proposed adherence factors are not produced by all strains, and their role in adherence is not completely understood.

Sixteen putative pilus-like operons are present in the genome of EHEC O157:H7 EDL933, and emerging data hint at which operons are expressed and whether they are functional (27, 44). Recently, we have demonstrated that both commensal and pathogenic categories of E. coli, including EHEC O157:H7 strains, can express a pilus-like gene annotated as yagZ in E. coli K-12 MG1655 (also called matB in meningitis-producing E. coli) (46, 49). The pilus structures produced from the yagZ operon were proposed to be called ECP for E. coli common pili (49). That ECP is a colonization factor was concluded from in vitro studies showing that EHEC and normal flora E. coli with mutations in the pilin subunit gene (ecpA) were affected, even though not completely, in adherence to human intestinal epithelial cells (49). We also reported that the H7 flagella of EHEC EDL933 are involved in binding to host proteins and to intestinal cells (13). Additional studies in our laboratory carried out to better understand the mechanisms underlying the adherence of EHEC O157:H7 to eukaryotic cells resulted in the demonstration that EHEC O157:H7 is also able to express and assemble T4P, which were named HCP for hemorrhagic coli pili. These pili are composed of a major pilin subunit encoded by the prepilin peptidase-dependent gene (ppdD), which is present in most E. coli strains, including commensal and pathogenic strains (51). However, E. coli K-12 strains are not able to assemble the pili unless they are transformed with the pullalanase type 2 secretion system of Klebsiella oxytoca (52). Overexpression of ppdD in Pseudomonas aeruginosa led to T4P formation, suggesting that the T4P biogenesis machinery of the pseudomonas assisted in assembly of the PpdD pili (51). We have shown that HCP play a role in adherence to cultured human colonic epithelial cells and to porcine and bovine intestinal explants and that HCP-specific antibodies are produced in patients with hemolytic uremic syndrome, suggesting that HCP are produced in vivo (66). In this study, we report that in addition to mediating cell adherence, HCP are also significantly associated with other pathogenicity attributes exhibited by other gram-negative pathogenic bacteria producing T4P. Together, the HCP-mediated properties described here may contribute to EHEC virulence, survival, and transmission.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Bacterial strains and culture conditions. Plasmids and bacterial strains used in this study are listed in Table 1. Bacteria were routinely cultured overnight in Minca minimal medium broth at 37°C to induce expression of HCP (66), unless otherwise stated. When required, the antibiotics kanamycin (100 µg/ml) and ampicillin (200 µg/ml) were added to the medium. Nonadherent and noninvasive laboratory E. coli strain HB101 does not transcribe the hcpA gene (data not shown) and was used in our studies as a bacterial host of plasmid pJX22, which carries hcpABC of EHEC strain EDL933 and leads to overexpression of HCP. Under the experimental conditions employed, HB101 was negative for all the phenotypes sought in this study and thus was used as negative control.

View this table: [in this window] [in a new window]

TABLE 1. E. coli strains and plasmids used

Cloning of His-tagged HcpA. The hcpA gene of EDL933 O157:H7 was PCR amplified using specific forward hcpA-F (CCGGGATCCTTTACACTTATCGAACTGAT) and reverse hcpA-R (GCCAAGCTTTTAGTTGGCGTCATCAAA) primers and cloned into the BamHI and HindIII restriction sites on plasmid pET-28 (Novagen), resulting in an N-terminal histidine (His) and T7 tags without a signal peptide. The HcpA His-tagged protein was purified according to the manufacturer's procedures (Qiagen).

Bacterial adherence to epithelial cells. We employed human polarized colonic (HT-29), nonintestinal (HeLa and HEp-2), and Madin-Darby bovine kidney (MDBK) epithelial cell lines. Monolayers of these cells lines at 80% confluence in 24-well plates containing Dulbecco's minimal essential medium (DMEM) with 5% D-mannose (to block type 1 pilus-mediated adherence by E. coli strains) were incubated for 3 h with 10⁷ Minca-grown E. coli strains, after which the supernatant was removed, fresh DMEM was added, and the infection was allowed to continue for an additional 3 h. After washing three times with phosphate-buffered saline (PBS), adhering bacteria were plated out to count CFU or fixed for immunofluorescence studies as previously described (66).

Invasion assay. Invasion assays were performed as described before with minor modifications (12). Briefly, cell monolayers were infected for a total of 6 h as described above. Gentamicin at 100 µg/ml (Sigma-Aldrich) was added and left for 1 h to kill extracellular bacteria. Cells were then washed three times with PBS, lysed with 1 ml of 0.1% Triton X-100 in PBS, and plated onto LB agar plates with the appropriate antibiotics. Invasion frequencies were calculated as the number of bacteria surviving incubation with gentamicin divided by the total number of bacteria present in the absence of the antibiotic. The experiments were performed in triplicate at least three times on separate days, and the data are expressed as the means of the averages of the results obtained from the three experiments performed. Thin sections of cells infected with HB101 or HB101(pJX22) were prepared for immunogold labeling using anti-HCP antibodies at the Electron Microscope Facility at the University of Arizona.

Hemagglutination assays. Purified HCP, HcpA His-tagged protein, piliated EDL933 bacteria, and derivative strains were tested for their ability to agglutinate animal (rabbit, chicken, horse, guinea pig, and bovine) erythrocytes in the presence of 1% D-mannose in 96-U-well plates as previously described (13). Animal blood was purchased from Lampire (PA).

Western blotting. The pili purified from EDL933 hcpA(pJX22) (available from a previous study [66]) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (25), and the gels were electroblotted onto polyvinylidene fluoride (PVDF) membranes and then reacted with anti-HCP antibody (1:3,000) dilutions followed by the secondary goat anti-rabbit immunoglobulin G-peroxidase conjugate (diluted 1:20,000). In separate experiments, the immobilized HCP (50 µg) were incubated with 10-µg/ml solutions of extracellular matrix glycoprotein (ECM) fibronectin, laminin, or collagen type IV (from human placenta) (Sigma), and the binding to HcpA was monitored using antibodies against individual ECMs diluted 1:3,000 (Sigma) (13).

