This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, Y.-r.
Right arrow Articles by Chen, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, Y.-r.
Right arrow Articles by Chen, C. W.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2009, p. 773-781, Vol. 191, No. 3
0021-9193/09/$08.00+0     doi:10.1128/JB.01299-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Streptomyces Telomeres Contain a Promoter{triangledown}

Yuh-ru Lin,1,§ Mi-Young Hahn,2,# Jung-Hye Roe,2 Tzu-Wen Huang,1 Hsiu-Hui Tsai,1 Yung-Feng Lin,1 Tsung-Sheng Su,1,3,4 Yu-Jiun Chan,5 and Carton W. Chen1*

Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Shih-Pai, Taipei 112, Taiwan,1 School of Biological Sciences, Seoul National University, Seoul 151-742, South Korea,2 Institute of Microbiology and Immunology, National Yang-Ming University, Shih-Pai, Taipei 112, Taiwan,3 Department of Medical Research and Education, Taipei Veterans General Hospital, Shih-Pai, Taipei 112, Taiwan,4 Division of Clinical Virology, Taipei Veterans General Hospital, Shih-Pai, Taipei 112, Taiwan5

Received 16 September 2008/ Accepted 19 November 2008


arrow
ABSTRACT
 
Bidirectional replication of the linear chromosomes and plasmids of Streptomyces spp. results in single-strand overhangs at their 3' ends, which contain extensive complex palindromic sequences. The overhangs are believed to be patched by DNA synthesis primed by a terminal protein that remains covalently bound to the 5' ends of the telomeres. We discovered that in vitro a conserved 167-bp telomere DNA binds strongly to RNA polymerase holoenzyme and exhibits promoter activities stronger than those of an rRNA operon. In vivo, the telomere DNA exhibited promoter activity in both orientations on a circular plasmid in Streptomyces. The telomere promoter is also active on a linear plasmid during exponential growth. Such promoter activity in a telomere has not hitherto been observed in eukaryotic or prokaryotic replicons. Streptomyces telomere promoters may be involved in priming the terminal Okazaki fragment (during replication) replicative transfer (during conjugation), or expression of downstream genes (including a conserved ttrA helicase-like gene involved in conjugal transfer). Interestingly, the Streptomyces telomeres also function as a promoter in Escherichia coli and as a transcription enhancer in yeast.


arrow
INTRODUCTION
 
The linear chromosomes (33) and plasmids (38) of Streptomyces spp. are capped by terminal proteins (TPs) covalently bound to the 5' ends of the DNA. Such TP-capped telomeres are also found in a variety of linear plasmid and viral DNAs of both eukaryotic and prokaryotic origins, including the well-studied adenoviruses and Bacillus {phi}29 phage, which are replicated from end to end using the TP as a primer for initiation (reviewed in reference 39). In contrast, the linear replicons of Streptomyces spp. are replicated bidirectionally from an internal origin. This mode of replication leaves single-stranded gaps of 250 to 300 nucleotides (nt) at the 3' ends (16; C.-H. Huang, unpublished results), which are supposedly patched by TP-primed DNA synthesis (reviewed in reference 15). For essentially all linear chromosomes and most linear plasmids of Streptomyces spp., the telomere sequences are highly conserved for about 200 bp and contain extensive palindromic sequences capable of forming complex secondary structures (27). These archetypal telomeres are capped by TP encoded by tpg (4, 45). Several Tpg proteins have been identified (4, 45), and they are highly conserved in size (184 to 185 amino acids) and sequences.

Atypical telomere sequences have been found in a few linear plasmids (32, 47) and one chromosome (23) of Streptomyces spp. For example, the telomeres of linear plasmid SCP1 of Streptomyces coelicolor differ significantly from the archetypal telomeres in primary (32) and secondary (7) structures. They are capped by a 259-amino-acid TP (encoded by the tpc gene on SCP1), which shares no homology with Tpgs.

Little is known about the TP-primed end patching during replication of the Streptomyces linear replicons. An in vitro deoxynucleotidylation study using a crude extract of Streptomyces identified a Thr residue on Tpg (of S. coelicolor and "Streptomyces lividans") as the attachment site of the first nucleotide, dCMP (46). However, there is no clue as to which DNA polymerase in the extract is involved in the reaction. In a TP-primed replication of {phi}29 and adenoviruses, the DNA polymerase involved is of family B. However, no gene for a family B DNA polymerase is found in the genomic sequences of S. coelicolor (8) and Streptomyces avermitilis (29).

