Previous Article | Next Article ![]()
Journal of Bacteriology, June 2009, p. 3462-3468, Vol. 191, No. 11
0021-9193/09/$08.00+0 doi:10.1128/JB.01804-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Institut für Med. Mikrobiologie und Hygiene, Universitätsklinikum Tübingen, Tübingen, Germany,1 Department of Genetics and Molecular Biology, Masaryk University, Brno, Czech Republic,2 Institut für Immunologie und Transfusionsmedizin, Universität Greifswald, Greifswald, Germany3
Received 23 December 2008/ Accepted 23 March 2009
|
|
|---|
|
|
|---|
Despite the obvious importance of phages for the biology of S. aureus, epidemiological data on the prevalence of phages in this species are limited (28, 33). More than 80 genome sequences of staphylococcal bacteriophages and prophages are available in the public genome databases. Most published S. aureus phages belong to the Siphoviridae family of temperate, tailed bacterial viruses. Traditionally, S. aureus phages were characterized according to their lytic activity, morphology, and serological properties (1, 28). Today, the temperate phages in clinical S. aureus isolates can by identified with a multiplex PCR strategy, which is based on sequence differences between viral genes coding for the surface-exposed determinants (28).
In general, the evolution of phage lineages seems to be driven by the lateral gene transfer of interchangeable genetic elements (modules), which consist of functionally related genes. The Siphoviridae genomes are usually organized into six functional modules: lysogeny, DNA replication, regulation of transcription, packaging and head, tail, and lysis (4). A functional module found in one phage can be replaced in another phage by a sequence-unrelated module that fulfils the same or related functions. Multiple alignment of S. aureus phage genomes also revealed a chimeric and mosaic structure resulting from horizontal transfer and recombination (5, 20). It is an open question whether all phages have access to a common gene pool or whether subpools have developed, which are due to differences in the accessibility of strain variants of the bacterial host species.
It was recently shown that most human S. aureus strains belong to one of 10 independent lineages or clonal complexes (CCs) (9, 24). Exchange of DNA is very much lower between different lineages than within the same lineage due to the action of the restriction-modification (R-M) system SauI (34). The prime role of R-M systems in many bacteria is the defense against DNA bacteriophages. These systems usually comprise a DNA methyltransferase and a restriction endonuclease. The former protects self DNA by methylation of specific nucleotides in a certain DNA sequence, whereas the latter cleaves the foreign unmodified DNA at the same sequence motif. If the spread of bacteriophages between different S. aureus lineages was controlled by the R-M system or a similar mechanism, an unequal distribution would be expected.
Here we established a classification scheme for staphylococcal prophages of the major Siphoviridae family which was based on the suggested phage designation of the published S. aureus genomes (22, 23). When analyzing a representative S. aureus strain collection, we could show that the frequency of certain phage groups varied between S. aureus lineages. A comparison of colonizing and invasive S. aureus strain populations revealed that hlb-converting phages were significantly more frequent in colonizing strains.
|
|
|---|
Strain typing. spa typing was performed as described previously (15) using the Ridom StaphType software (13). Pulsed-field gel electrophoresis (PFGE) typing and Southern blot analysis were performed as described previously (10).
MLST. Multilocus sequence genotyping (MLST) was performed on selected isolates according to published protocols (8). Otherwise, MLST CCs were deduced from BURP grouping of spa types or by comparison with the PFGE pattern (31).
Phage integrase multiplex PCRs.