Flow cytometry. Bacteria were grown overnight in Minca minimal medium supplemented with 0.8% L-arabinose at 37°C, and HCP on E. coli strains were detected by flow cytometry using anti-HCP antibody. The bacteria were labeled with propidium iodide (Sigma-Aldrich) and analyzed through a 42-nm band pass centered at 585 nm (66). For determination of HCP-ECM binding by flow cytometry, bacteria were incubated with ECMs at a concentration of 10 µg/ml, washed, and then incubated with specific anti-ECM antibody (1:10,000) and the secondary Alexa-Fluor 488 conjugate (1:10,000). The experiments were performed in triplicate at least three times on separate days, and the data are expressed as the means of the averages of the results obtained from the three experiments performed.

Biofilm formation. E. coli strains were grown in Minca medium and tested for biofilm formation on glass coverslips in 24-well plates (Cellstar). Ten microliters of bacteria was added to each well containing 1 ml of DMEM supplemented with 0.5% D-mannose and 0.8% L-arabinose and incubated for 24 h at 37°C under a 5% CO₂ atmosphere (53). The biofilms were fixed with 2% formaldehyde, stained with crystal violet, or incubated with primary antibodies for immunofluorescence microscopy (IFM) assays (66). In similar experiments, the uptake of crystal violet in the wells was measured by reading optical density at 620 nm (OD₆₂₀). The experiments were performed in triplicate at least three times on separate days, and the data are expressed as the means of the averages of the results obtained from the three experiments performed.

IFM. Adherence or biofilm samples were fixed in 2% formaldehyde and incubated with primary antibodies followed by secondary Alexa-Fluor 488 conjugate (66). Binding between bacteria producing HCP and ECMs (fibronectin, laminin, and collagen type IV) was also determined by IFM using specific antibodies against these proteins (13).

Binding of bacteria to immobilized HCP. We wanted to know if the pili promoted bacterium-bacterium interactions. To this aim, purified HCP (200 µl of 1.2 mg/ml) were applied to a glass coverslip, allowed to dry, and fixed with 2% formaldehyde. The presence of HCP was confirmed by IFM using anti-HCP antibody. After three washes with PBS, 200 µl of a bacterial culture adjusted to an OD₆₀₀ of 1.1 was applied in 1 ml of PBS and incubated for 1 h at room temperature. Replication of bacteria should not be expected. The coverslips were washed three times with PBS, fixed with 2% formaldehyde, incubated with propidium iodide to stain bound bacteria, mounted on glass slides, and then observed by fluorescence microscopy. Duplicate wells were stained with crystal violet to determine dye uptake by the bacteria by OD₆₂₀. In addition, binding of bacteria (producing or not producing HCP) to immobilized HCP was also determined and quantitated by enzyme-linked immunosorbent assay (ELISA) using rabbit anti-O157 antibody (diluted 1:3,000). The experiments were performed in triplicate at least three times on separate days, and the data are expressed as the means of the averages of the results obtained from the three experiments performed.

ELISA-based determination of the binding of HCP to ECMs. To determine the binding between HCP and ECMs, an ELISA-based binding assay was designed in which 10-fold dilutions of matrix proteins (starting at 1 mg/ml) were applied to ELISA plates in carbonate buffer (pH 9.8) at 4°C for 18 h. After blocking with 3% bovine serum albumin, HCP were added (1 ng/well) in quadruplicate and left for 1 h, followed by a 1-h incubation with adsorbed anti-HCP (1:3,000) serum. Anti-rabbit immunoglobulin G-alkaline phosphatase conjugate was used as the secondary antibody (1:10,000) before addition of the phosphatase substrate. The plates were read at 405 nm in an ELISA Multiskan reader. The experiments were performed in triplicate at least three times on separate days, and the data are expressed as the means of the averages of the results obtained from the three experiments performed.

Twitching motility assay. The subsurface stab assay was performed, in which twitching motility is evidenced as a zone of cellular motility in the interstitial area between the bottom of the agar and the petri dish (1). Minca minimal medium with 1% agar supplemented with 0.8% L-arabinose was inoculated with EHEC strains for 24 h at 37°C and stained with Coomassie blue for 1 h. Twitching motility in LB (pH 9.0) was also assessed for P. aeruginosa PAK and its derivative pilA mutant, which were used as positive and negative controls, respectively.

Statistical analysis. Quantitative assays were carried out at least three times in triplicate on different days. Standard deviations are represented by error bars, and data represent the average of all the results obtained from the three experiments performed. Data corresponding to the absorbance values were calculated by one-way analysis of variance and then the Tukey test. The level of significance was set at a P value of <0.05 for all comparisons. The SPSS statistical package was used.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
HCP promote adherence and invasion of EHEC and E. coli HB101. We have previously shown that HCP mediate adherence of EHEC O157:H7 to tissue culture cells (66). Invasion of host cells is a property also associated with bacterial pathogenesis, especially that of intracellular pathogens such as Salmonella enterica, Shigella flexneri, and Yersinia enterocolitica (45). While invasion of epithelial cells is not typically recognized as a clinical manifestation of EHEC infections, early studies have demonstrated that EHEC strains are capable of invading, albeit at different invasion frequencies, cultured epithelial cells (28). More recently, Luck et al. showed that EHEC LEE-negative (LEE^–) strains were more invasive than LEE⁺ strains and that invasion was dependent on the rearrangement of cytoskeleton microfilaments (29). The flagella of EHEC O113:H21 strains were suggested to contribute to invasion by these strains (28). However, no invasin has been associated with the invasion property of EHEC O157:H7 strains, and thus its identity remains elusive. Since pilus-receptor interactions may trigger internalization of bacteria into eukaryotic cells (31, 65), we investigated here whether expression of HCP could also trigger invasion of cultured epithelial cells. To address this question, we employed the gentamicin protection-based invasion assay to evaluate the ability of EDL933 and an isogenic derivative strain lacking HCP production to invade HT-29 cells after 6 h of incubation at 37°C. Relative frequencies of invasion were determined by counting the number of viable bacteria in the presence of gentamicin in relation to the total number of bacteria present in the absence of the antibiotic. We found a sixfold reduction in the frequency of invasion by the hcpA mutant with respect to the wild-type strain (Fig. 1A). Further, overproduction of HCP by EDL933 hcpA(pJX22) led to a higher frequency of invasion than for its parental strain, suggesting the involvement of the pili in internalization.