End patching requires the product of a gene named tap, which lies upstream of tpg in the same operon on Streptomyces chromosomes (4). Tap binds to the secondary structures formed by the 3' overhangs at the archetypal telomeres formed during replication, and supposedly recruits Tpg to the telomeres to engage in end patching (2). Using Tap as a scaffold, Bao and Cohen (3) further identified DNA polymerase I (Pol I) and topoisomerase I as other components of the telomere complex. Intriguingly, these two proteins exhibit reverse transcriptase activity in addition to their predicted functions. The significance of this finding is not clear.

In this study, we attempted to isolate proteins that bind to the archetypal telomeres of Streptomyces spp. and unexpectedly found RNA polymerase among them. In an in vitro transcription system using purified Streptomyces RNA polymerase holoenzyme, the telomere DNA displayed strong promoter activity. In vivo, the telomere DNA also exhibited promoter activity either on a circular DNA or at the end of a linear DNA. Interestingly, the telomere also functioned as a promoter in E. coli and as an enhancer of transcription in Saccharomyces cerevisiae. The possible mechanism and biological role of the novel promoter activity of the Streptomyces telomeres are discussed.


arrow
MATERIALS AND METHODS
 
General bacteriological and molecular biological procedures. Bacterial strains and plasmids used are listed in Table 1. Bacterial culture, DNA restriction, electrophoresis, hybridization, cloning, transformation, and other general biological and molecular procedures were according to Sambrook et al. (40) for Escherichia coli and Kieser et al. (31) for Streptomyces.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Bacterial strains and plasmids used

Synthesis of biotin-labeled telomere DNA by PCR. Biotin-labeled telomere DNA was prepared by PCR. The 167-bp terminal sequences of the Streptomyces chromosomes (END167Sli and END167Sco) (Fig. 1) were amplified by PCR using the following pairs of primers: for S. lividans, a forward primer (ACGCGTCGACCCCGCGGAGCGGGTACCC) containing a SalI site (underlined) and a reverse primer (CCGCTCGAGGCTCCGGGAGCGCAGCGG) containing a XhoI site (underlined); and for S. coelicolor, a forward primer (ACGCGTCGACCCCGCGGAGCGGGTACCA) containing a SalI site (underlined) and a reverse primer (CCGCTCGAGACTCCGGGAGCGCAGCGG) containing a XhoI site (underlined). Each 50-µl reaction mixture contained 5 µl 10x PCRx amplification buffer, 1.5 µl 50 mM MgSO4, 2.5 U Platinum Taq DNA polymerase (Invitrogen), 1 µl 10 mM deoxynucleoside triphosphate mixture, 1 µl (25 pmol) of each primer, 20 ng template DNA (plasmid containing the cloned telomere DNA), and 10 µl 10x PCRx Enhancer System solution (Invitrogen). The PCR was performed in a PerkinElmer 9700 unit with an initial incubation at 95°C for 5 min followed by 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 65°C), and extension (30 s at 72°C). The PCR products (designated DS167) were cloned in a TA cloning vector pGEM-T Easy (Promega) to give pGEM-END167Sli and pGEM-END167Sco, and the cloned sequences were confirmed by sequencing. For biotin-labeled DNA, the PCR primers were labeled with biotin at the 5' end. Biotin-labeled forward primer and unlabeled reverse primer were used to generate DS167 DNA, which was denatured by boiling for 10 min and then quickly cooled on ice. Streptavidin-coated magnetic beads (Dynabeads M-280 streptavidin; Invitrogen) were used to isolate the biotin-labeled strand (designated SS167w) according to the manufacturer's specifications. For isolation of the complementary strand, biotin-labeled reverse primer and unlabeled forward primer were used. The resulting DNA was denatured, and the biotin-labeled strand (designated SS167c) was isolated by magnetic beads as described above.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 1. Design and synthesis of telomere DNA probes. (A) The sequence and predicted secondary structure of the 3' ends of the S. lividans chromosome (27). The secondary structures formed by the 10 palindromes (I' to X') with the lowest energy levels were constructed based on energy optimization using the DNA folding server (http://mfold.bioinfo.rpi.edu/) and G·A sheared pairings (solid dots) at the hairpin loops and at the GAA·GAA motifs (18, 27). The first 167 nt spanning the first seven palindromes is framed. The 12 substitutions (in lightface) in the corresponding terminal sequence of the S. coelicolor chromosome are shown next to the corresponding residues. Inset, secondary structure of the coliphage N4 promoter; M, A or G. (B) Synthesis of double-stranded and single-stranded terminal DNA. A pair of primers (Forward and Reverse), one of which was end labeled with biotin (filled circles), was used to produce the DS167 DNA by PCR. The two biotin-labeled strands (SS167w and SS167c) were separately purified by denaturation of DS167 DNA, followed by binding to streptavidin-coated magnetic beads.