Multiplex PCR was performed using the multiplex PCR kit (Qiagen, Hilden, Germany). Each reaction mixture (25 µl) contained 12.5 µl 2x Qiagen multiplex PCR master mix, 200 nM of each primer, and 10 ng of template DNA. An initial denaturation of DNA at 95°C for 15 min was followed by 35 cycles of amplification (95°C for 30 s, 55°C for 60 s, and 72°C for 45 s), ending with a final extension phase at 72°C for 10 min. All PCR products were resolved by electrophoresis in 3% agarose gels, stained with ethidium bromide, and visualized under UV light. The following primers specific for the phage integrase genes were used: for Sa1int, Sa1-F (AAGCTAAGTTCGGGCACA) and Sa1-R (GTAATGTTTGGGAGCCAT) (length, 569 bp); for Sa2int, Sa2-F (TCAAGTAACCCGTCAACTC) and Sa2-R (ATGTCTAAATGTGTGCGTG) (length, 640 bp); for Sa3int, Sa3-F (GAAAAACAAACGGTGCTAT) and Sa3-R (TTATTGACTCTACAGGCTGA) (length, 475 bp); for Sa4int, Sa4-F (ATTGATATTAACGGAACTC and Sa4-R (TAAACTTATATGCGTGTGT) (length, 320 bp); for Sa5int, Sa5-F (AAAGATGCCAAACTAGCTG and Sa5-R (CTTGTGGTTTTGTTCTGG) (length, 375 bp); for Sa6int, Sa6-F (GCCATCAATTCAAGGATAG and Sa6-R (TCTGCAGCTGAGGACAAT) (length, 167 bp); and for Sa7int, Sa7-F (GTCCGGTAGCTAGAGGTC and Sa7-R (GGCGTATGCTTGACTGTGT) (length, 214 bp). Validation of the multiplex PCR assay was carried out with (i) genome-sequenced S. aureus strains, (ii) prophage-less S. aureus 8325-4 or S. aureus 1039 lysogenized with genome-sequenced phages of the International Typing Set belonging to different int gene classes (
55, Sa1int;
47, Sa2int;
42E, Sa3int;
29, Sa5int;
77, Sa6int; or
53, Sa7int), and (iii) triple-lysogenic S. aureus NCTC 8325 (harboring prophages
11,
12, and
13) lysogenized with
77 or with
53.
Sequence analysis. Phage sequences were obtained from the NCBI nucleotide database or were assembled from the published S. aureus genomes. Open reading frames (ORFs) for the integrase and holin genes were deduced from the whole phage genomes by BLAST analysis. Integrase sequences were aligned by ClustalW. Phages were assigned to serotypes using the primer sequences published by Pantucek et al. to identify the respective genes (28).
For sequencing of the integrase and holin genes of phage
6390, the targets were amplified from strain RN6390 by standard PCR using the primers 6390intseq-for (ATTGGCGAACGAGGTAAC) and 6390intseq-rev (GCCAATTTTGAGGAGGGAG) for the integrase gene and Holin255-for (ATGATTAATTGGAAAATTAGAA and Holin255-rev (CTAGTATTTTCTTCTTGGTTCT) for the holin gene. Amplicons were cloned into pCR2.1 (Invitrogen, Karlsruhe, Germany) for sequencing. The sequencing was done by 4base lab, Reutlingen, Germany, using the Dynamic sequence kit (Amersham Biosciences, Freiburg, Germany). Sequence data were analyzed using Vector NTI software (InforMax, Frederick, MD).
Statistical analysis. Differences between groups were assessed using the likelihood ratio test with Bonferroni's adjustment.
Nucleotide sequence accession number.
The
6390 integrase sequence was deposited in the GenBank and EMBL databases (accession no. FM877489).
|
|
|---|
Genes coding for a putative integrase could be identified in all the available staphylococcal phage genomes with the exception of one (
3A). Alignment of the integrase nucleotide sequences clustered the prophages in seven major and eight minor groups (Fig. 1). Within groups, the nucleotide sequence identity was 95% to 100%; between the groups, there was only 38% to 84% identity, which was still compatible with functional analogy. In fact, based on amino acid sequence homology and catalytic residues, most integrases belong to the tyrosine recombinase type family; only Sa7int, Sa12int, Se1int, and Sh2int belong to the serine recombinase type family. Most S. aureus prophages clustered in one of the seven major groups (designated Sa1int to Sa7int), and five were singletons (Sa8int to Sa12int). The two known S. epidermidis bacteriophages (
CNPH82 and
PH15) and the two S. haemolyticus prophages (
JCSC1435A and
JCSC1435B) differed strongly from all S. aureus phages (Fig. 1).