View larger version (59K): [in this window] [in a new window]

FIG. 1. Invasion of HT-29 cells by EHEC and HB101(pJX22). (A) Gentamicin protection assay showing that the hcpA mutant appears to be less invasive than the wild-type strain. (B) Comparison of invasion frequencies of strains HB101 and HB101(pJX22). The data are the means of the average of three experiments performed in triplicate on different days. Error bars represent standard deviations. (C) Electron micrograph of a thin section of an infected HT-29 cell, showing an HB101(pJX22) bacterium adhering to the cell membrane. (D) Electron micrograph of a thin section of an infected HT-29 cell, showing an HB101(pJX22) bacterium penetrating an HT-29 cell. (E) Electron micrograph of a thin section of an infected HT-29 cell, showing one HB101(pJX22) organism within an intracellular vacuole. (F) Electron micrograph of a thin section of an infected HT-29 cell, showing multiple HB101(pJX22) bacteria residing within a large intracellular vacuole; other bacteria are also seen attaching to the edges of the cell. HB01 did not invade these cells (data not shown). In panels C to E the presence of HCP antigen was detected by immunogold labeling as described in the text. The electron micrographs were taken at a magnification of x19,000.

Next, we sought to further determine the role of HCP in adherence and invasion in non-EHEC bacteria lacking the intimin adhesin. Thus, we employed laboratory E. coli strain HB101, which, regardless of the presence of type 1 pili, is typically nonadherent to most common human cell lines employed in the presence or absence of mannose and does not produce HCP. We then transformed HB101 with plasmid pJX22, and qualitative and quantitative adherence assays showed that HB101(pJX22) adhered substantially to and covered the entire monolayer of HeLa, HEp-2, HT-29, and MDBK epithelial cells, while the negative controls HB101 and HB101(pBAD-TOPO) remained nonadherent (Fig. 2A and B). The most likely explanation for these results was that overproduction of the pilin in HB101(pJX22) was responsible for the hyperadherence phenotype observed. Immunoblotting experiments using anti-HCP antibody showed a strong signal in this strain, confirming the presence of the HcpA pilin (Fig. 2C). No reactivity was found in the negative controls HB101 and HB101(pBAD-TOPO), which lack HCP production. We then tested HB101(pJX22) for its ability to invade cultured epithelial cells. This strain displayed a significantly higher frequency of invasion (0.16%) than HB101 (0.01%) and even EDL933 (0.1%) (Fig. 1A and B). In fact, the frequency of invasion of HB101(pJX22) was similar to that exhibited by EDL933 hcpA(pJX22). Analysis of thin sections of HB101(pJX22)-infected HT-29 cells by immunogold labeling electron microscopy (EM) using anti-HCP antibodies showed bacteria expressing HCP interacting closely with the cell membrane, bacteria in the process of internalization, and individual as well as numerous bacteria present within large cytoplasmic intracellular vacuoles (Fig. 1C to F).

View larger version (67K): [in this window] [in a new window]

FIG. 2. Expression of HCP leads to hyperadherence in HB101. (A) Giemsa staining of MDBK cells infected with HB101, HB101(pJX22), and HB101(pBAD-TOPO). (B) The indicated strains were incubated with human HEp-2, HeLa, MDBK, and HT-29 cells for 6 h, and the adherent bacteria were expressed as CFU/ml (105) after plating out 10-fold serial dilutions. The data are the means of the average of three experiments performed in triplicate on separate days. Error bars represent standard deviations. Note the significant increase in adherence in HB101(pJX22) compared to HB101. (C) Western blotting of whole-cell bacterial extracts, demonstrating synthesis of HcpA in HB101(pJX22). Light microscopy pictures were taken at a magnification of x60.

HCP have hemagglutinin properties. Most pili display agglutination of human or animal erythrocytes, and this property has been correlated with the ability of piliated bacteria to adhere to eukaryotic cells and with pathogenesis in general (14). We found that HCP-producing EHEC, purified HCP, and a recombinant HcpA His-tagged protein caused agglutination of rabbit, but not chicken, horse, guinea pig, or bovine, red blood cells (Fig. 3), while the EDL933 hcpA strain showed a weaker titer of hemagglutination. The residual hemagglutination in this mutant is due to the presence of the H7 flagella, which also display hemagglutinin properties, as we previously described (13).

View larger version (76K): [in this window] [in a new window]

FIG. 3. Hemagglutination assays. Twofold serial dilutions in PBS of EHEC strains, HCP, and HcpA His-tagged protein (1 mg/ml) were incubated with rabbit red blood cells on ice for 2 h. Wells containing only red blood cells and PBS were used as negative controls.

HCP contribute to biofilm formation. Since T4P are essential for initial attachment and microcolony formation during biofilm development by some gram-negative bacteria (3, 23, 64), we wondered whether the production of HCP was important for biofilm formation by EHEC O157:H7 on abiotic substrata. Thus, we also compared the abilities of the wild-type (EDL933), EDL933 hcpA, and EDL933 hcpA(pJX22) strains to form biofilms on glass coverslips. EDL933 hcpA(pBAD-TOPO) was used as the negative control. The level of biofilm formation was evaluated by comparisons of absorbance values associated with retention of crystal violet dye in biofilms. As expected, EDL933 hcpA was reduced in its ability to form biofilms in comparison to the wild-type strain (P = 0.0005) and even more with respect to the complemented strain (Fig. 4A). In agreement, the results of the microscopic analysis of EHEC biofilms showed a marked reduction in biofilm formation by the hcpA mutant strain compared to the wild-type and EDL933 hcpA(pJX22) strains (Fig. 4B). In order to visualize the presence of HCP within biofilms, IFM was carried out using anti-HCP antibodies. Meshworks of large bundles of fluorescent filaments protruding from the bacteria were produced by the complemented strain EDL933 hcpA(pJX22) but not by the hcpA mutant or the hcpA mutant transformed with the vector alone (Fig. 4B). Fewer HCP were seen in the biofilms of EDL933 than in the biofilms of the complemented strain EDL933 hcpA(pJX22). This is attributed to overexpression of HCP due to the presence of plasmid pJX22. The identity of these structures as HCP was confirmed by scanning immuno-EM (Fig. 4C). To further confirm these results, we determined HCP-mediated biofilm formation in another microbial background, E. coli HB101 carrying pJX22, under the same experimental conditions employed above. The qualitative and quantitative determinations revealed a striking increase in the level of biofilm formation by HB101(pJX22) compared to HB101, which was used as a negative control (Fig. 5). In fact, the biofilm produced by HB101(pJX22) was denser and apparently thicker than the ones produced by any of the EHEC strains.