Preparation of Streptomyces cell extracts and RNA polymerase. S. lividans ZX7 or S. coelicolor 3456 was cultured in Trypticase soy broth medium (31) at 30°C to an optical density at 600 nm (OD600) of about 1.2 and harvested by centrifugation. The pellet was resuspended in low-salt buffer A (20 mM Tris-HCl [pH 7.4], 0.5 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 0.1 M NaCl, 5% glycerol, 0.5 mM dithiothreitol [DTT], and 5 mM MgCl2) and disrupted by sonication on ice. Cell debris was removed by centrifugation. Protein concentrations were determined by the micro-Bradford method (Bio-Rad). The cell extract was divided into aliquots and stored at –20°C. RNA polymerase holoenzyme of S. coelicolor was purified as described previously (30).

Isolation of the telomere binding proteins (TBPs) and mass spectrometric analysis. Biotin-labeled terminal DNA (DS167, SS167c, or SS167w) was incubated with crude extract in ZTA buffer (0.1 mM DTT, 1 mM EDTA, 5% glycerol, 10 mM HEPES, 50 mM KCl, 0.1 mM phenylmethylsulfonyl fluoride, 0.1% Triton X-100) at 4°C for 60 min. Streptavidin-coated magnetic beads were added, and the mixture was incubated at 4°C for 30 min, then washed three times with the same buffer and eluted with 0.5 M NaCl in ZTA buffer. Electrophoretic separation in sodium dodecyl sulfate (SDS) gel, trypsin digestion, and mass spectrometric analysis of the proteins were as described previously (45).

In vitro transcription. In vitro runoff transcription assays were performed using the procedures of Fujita et al. (20) and Buttner et al. (14). The template DNA fragments were purified by electrophoresis in 5% polyacrylamide gel, eluted in 0.1% SDS overnight, and concentrated by precipitation with RNase-free ethanol. The template DNA (0.15 pmol) and RNA polymerase (1.5 pmol) were incubated at 30°C for 5 min in 15 µl transcription buffer (40 mM Tris-HCl [pH 7.9], 10 mM MgCl2, 0.6 mM EDTA, 0.4 mM potassium phosphate, 1.5 mM DTT, 0.25 mg/ml bovine serum albumin, and 20% [vol/vol] glycerol). RNA synthesis was initiated by adding 3 µl of substrate mixture containing 2 µCi [{alpha}-32P]CTP (400 Ci/mmol) and 0.4 mM each of UTP, ATP, and GTP. Heparin (3 µl, 0.1 mg/ml final concentration) was added after 2 min to prevent reinitiation, and the incubation was continued for 5 min before 2 µl cold CTP (1 mM final concentration) was added. After a 10-min incubation, the reaction was terminated by adding 50 µl of stop solution (375 mM sodium acetate [pH 5.2], 15 mM EDTA, 0.15% SDS, and 0.1 mg/ml calf thymus DNA). Transcripts were precipitated with ethanol, resuspended in formamide sample buffer (80% [vol/vol] formamide, 8% [vol/vol] glycerol, 0.1% SDS, 8 mM EDTA, 0.01% bromophenol blue, and 0.01% xylene cyanol), and electrophoresed on 5% polyacrylamide gel containing 7 M urea.

Gel electrophoresis mobility shift assay. DNA-protein binding reactions were carried out at room temperature for 30 min in 25 µl buffer containing 0.1 mM DTT, 0.1 mM EDTA, 3 mM Mg(OAc)2, 50 mM NaCl, 50 mM Tris-HCl (pH 7.9), 25 µg/ml bovine serum albumin, 200 ng poly(dI/dC), 3 to 6 pmol RNA polymerase holoenzyme, and labeled DNA probe. For telomere DNA, the 205-bp EcoRI fragment containing the END167Sli sequence on pGEM-END167Sli was isolated and filled in with [{alpha}-32P]dATP by the Klenow enzyme. For the rrnD promoter, a 245-bp AccI-EcoRI fragment from pIJ2820 (6) was isolated and filled in with [{alpha}-32P]dATP by the Klenow enzyme. Electrophoresis was performed in 5% polyacrylamide gel in 0.5x Tris-borate-EDTA buffer.