![]() View larger version (29K): [in a new window] |
FIG. 1. In silico analysis of the integrase groups, serogroups, holin groups, and virulence genes of 70 published staphylococcal bacteriophages of the class Siphoviridae. Integrase nucleotide sequences were aligned using the ClustalW algorithm. Identical serogroups and holin groups are color coded. Integrases of the serine recombinase-type family are shaded in gray.
|
37 and
EW), the two S. epidermidis phages, and the two S. haemolyticus phages could not be discerned with the applied classification scheme. Sequence alignment of the holin genes revealed 10 different groups. Sequence relatedness within these groups ranged from 92% to 100% homology. Because sequence homology was closely correlated with gene length, the holin groups were designated by the sequence length polymorphism (number), and additional sequence variations were indicated by letters (255a, 255b, 216, 273, 276, 303, 423, 435, 438, and 486). The majority of the S. aureus phages clustered in one of the five major holin groups. Little sequence homology was observed between the holin genes from the different staphylococcal species.
Mosaicism of staphylococcal phage genomes.
When comparing the integrase sequence tree with the results of the other two classification systems for 70 staphylococcal phages (
3A was omitted, because no integrase gene could be detected), different degrees of genome mosaicisms were observed. For the phage groups Sa3int, Sa5int, and Sa6int, a high diversity in the combination of the three marker modules was determined (Fig. 1). The largest group of S. aureus phages (14/70) are the Sa3int phages, which differed in serogroup (Fa, Fb, or A), holin genes (255a and 255b are not closely related), and their combination of immune-modulatory virulence factors. Phages of this group typically integrate into the hlb gene of S. aureus, leading to negative conversion of β-hemolysin production (6). Similarly, the phages of the Sa5int group exhibited a high diversity in their module pattern: three serogroups (B, Fb, and L) and three holin groups (255a, 303, and 438) could be detected. The popular transducing phage
11 of S. aureus strain 8325 is placed in this group. Phage
PV83 is the only Sa5int member which encodes a known virulence factor (lukM). Finally, serogroups A, B, and Fa and two holin genes, 303 and 438, were found in phage group Sa6int. These phages typically integrate into the lipase gene (geh) of S. aureus (21).
A lower degree of variation regarding the three analyzed modules was found in the S. aureus phage groups Sa1int, Sa2int, Sa4int, and Sa7int (Fig. 1). Some Sa1int phages harbor the exfoliative toxin a (eta). Sa2int phages integrate into an ORF (SA3121) of unknown function in the S. aureus genome, as shown for phage
12 of strain 8325 and the PVL-encoding phages (18). All Sa7int phages contained the serogroup B module and holin gene 303 or 438, with the exception of prophage
6390. This phage encodes holin 255a, which is characteristic for Sa3int phages, the typical sak-carrying phages. We recently determined the integration site of
6390 (intergenic region between rpmF and isdB) in the prototypic S. aureus strain RN6390 and showed that it carries the virulence gene sak (11).
The remaining S. aureus phages harbored unique integrase types but shared serogroups or holin genes with other integrase groups. For instance, the prophage
RF122 of the bovine S. aureus isolate RF122 (Sa8int) and the Sa9int and Sa12int phages all exhibit the serogroup B module and holin type 438 or 303. None of the S. aureus bacteriophage modules could be detected in the phages of the other staphylococcal species.
The results give an overview of phage mosaicism, but they also show strong association between functional units. Especially, the phage-encoded virulence factors were closely linked to the integrase groups.