View larger version (66K): [in this window] [in a new window]

FIG. 4. Role of HCP in biofilm formation. (A) Quantification of biofilms by reading absorbance of crystal violet dye at 620 nm. Error bars represent standard deviations. (B) EHEC biofilms stained by crystal violet and analyzed by light microscopy and IFM using anti-HCP antibody. HCP are shown in green and bacteria in red. Micrographs were taken at a magnification of x60. (C) Scanning immuno-EM micrograph of EDL933 hcpA(pJX22) biofilms, showing labeling of HCP bundles with primary antibody and the 30-nm gold conjugate. Bar, 1 µm.

View larger version (17K): [in this window] [in a new window]

FIG. 5. Development of biofilm by HB101(pJX22). (A) HB101 expressing HCP from plasmid pJX22 shows a dense biofilm, while the host strain does not. The inset shows the glass coverslip covered with HB101(pJX22) biofilm. Light microscopy pictures were taken at a magnification of x60. (B) Quantification of HB101 biofilms by reading absorbance of crystal violet dye at 620 nm. The data are the means of the average of three experiments performed in triplicate. Error bars represent standard deviations.

HCP serve as a substratum for bacterial binding. To determine if HCP promote bacterial interactions via pilus-pilus bridging, bacteria that produce or do not produce HCP were added to glass coverslips coated with HCP and left for 1 h. A series of qualitative (IFM) and quantitative experiments using ELISA and crystal violet uptake were carried out to determine the binding of bacteria to immobilized HCP. Through these approaches, we found that bacteria producing HCP [EDL933, EDL933 hcpA(pJX22), and HB101(pJX22)] bound to immobilized HCP, whereas the EHEC hcpA mutant and the nonpathogenic HB101 laboratory strain did not (Fig. 6). These data are strong indications that pili interact with other pili to promote bacterial binding.

View larger version (35K): [in this window] [in a new window]

FIG. 6. Binding of HCP-producing bacteria to HCP. (A) ELISA-based assay to determine binding of EHEC strains to immobilized HCP using anti-O157 antibodies. The HCP mutant did not adhere to HCP. (B) Quantification of bacteria attached to HCP-coated glass coverslips by determination of crystal violet uptake by OD620. The data are the means of the average of three experiments performed in triplicate on separate days. Error bars represent standard deviations. (C) Demonstration of the binding of HCP-producing bacteria (red) to immobilized HCP. (a) HCP immobilized and fixed on coverslips, used as a control for the presence of HCP in all coverslips. (b to f) HCP-coated coverslips were incubated with EDL933 (b), EDL933hcpA (c), EDL933 hcpA(pJX22) (d), HB101 (e), or HB101(pJX22) (f). After incubation, washing, and fixation, the bacteria were stained with propidium iodide (red). Note that only HCP-producing bacteria bind to HCP. Micrographs were taken at a magnification of x60.

Purified HCP and HCP-producing bacteria bind to ECMs. ECMs such as laminin, fibronectin, vitronectin, and collagen act as interlinking molecules in the basal cell membrane in connective tissues and are ideal microbial adhesion targets for colonization of host tissues (7, 35). A variety of organisms have been shown to bind, sometimes via pili, to some of these ECMs, and thus we tested the binding affinity of HCP for any of these ECMs. Through an ELISA-based binding assay, we found that HCP bound equally to fibronectin and laminin in a dose-responsive manner but not to collagen type IV (Fig. 7A). Additionally, no binding to N-acetylglucosamine, chondroitin sulfate, N-acetylgalactosamine, or bovine serum albumin was observed (data not shown). In addition, soluble fibronectin and laminin but not collagen bound to HcpA pilin immobilized onto PVDF membranes (Fig. 7B). In correlation with these data, HCP-producing bacteria EHEC and HB101(pJX22) were demonstrated by flow cytometry and IFM to bind these two ECMs (Fig. 7C and D). These data are compelling evidence demonstrating that HCP have adhesive properties and binding affinity for fibronectin and laminin.

View larger version (29K): [in this window] [in a new window]

FIG. 7. Binding of HCP to ECMs. (A) ELISA-based assay to determine binding of HCP to fibronectin, laminin, and collagen type IV. Tenfold dilutions of ECMs immobilized on ELISA plates were incubated with purified HCP and then reacted with anti-HCP antibody. The data are the means of the average of three experiments performed in triplicate on different days. Error bars represent standard deviations. (B) HCP electrophoresed and electroblotted onto PVDF membranes were reacted with a solution of 1 mg/ml of ECMs and then with antibodies against individual ECMs. (C) Determination of binding of ECMs to EHEC and HB101(pJX22) strains in suspension by flow cytometry. The data are the means of the average of three experiments performed in triplicate on separate days. Error bars represent standard deviations. (D) IFM using individual anti-ECM antibodies to detect the binding of ECMs to immobilized bacteria. In all cases, note the binding of purified HCP or bacteria producing HCP to laminin and fibronectin and not to collagen. Micrographs were taken at a magnification of x60.

HCP mediate twitching motility. Twitching motility is a phenomenon associated with production of T4P and virulence in many gram-negative bacteria (32). The retraction and extension of the flexible pili by the bacteria growing on a semisolid surface gives rise to this phenomenon. We tested the ability of HCP-producing EHEC to produce twitching motility. A twitching motility zone at the agar interstitial surface was observed only in the strains producing HCP (Fig. 8). Notably, EDL933 hcpA(pJX22) produced a larger twitching motility zone than the wild-type strain, and this can be attributed to the abundant HCP produced by the complemented strain EDL933 hcpA(pJX22). In contrast, no twitching motility was seen in the hcpA mutant strain. P. aeruginosa PAK and PAK pilA mutant strains were used as positive and negative controls, respectively.