Promoter activity assays in Streptomyces. To test the promoter activity on a circular plasmid, a 206-bp EcoRI fragment containing END167Sco from pGEM-END167Sco was inserted into the EcoRI site upstream of the promoterless neo gene on pIJ487 (43) in two orientations. The resulting plasmids, pIJ487-END167(+) and pIJ487-END167(–), were introduced into Streptomyces isolates by transformation. Expression of the neo gene was tested by streaking 100 µl of spore suspensions of the transformants on an LB plate containing a kanamycin gradient, followed by incubation at 30°C for 7 days. To test the promoter activity of the telomere DNA on a linear plasmid, the linear plasmid pLUS357L (see Fig. 6A) was constructed based on a mini-linear plasmid, pLUS968 (28), on which a 365-bp S. lividans telomere was replaced by the END167ScoDNA, and the melC operon was deleted and replaced by a synthetic linker. The luxAB operon (from pQM5065) was inserted into the linker to give rise to pLUS358L (see Fig. 6A). Spores of S. coelicolor M600 harboring these plasmids were inoculated in yeast extract-malt extract medium containing 5 µg/ml thiostrepton and shaken at 30°C. At a different time, aliquots of the culture were sampled for measurement of OD600 and luciferase activities. For the luciferase activity assay, 2 µl of n-decanal (Sigma) mixed with 200 µl of culture was incubated for 5 min at room temperature, and the luminance was determined in a luminometer (Wallac 1420 VICTOR2; PerkinElmer). The luminance of each sample was normalized by the mass (OD), and the ratio of the normalized luminance for the pLUS358L-containing culture to that for the pLUS357L-containing culture was calculated and reported as relative luciferase activity.


Figure 6
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 6. Promoter activity of END167Sco as a telomere of a linear plasmid in Streptomyces. (A) Reporter plasmids pLUS357L and pLUS358L. pLUS357L possesses END167Sco as the left telomere (black arrow) and a 365-bp right telomere (gray arrow) sequence of S. lividans, the thiostrepton resistance gene (tsr; open arrow), and the ARS of pSLA2 (containing four genes depicted by the black arrows). pLUS358L contains the luxAB operon (open arrows) inserted 55 bp downstream of END167Sco on pLUS357L. The TPs are represented by the filled circles. (B) Expression of luxAB from the telomere promoter. Spores of S. coelicolor M600 harboring pLUS357L (filled circles) and pLUS358L (open circles) were inoculated in yeast extract-malt extract medium containing 5 µg/ml thiostrepton and shaken at 30°C. At various times, aliquots were removed for measurement of OD600 (top) and relative luciferase activity (bottom).

Expression of the telomere promoter in E. coli. The lac promoter of the enhanced green fluorescent protein (EGFP) gene on pEGFP (BD Biosciences Clontech) was removed by digestion with PvuII and HincII and ligation to give pLUS887 (see Fig. 7). The END167Sli DNA was inserted into the SmaI site upstream of the promoterless EGFP gene on pLUS887 in both orientations to give pLUS888 and pLUS889 (see Fig. 7). These plasmids were introduced into E. coli DH5{alpha}, and fluorescence produced by the transformants growing in LB medium was observed under a fluorescence microscope.


Figure 7
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 7. Promoter activity of the telomere DNA in E. coli. (A) Expression vectors. pLUS887 contains a promoterless EGFP gene. pLUS888 and pLUS889 contain END167Sli (filled arrows) inserted upstream of EGFP in opposite orientations. The orientation of the filled arrow points from nt 1 to 167. rbs, ribosome binding site; ori, replication origin of E. coli plasmid ColE1; bla, β-lactamase gene. (B) In vivo promoter activity of END167Sli. E. coli transformants harboring the three plasmids were cultured in LB medium, and their fluorescence was photographed under a microscope. None was detected in the pLUS887 transformant.