Identification of S. aureus prophages by multiplex PCR. For a prevalence analysis of S. aureus prophages in a large strain collection, we focused on the identification of the integrase polymorphism for several reasons. First, nucleotide sequences are well conserved within integrase groups making, the gene an ideal target for PCR amplification. Second, the integrase-defined grouping had the best discriminatory power, reflecting the diversity of the S. aureus phage population as well as their relatedness. Last, the integrase type is closely linked to the virulence gene content of the prophage and might therefore convey information about the S. aureus pathogenic potential (Fig. 1).
We established a multiplex PCR scheme to discriminate between the seven most prominent S. aureus integrase families, Sa1int to Sa7int. The method reliably identified the prophage content of the prototypic S. aureus strains N315, Mu50, MW2, MRSA252, MSSA476, Newman, and 8325 (Fig. 2). Additionally the method was validated with S. aureus strains 8325-4 and 1039 lysogenized with genome-sequenced phages of the International Typing Set. The seven int groups were detectable by the multiplex PCR in these isolates (data not shown).
![]() View larger version (61K): [in a new window] |
FIG. 2. Multiplex PCR detecting the Sa1int to Sa7int integrase genes in prototypic S. aureus strains.
|
Analyzing the prevalence of the seven phage groups in the 291 S. aureus isolates revealed that prophages of the groups Sa3int (74%) and Sa2int (33%) (Table 1) were the most frequent ones. Sa7int could be detected in 16%, Sa1int in 9%, Sa6int in 6%, and Sa4int only in 0.2% of the isolates; 13% of the isolates harbored none of the targeted prophages. Next we asked whether there was a relationship between prophage groups and S. aureus clonal lineages. The likelihood ratio test was applied to compare the frequency of phage types in certain CCs with that in the whole cohort. Indeed, the frequency of the different phage types varied remarkably between the tested S. aureus CCs. In CC15, the very common Sa3int phages were never detected (P < 0.001). This result was verified by Southern analysis using probes specific for the phage-encoded staphylokinase (sak) (data not shown). Additionally, in significantly more (P < 0.05) CC15 isolates, none of the seven prophage groups could be detected. No CC25 isolate harbored a Sa7int phage (P < 0.05). In CC30 isolates, Sa1int phages were significantly less frequent (P < 0.05), but the Sa2int and Sa5int phages were significantly more frequent (P < 0.001 for both) than in the whole S. aureus strain collection. In CC45 the prevalence of Sa1int phages was significantly higher (P < 0.005) and that of Sa2int phages significantly lower (P < 0.001) than in all isolates. In CC5 also the Sa2int group was less often detected (P < 0.05), whereas Sa7int phages were significantly more frequent (P < 0.001). The phage prevalences in CC22 and CC8 did not differ from those in the overall cohort.
|
View this table: [in a new window] |
TABLE 1. Distribution of the seven prophage groups Sa1int to Sa7int in common S. aureus CCs
|
Distribution of phages in invasive versus colonizing isolates. To test whether phage prevalences differ in invasive and colonizing S. aureus populations, blood culture isolates were compared to nasal carriage strains. In total 276 isolates were available for analysis, 115 from blood cultures and 161 nasal isolates. When applying the multiplex PCR scheme, we could show that in the colonizing population significantly more isolates harbor Sa3int phages than in the invasive strains (P < 0.05) (Table 2). No differences were observed in the prevalence of the other phage types. Most of the isolates were lysogenic for one or more phages: in only 21% of the blood culture and 13% of the nasal isolates could none of the seven phage groups be detected. Additionally, the isolates from both populations also did not differ in the number of prophages per cell (data not shown).