View larger version (75K): [in this window] [in a new window]

FIG. 8. Twitching motility by HCP-producing strains, demonstrated by using the subsurface stab assay in Minca minimal medium. Twitching motility was characterized by a zone of cellular motility in the interface between the bottom of the agar and the petri dish. P. aeruginosa PAK and pilA mutant strains were used as positive and negative controls, respectively. EDL933 and the complemented strain EDL933 hcpA(pJX22) produced a zone of twitching motility, while the hcpA mutant was negative for this phenotype.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
T4P are generally recognized as crucial adherence factors for host colonization that also mediate bacterial aggregation. Members of the T4P family display many other biological functions that may or may not be manifested by all members (9, 16, 18, 32, 41, 60, 66). For example, the T4P of Neisseria gonorrhoeae are associated with twitching motility but not with invasion of eukaryotic cells (36). The toxin-coregulated pilus of V. cholerae, in addition to being an intestinal colonization factor, is also the receptor for the cholera toxin bacteriophage, promotes bacterial aggregation, and provides serum resistance to the organism (8). The bundle-forming pilus of enteropathogenic E. coli is responsible for bacterial aggregation and microcolony formation on epithelial cells but has not been reported to be involved in twitching motility or phage interactions (4, 11, 17, 24).

The present study reveals that the HCP of EHEC O157:H7 possess several attributes which have been associated with virulence in other pathogens that elaborate T4P. Through several approaches, we demonstrated that the HCP is an adhesin, an invasin, a hemagglutinin, and a structure that promotes biofilm formation and confers twitching motility and ECM binding. Like many other T4P, HCP play multiple biological functions. It seems reasonable to propose that these features provide an ecological advantage to EHEC. The ability of pili to produce hemagglutination of human and animal erythrocytes correlates in general with the adherence properties of piliated bacteria. Purified HCP and the cloned HcpA His-tagged protein agglutinated rabbit red blood cells, indicating that the HCP is also a hemagglutinin. The HCP mutant still caused hemagglutination, and this effect is explained by the fact that the flagella of EHEC O157:H7 were also shown to cause rabbit erythrocytes to agglutinate (13). Thus, HCP and flagella of EHEC O157:H7 may contribute synergistically to this phenotype. Pili mediate adherence to host tissues either directly by recognizing specific host cell receptors or indirectly by promoting bacterium-bacterium interactions (45). We found that HCP served as a binding substratum only for bacteria expressing HCP [EDL933, EDL933hcpA(pJX22), and HB1201(pJX22)] and not for the EDL933 hcpA or HB101, which are unable to produce HCP. These data strongly suggest that HCP are adhesive structures in nature that mediate specific bacterial aggregation through pilus-pilus interactions. These notions are in line with previous in vitro studies showing that HCP are adherence factors for EHEC colonization of human and animal intestinal epithelial cells (66).

Several earlier and recent studies have alluded to the ability of some EHEC strains to invade some, albeit not all, host cultured epithelial cell lines (6, 28, 29, 34, 39, 54, 63). The relative frequency of EHEC invasion found by several workers varies depending on the strains and cultured epithelial cell lines employed. EHEC bacteria have been seen free in the cytoplasm or within intracellular vacuoles of colonic HCT-8 cells. Luck et al. reported that EHEC LEE^– strains (belonging to serotypes O113:H21, O91:H^–, O116:H21, O130:H11, and O1:H7) were more invasive than LEE⁺ strains (29). This would suggest that the EHEC invasin molecule is not encoded on the LEE. It is not clear if the presence of the LEE impedes host cell invasion and what is the identity of the elusive invasin of EHEC. A later study showed that the presence of the H21 flagella contributed to invasion, but not to adherence, in EHEC strains bearing these flagella by a mechanism that remains unclear (28). Whether other flagellar serotypes of EHEC LEE⁺ or LEE^– strains mediate invasion of host cells requires further investigation. In our study, we showed that LEE⁺ EHEC strain EDL933 (O157:H7) and HB101(pJX22) expressing HCP were capable of invading HT-29 human colonic epithelial cells at rates comparable to those reported by other workers using other human colonic cells (28, 29, 34, 39). Notably, the EHEC hcpA mutant and HB101 were considerably less invasive or noninvasive. Restoration of HCP production in the hcpA mutant led to significant levels of invasion.

Martinez et al. showed that the tip adhesin FimH of type 1 pili was sufficient to trigger invasion of uropathogenic E. coli into bladder epithelial cells (31). This organism was typically considered an extracellular pathogen. FimH-mediated invasion requires localized actin reorganization, activation of phosphoinositide 3-kinase, and host protein tyrosine phosphorylation. How HCP induce EHEC O157:H7 host cell invasion is a question that remains unanswered. The expression of hcpABC from a plasmid in HB101 was sufficient to promote cell invasion; thus, it is possible that pilus-mediated cell contact triggers a yet-unidentified signal in the host cytoskeleton to induce bacterial uptake.

EHEC O157:H7 is able to form biofilms on inert surfaces, an event that can be affected by many nutritional and environmental factors (10). T4P have been shown to mediate biofilm formation in other gram-negative organisms, such as Vibrio cholerae and Pseudomonas aeruginosa (40, 48). Our data showing that EHEC strains and HB101(pJX22) expressing hcpA produce biofilms, whereas the EHEC hcpA mutant and HB101 do not, suggest that HCP contribute to this phenotype. In addition, the IFM and scanning EM studies of EHEC O157:H7 biofilms identified HCP structures within these biofilms. Several other proteins and structures (e.g., curli, type 1 pili, flagella, colanic acid, or antigen 43) have been reported to be involved in biofilm formation by laboratory E. coli K-12 strains (2). Under the experimental conditions employed here, we did not see biofilm formation or cell adherence by HB101, indicating that none of these surface products were expressed. Thus, the phenotypes exhibited by HB101(pJX22) reflect the presence of HCP. In this study, all assays were carried out with previous incubation of the bacteria in Minca medium at 37°C; these are nonpermissive conditions for production of type 1 pili or curli (J. A. Giron, unpublished observations). Curli have also been associated with biofilm formation in EHEC O157:H7 (22). It is possible that biofilm formation by EHEC is associated with distinct bacterial structures, including HCP, which are under regulation of different nutritional and environmental conditions and which make possible the interactions among bacteria in a variety of ecological niches.

Perhaps the ability of EHEC strains to invade intestinal cells and to form biofilms is a strategy for long-term survival and persistent colonization in their natural hosts, hidden and protected from the immune system, which has crucial implications for the establishment of infection in humans. In support of these notions, it is known that EHEC can persist in animals for months (37), and we recently showed that HCP are apparently produced in vivo (66). The importance of the ability of EHEC to invade epithelial cells during human infections remains an open question and a possibility that cannot be ruled out and that deserves further investigation.

Many bacterial pathogens use host ECMs as target receptors to initiate colonization of tissues (7). By several experimental approaches, we showed here that purified HCP and HCP-producing bacteria display specific binding affinity for fibronectin and laminin but not for collagen type IV, suggesting that the pilin itself is an adhesin. The HCP-ECM interaction might represent an advantage for the bacteria when the normal structure of the cell tight junctions is compromised. In line with this hypothesis, LEE-containing EHEC strains secrete and translocate, via the type 3 secretion system, an effector molecule called EspF which is responsible for altering the function of tight junction proteins (20). The EspF-induced opening of tight junctions may represent a gateway for the interaction of HCP with subcellular substrates, particularly when the integrity of the intestinal epithelium has been compromised during infection.

Besides its importance as a colonization factor, HCP were shown here to be involved in twitching motility of EHEC. This property may contribute to EHEC's pathogenicity process, as has been demonstrated in other bacteria, such as P. aeruginosa, N. gonorrhoeae, and N. meningitidis, since mutants defective in twitching motility showed reduced virulence in vitro and in vivo (36, 47, 67). However, further studies are needed to verify the potential role of HCP retraction in EHEC virulence. In sum, this study reveals that the T4P of EHEC are multifunctional structures with properties that are likely to contribute to host colonization and survival of the bacteria in the environment and in different hosts.

 
We thank Mark Strom for providing P. aeruginosa strains and Olivera Francetic and Anthony Pugsley for providing anti-PpdD antiserum.

This work was supported by NIH grants AI61020 and AI63211-01 to J.A.G. and by grants from DGAPA (IN224107) and CONACyT (60796) to J.L.P.

 
* Corresponding author. Mailing address: 1501 N. Campbell Ave, LSN-649, Department of Immunobiology, University of Arizona, Tucson, AZ 85724. Phone: (520) 626-0104. Fax: (520) 626-2100. E-mail: jagiron{at}e-mail.arizona.edu

Published ahead of print on 24 October 2008.