|
View this table: [in a new window] |
TABLE 2. Distribution of the seven prophage groups Sa1int to Sa7int in nasal carriage and blood culture populations
|
|
|
|---|
6390 (11) and phages of selected clinical isolates (unpublished data). The CCs analyzed were shown to differ in their R-M specificity genes (34). The SauI R-M system is a major barrier to horizontal gene transfer in S. aureus and seems to delay the evolution of new strains. Mobile genetic elements present in one strain will move to a strain of the same lineage at a higher frequency than to strains of other lineages. As a consequence, S. aureus lineages carry a unique combination of core variable genes, suggesting only a vertical transmission of these genes (24). Additional R-M systems were described for S. aureus, some of which were shown to be phage encoded, which may also contribute to phage exclusion (7). In addition to the host restriction, the lysogenic immunity of a resident prophage may play a role in prevalence differences. Indeed, Sa1int- and Sa2int-type phages appear to be (in part) mutually exclusive; the simultaneous occurrence of both in a single isolate is uncommon (P = 0.0095). In concordance, in CC30, Sa1int phages were rare whereas Sa2int phages were frequent; in CC45, the distribution is vice versa.
When comparing the patterns of phage prevalence in invasive versus colonizing S. aureus isolates, no differences were detected with the exception of Sa3int phages, which were significantly more common in colonizing strains. This is in agreement with our own observation that in 96% of nasal isolates Sa3 phages were stably integrated into the hlb gene (11). Hlb-converting phages encode the immune-modulatory proteins Sak, Scin, and Chips (6, 33). These may act together to resist the innate immune response encountered during nasal colonization (complement, defensins, and phagocytosis). In contrast, the lack of the Sa3int phages in infecting isolates is correlated to restore Hlb production. This is in concordance with previous findings indicating that Hlb-producing strains are linked to infectious conditions (11, 16, 29). However, when comparing community-acquired invasive isolates with nasal carriage isolates, Lindsay et al. were unable to detect any association between gene and invasive isolates (24). This discrepancy is perhaps due to different criteria for the inclusion of isolates in the invasive group.
In this study we developed a reliable classification scheme for staphylococcal phages of the Siphoviridae family, which is the largest, best-described group of temperate S. aureus phages. We could show that phages can be clustered into defined groups based on the integrase sequence. This feature fulfils the criteria to be discriminative enough to account for the high diversity of the prophages without being too diverse, thus creating only types represented by single members. Importantly, the integrase identification allows prediction of the chromosomal location of the prophage and gives an indication of the virulence gene content. Analysis of a large S. aureus strain collection revealed that most of the isolates contained one to three prophages, which is in line with the phage content of the S. aureus strains for which the whole genomes have been sequenced. The most prevalent phages were the Sa3int group, followed by Sa2int. Sa4int was detected only once.
To assess phage diversity, 71 complete staphylococcal bacteriophage genome sequences from the databases were analyzed in three marker regions: lysogeny module, morphogeny module, and lysis module. Various degrees of genome mosaicism could be observed within the different Sa-int groups. The Sa1int and Sa2int groups were characterized by a uniform modular architecture with strong links between the genes for integrase, holin, and encoded virulence factors. Perhaps it is evolutionarily beneficial to interchange this whole unit, which is in proximity in the circular form of the phage. Multiple alignments of several PVL-encoding phages revealed a high degree of mosaic structure of the phage genomes, but the luk-PV genes were always located in a 6.4-kb region consisting of the host lysis module, luk-PV, attP, and the integrase gene (18). We aligned the eight PVL-carrying and the three non-PVL-carrying strains of the Sa2int group to discern the crossover point for integration of the toxin complex. This point appeared to be located at the end of the phage amidase ORF (data not shown). The close organization of the lytic module and the inserted virulence factors is perhaps favored to optimize the phage control of the expression of the pathogenicity genes (32). Interestingly, Sa1int and Sa2int phages, which excluded one another, did not share any modules, suggesting a parallel evolution with no or little contact. It would now be of interest to test whether recombination occurs only within the lineage boundaries or whether phage mosaics are evolutionarily more ancient than the lineage branching. The fact that none of the S. aureus phage modules are present in phages from other staphylococcal species argues in favor of the first possibility.
Published ahead of print on 27 March 2009. ![]()
|
|
|---|
Sa3ms is intimately linked with the phage's life cycle. J. Bacteriol. 185:6841-6851.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»