Present address: Departamento de Bacteriología Intestinal, Hospital Infantil de México Federico Gómez, Ciudad de México, México.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Alm, R. A., and J. S. Mattick. 1995. Identification of a gene, pilV, required for type 4 fimbrial biogenesis in Pseudomonas aeruginosa, whose product possesses a pre-pilin-like leader sequence. Mol. Microbiol. 16:485-496.[CrossRef][Medline]
2
2. Barnhart, M. M., and M. R. Chapman. 2006. Curli biogenesis and function. Annu. Rev. Microbiol. 60:131-147.[CrossRef][Medline]
3
3. Bechet, M., and R. Blondeau. 2003. Factors associated with the adherence and biofilm formation by Aeromonas caviae on glass surfaces. J. Appl. Microbiol. 94:1072-1078.[CrossRef][Medline]
4
4. Bieber, D., S. W. Ramer, C. Y. Wu, W. J. Murray, T. Tobe, R. Fernandez, and G. K. Schoolnik. 1998. Type IV pili, transient bacterial aggregates, and virulence of enteropathogenic Escherichia coli. Science 280:2114-2118.[Abstract/Free Full Text]
5
5. Brunder, W., A. S. Khan, J. Hacker, and H. Karch. 2001. Novel type of fimbriae encoded by the large plasmid of sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H(–). Infect. Immun. 69:4447-4457.[Abstract/Free Full Text]
6
6. Cantey, J. R., and S. L. Moseley. 1991. HeLa cell adherence, actin aggregation, and invasion by nonenteropathogenic Escherichia coli possessing the eae gene. Infect. Immun. 59:3924-3929.[Abstract/Free Full Text]
7
7. Castaneda-Roldan, E. I., F. Avelino-Flores, M. Dall'Agnol, E. Freer, L. Cedillo, J. Dornand, and J. A. Giron. 2004. Adherence of Brucella to human epithelial cells and macrophages is mediated by sialic acid residues. Cell. Microbiol. 6:435-445.[CrossRef][Medline]
8
8. Chiang, S. L., R. K. Taylor, M. Koomey, and J. J. Mekalanos. 1995. Single amino acid substitutions in the N-terminus of Vibrio cholerae TcpA affect colonization, autoagglutination, and serum resistance. Mol. Microbiol. 17:1133-1142.[CrossRef][Medline]
9
9. Craig, L., M. E. Pique, and J. A. Tainer. 2004. Type IV pilus structure and bacterial pathogenicity. Nat. Rev. Microbiol. 2:363-378.[CrossRef][Medline]
10
10. Dewanti, R., and A. C. Wong. 1995. Influence of culture conditions on biofilm formation by Escherichia coli O157:H7. Int. J. Food Microbiol. 26:147-164.[CrossRef][Medline]
11
11. Donnenberg, M. S., J. A. Giron, J. P. Nataro, and J. B. Kaper. 1992. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol. Microbiol. 6:3427-3437.[Medline]
12
12. Elsinghorst, E. A. 1994. Measurement of invasion by gentamicin resistance. Methods Enzymol. 236:405-420.[Medline]
13
13. Erdem, A. L., F. Avelino, J. Xicohtencatl-Cortes, and J. A. Giron. 2007. Host protein binding and adhesive properties of H6 and H7 flagella of attaching and effacing Escherichia coli. J. Bacteriol. 189:7426-7435.[Abstract/Free Full Text]
14
14. Evans, D. J., Jr., D. G. Evans, and H. L. DuPont. 1979. Hemagglutination patterns of enterotoxigenic and enteropathogenic Escherichia coli determined with human, bovine, chicken, and guinea pig erythrocytes in the presence and absence of mannose. Infect. Immun. 23:336-346.[Abstract/Free Full Text]
15
15. Girard, F., F. Dziva, P. van Diemen, A. D. Phillips, M. P. Stevens, and G. Frankel. 2007. Adherence of enterohemorrhagic Escherichia coli O157, O26, and O111 strains to bovine intestinal explants ex vivo. Appl. Environ. Microbiol. 73:3084-3090.[Abstract/Free Full Text]
16
16. Girón, J. A., M. S. Donnenberg, W. C. Martin, K. G. Jarvis, and J. B. Kaper. 1993. Distribution of the bundle-forming pilus structural gene (bfpA) among enteropathogenic Escherichia coli. J. Infect. Dis. 168:1037-1041.[Medline]
17
17. Girón, J. A., A. S. Ho, and G. K. Schoolnik. 1991. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science 254:710-713.[Abstract/Free Full Text]
18
18. Girón, J. A., M. M. Levine, and J. B. Kaper. 1994. Longus: a long pilus ultrastructure produced by human enterotoxigenic Escherichia coli. Mol. Microbiol. 12:71-82.[CrossRef][Medline]
19
19. Griffin, P. M., S. M. Ostroff, R. V. Tauxe, K. D. Greene, J. G. Wells, J. H. Lewis, and P. A. Blake. 1988. Illnesses associated with Escherichia coli O157:H7 infections. A broad clinical spectrum. Ann. Intern. Med. 109:705-712.[Abstract/Free Full Text]
20
20. Guttman, J. A., Y. Li, M. E. Wickham, W. Deng, A. W. Vogl, and B. B. Finlay. 2006. Attaching and effacing pathogen-induced tight junction disruption in vivo. Cell. Microbiol. 8:634-645.[CrossRef][Medline]
21
21. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123-140.[CrossRef][Medline]
22
22. Kim, S. H., and Y. H. Kim. 2004. Escherichia coli O157:H7 adherence to HEp-2 cells is implicated with curli expression and outer membrane integrity. J. Vet. Sci. 5:119-124.[Medline]
23
23. Klausen, M., A. Heydorn, P. Ragas, L. Lambertsen, A. Aaes-Jorgensen, S. Molin, and T. Tolker-Nielsen. 2003. Biofilm formation by Pseudomonas aeruginosa wild type, flagella and type IV pili mutants. Mol. Microbiol. 48:1511-1524.[CrossRef][Medline]
24
24. Knutton, S., R. K. Shaw, R. P. Anantha, M. S. Donnenberg, and A. A. Zorgani. 1999. The type IV bundle-forming pilus of enteropathogenic Escherichia coli undergoes dramatic alterations in structure associated with bacterial adherence, aggregation and dispersal. Mol. Microbiol. 33:499-509.[CrossRef][Medline]
25
25. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
26
26. Low, A. S., F. Dziva, A. G. Torres, J. L. Martinez, T. Rosser, S. Naylor, K. Spears, N. Holden, A. Mahajan, J. Findlay, J. Sales, D. G. Smith, J. C. Low, M. P. Stevens, and D. L. Gally. 2006. Cloning, expression, and characterization of fimbrial operon F9 from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 74:2233-2244.[Abstract/Free Full Text]
27
27. Low, A. S., N. Holden, T. Rosser, A. J. Roe, C. Constantinidou, J. L. Hobman, D. G. Smith, J. C. Low, and D. L. Gally. 2006. Analysis of fimbrial gene clusters and their expression in enterohaemorrhagic Escherichia coli O157:H7. Environ. Microbiol. 8:1033-1047.[CrossRef][Medline]
28
28. Luck, S. N., L. Badea, V. Bennett-Wood, R. Robins-Browne, and E. L. Hartland. 2006. Contribution of FliC to epithelial cell invasion by enterohemorrhagic Escherichia coli O113:H21. Infect. Immun. 74:6999-7004.[Abstract/Free Full Text]
29
29. Luck, S. N., V. Bennett-Wood, R. Poon, R. M. Robins-Browne, and E. L. Hartland. 2005. Invasion of epithelial cells by locus of enterocyte effacement-negative enterohemorrhagic Escherichia coli. Infect. Immun. 73:3063-3071.[Abstract/Free Full Text]
30
30. Luke, N. R., A. J. Howlett, J. Shao, and A. A. Campagnari. 2004. Expression of type IV pili by Moraxella catarrhalis is essential for natural competence and is affected by iron limitation. Infect. Immun. 72:6262-6270.[Abstract/Free Full Text]
31
31. Martinez, J. J., M. A. Mulvey, J. D. Schilling, J. S. Pinkner, and S. J. Hultgren. 2000. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. EMBO J. 19:2803-2812.[CrossRef][Medline]
32
32. Mattick, J. S. 2002. Type IV pili and twitching motility. Annu. Rev. Microbiol. 56:289-314.[CrossRef][Medline]
33
33. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.[Abstract/Free Full Text]
34
34. McKee, M. L., and A. D. O'Brien. 1995. Investigation of enterohemorrhagic Escherichia coli O157:H7 adherence characteristics and invasion potential reveals a new attachment pattern shared by intestinal E. coli. Infect. Immun. 63:2070-2074.[Abstract]
35
35. McKeown-Longo, P. J. 1987. Fibronectin-cell surface interactions. Rev. Infect. Dis. 9(Suppl. 4):S322-S334.[Medline]
36
36. Merz, A. J., M. So, and M. P. Sheetz. 2000. Pilus retraction powers bacterial twitching motility. Nature 407:98-102.[CrossRef][Medline]
37
37. Naylor, S. W., D. L. Gally, and J. C. Low. 2005. Enterohaemorrhagic E. coli in veterinary medicine. Int. J. Med. Microbiol. 295:419-441.[CrossRef][Medline]
38
38. Nicholls, L., T. H. Grant, and R. M. Robins-Browne. 2000. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol. Microbiol. 35:275-288.[CrossRef][Medline]
39
39. Oelschlaeger, T. A., T. J. Barrett, and D. J. Kopecko. 1994. Some structures and processes of human epithelial cells involved in uptake of enterohemorrhagic Escherichia coli O157:H7 strains. Infect. Immun. 62:5142-5150.[Abstract/Free Full Text]
40
40. O'Toole, G. A., and R. Kolter. 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304.[CrossRef][Medline]
41
41. Paranjpye, R. N., and M. S. Strom. 2005. A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epithelial cells, and virulence. Infect. Immun. 73:1411-1422.[Abstract/Free Full Text]
42
42. Paton, A. W., P. Srimanote, M. C. Woodrow, and J. C. Paton. 2001. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 69:6999-7009.[Abstract/Free Full Text]
43
43. Paton, J. C., and A. W. Paton. 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11:450-479.[Abstract/Free Full Text]
44
44. Perna, N. T., G. Plunkett, 3rd, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533.[CrossRef][Medline]
45
45. Pizarro-Cerda, J., and P. Cossart. 2006. Bacterial adhesion and entry into host cells. Cell 124:715-727.[CrossRef][Medline]
46
46. Pouttu, R., B. Westerlund-Wikstrom, H. Lang, K. Alsti, R. Virkola, U. Saarela, A. Siitonen, N. Kalkkinen, and T. K. Korhonen. 2001. matB, a common fimbrillin gene of Escherichia coli, expressed in a genetically conserved, virulent clonal group. J. Bacteriol. 183:4727-4736.[Abstract/Free Full Text]
47
47. Pujol, C., E. Eugene, M. Marceau, and X. Nassif. 1999. The meningococcal PilT protein is required for induction of intimate attachment to epithelial cells following pilus-mediated adhesion. Proc. Natl. Acad. Sci. USA 96:4017-4022.[Abstract/Free Full Text]
48
48. Reguera, G., and R. Kolter. 2005. Virulence and the environment: a novel role for Vibrio cholerae toxin-coregulated pili in biofilm formation on chitin. J. Bacteriol. 187:3551-3555.[Abstract/Free Full Text]
49
49. Rendon, M. A., Z. Saldana, A. L. Erdem, V. Monteiro-Neto, A. Vazquez, J. B. Kaper, J. L. Puente, and J. A. Giron. 2007. Commensal and pathogenic Escherichia coli use a common pilus adherence factor for epithelial cell colonization. Proc. Natl. Acad. Sci. USA 104:10637-10642.[Abstract/Free Full Text]
50
50. Riley, L. W., R. S. Remis, S. D. Helgerson, H. B. McGee, J. G. Wells, B. R. Davis, R. J. Hebert, E. S. Olcott, L. M. Johnson, N. T. Hargrett, P. A. Blake, and M. L. Cohen. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681-685.[Abstract]
51
51. Sauvonnet, N., P. Gounon, and A. P. Pugsley. 2000. PpdD type IV pilin of Escherichia coli K-12 can be assembled into pili in Pseudomonas aeruginosa. J. Bacteriol. 182:848-854.[Abstract/Free Full Text]
52
52. Sauvonnet, N., G. Vignon, A. P. Pugsley, and P. Gounon. 2000. Pilus formation and protein secretion by the same machinery in Escherichia coli. EMBO J. 19:2221-2228.[CrossRef][Medline]
53
53. Sheikh, J., S. Hicks, M. Dall'Agnol, A. D. Phillips, and J. P. Nataro. 2001. Roles for Fis and YafK in biofilm formation by enteroaggregative Escherichia coli. Mol. Microbiol. 41:983-997.[CrossRef][Medline]
54
54. Sherman, P., R. Soni, M. Petric, and M. Karmali. 1987. Surface properties of the Vero cytotoxin-producing Escherichia coli O157:H7. Infect. Immun. 55:1824-1829.[Abstract/Free Full Text]
55
55. Sinclair, J. F., E. A. Dean-Nystrom, and A. D. O'Brien. 2006. The established intimin receptor Tir and the putative eucaryotic intimin receptors nucleolin and beta1 integrin localize at or near the site of enterohemorrhagic Escherichia coli O157:H7 adherence to enterocytes in vivo. Infect. Immun. 74:1255-1265.[Abstract/Free Full Text]
56
56. Srimanote, P., A. W. Paton, and J. C. Paton. 2002. Characterization of a novel type IV pilus locus encoded on the large plasmid of locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 70:3094-3100.[Abstract/Free Full Text]
57
57. Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the type IV pili. Annu. Rev. Microbiol. 47:565-596.[CrossRef][Medline]
58
58. Tarr, P. I., S. S. Bilge, J. C. Vary, Jr., S. Jelacic, R. L. Habeeb, T. R. Ward, M. R. Baylor, and T. E. Besser. 2000. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect. Immun. 68:1400-1407.[Abstract/Free Full Text]
59
59. Tarr, P. I., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365:1073-1086.[Medline]
60
60. Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proc. Natl. Acad. Sci. USA 84:2833-2837.[Abstract/Free Full Text]
61
61. Torres, A. G., J. A. Giron, N. T. Perna, V. Burland, F. R. Blattner, F. Avelino-Flores, and J. B. Kaper. 2002. Identification and characterization of lpfABCC'DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 70:5416-5427.[Abstract/Free Full Text]
62
62. Torres, A. G., and J. B. Kaper. 2003. Multiple elements controlling adherence of enterohemorrhagic Escherichia coli O157:H7 to HeLa cells. Infect. Immun. 71:4985-4995.[Abstract/Free Full Text]
63
63. Uhlich, G. A., J. E. Keen, and R. O. Elder. 2002. Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells. Infect. Immun. 70:395-399.[Abstract/Free Full Text]
64
64. Watnick, P. I., and R. Kolter. 1999. Steps in the development of a Vibrio cholerae El Tor biofilm. Mol. Microbiol. 34:586-595.[CrossRef][Medline]
65
65. Weinberg, A., C. M. Belton, Y. Park, and R. J. Lamont. 1997. Role of fimbriae in Porphyromonas gingivalis invasion of gingival epithelial cells. Infect. Immun. 65:313-316.[Abstract]
66
66. Xicohtencatl-Cortes, J., V. Monteiro-Neto, M. A. Ledesma, D. M. Jordan, O. Francetic, J. B. Kaper, J. L. Puente, and J. A. Giron. 2007. Intestinal adherence associated with type IV pili of enterohemorrhagic Escherichia coli O157:H7. J. Clin. Investig. 117:3519-3529.[CrossRef][Medline]
67
67. Zolfaghar, I., D. J. Evans, and S. M. Fleiszig. 2003. Twitching motility contributes to the role of pili in corneal infection caused by Pseudomonas aeruginosa. Infect. Immun. 71:5389-5393.[Abstract/Free Full Text]

---

Journal of Bacteriology, January 2009, p. 411-421, Vol. 191, No. 1
0021-9193/09/$08.00+0     doi:10.1128/JB.01306-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• House, B., Kus, J. V., Prayitno, N., Mair, R., Que, L., Chingcuanco, F., Gannon, V., Cvitkovitch, D. G., Barnett Foster, D. (2009). Acid-stress-induced changes in enterohaemorrhagic Escherichia coli O157 : H7 virulence. Microbiology 155: 2907-2918 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xicohtencatl-Cortes, J. Articles by Girón, J. A. Search for Related Content PubMed PubMed Citation Articles by Xicohtencatl-Cortes, J. Articles by Girón, J. A.