Yeast transformation and β-galactosidase assay. The yeast one-hybrid system (BD Biosciences Clontech) was used for constructing the reporter and effector plasmids. The END167Sli DNA was removed from pGEM-END167Sli by digestion with SalI and XhoI and inserted between the SalI and XhoI sites of the yeast one-hybrid reporter vector pLacZi (BD Biosciences Clontech). The resulting plasmid, pLacZi-END167Sli, was linearized with NcoI (in the URA3 gene) and used to transform S. cerevisiae YM4271. Uracil prototrophic transformants were selected, and integration of pLacZi-END167Sli into the chromosome was confirmed by PCR analysis. β-Galactosidase activities were detected by the colony-lift filter assay.

Testing the promoter activity of END167Sli in human cell lines. Plasmids pEND(F)tkCAT and pEND(R)tkCAT are derivatives of pBLCAT5 (10) containing END167Sli DNA inserted (in opposite orientations) upstream of the thymidine kinase (TK) promoter, which drives transcription of the cat gene. pEND(F)CAT and pEND(R)CAT are derivatives of pBLCAT6 (10) containing END167Sli DNA inserted (in opposite orientations) in front of a promoterless cat gene. pG5END(F)CAT, pG5END(R)CAT, and pG5BLCAT6 are derivatives of pEND(F)tkCAT, pEND(R)tkCAT, and pG5BLCAT6 containing five copies of consensus GAL4 from pG5CAT (BD Biosciences Clontech). Plasmid DNA was introduced by transfection into HuH-7 and HeLa cell lines (grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum) by calcium phosphate coprecipitation, and 48 h after transfection, cells were harvested for CAT analysis (41). The concentration of plasmid DNA in the transfected cells was monitored by hybridization using a cat gene sequence as a probe after the removal of RNA by RNase treatment.


arrow
RESULTS
 
RNA polymerase binds S. lividans telomere DNA. In our initial attempt to isolate TBPs, we chose as the substrate the first 167 bp of the S. lividans chromosome spanning the first seven palindromes that are highly conserved among the archetypal telomeres of Streptomyces (Fig. 1A). This terminal sequence was designated END167Sli. Biotin-labeled END167Sli in the double-stranded form (DS167) and single-stranded forms (SS167w and SS167c) was prepared by PCR and purified using streptavidin-coated magnetic beads (Fig. 1B). These biotin-labeled DNA fragments were used for affinity purification of TBPs.

A crude extract from S. lividans ZX7 was incubated with the biotin-labeled DS167, SS167w, and SS167c DNA. The DNA-protein complexes were isolated using streptavidin-coated magnetic beads and separated by electrophoresis (Fig. 2, left). Four proteins of about 150 (two species), 100, and 40 kDa were eluted from the DS167 DNA. The 150- and 40-kDa proteins were also eluted from the SS167w and SS167c DNA. The addition of excess (50-fold by weight) salmon sperm DNA did not significantly alter the binding of these proteins, suggesting strong and specific interactions between them and the END167Sli DNA.


Figure 2
View larger version (40K):
[in this window]
[in a new window]

 
FIG. 2. Isolation of TBPs. Biotin-labeled double-stranded (DS167) and single-stranded (SS167w and SS167c) DNA fragments immobilized in a streptavidin column were used to purify binding proteins in crude extracts of S. lividans. The eluted proteins were separated by electrophoresis in SDS-polyacrylamide gel and silver stained (left). The sizes (in kDa) of the most abundant TBPs are indicated. The asterisk depicts nonspecific binding proteins that were also present in the flowthrough fractions. The region containing the β and β' subunits (bb') of RNA polymerase is enlarged in the insert on the left. The separated proteins were analyzed by immunoblots using anti-{alpha} (anti-a, middle) and anti-HrdB (right) antibody.

The two 150-kDa proteins and the 40-kDa proteins agreed with the profile of the core RNA polymerase β, β', and {alpha}2. The reaction of the 40-kDa polypeptide to anti-{alpha} antibody (Fig. 2, middle) supported this notion. To test whether sigma factors also accompanied the RNA polymerase core enzyme, antibodies against sigma B, sigma R, and the major housekeeping sigma factor HrdB (12) were used to react with the isolated TBPs. Sigma R was not detected in either the crude extract or the isolated TBP, while sigma B was seen in the crude extract but not in the isolated TBPs. Anti-HrdB antibody detected several strong signals in the crude extract as well as in the isolated TBPs (Fig. 2, right). These reacting polypeptides consisted of two major species plus several minor species, in the range of 55 to 80 kDa. The molecular weight of HrdB is 56 kDa. Some of the proteins that reacted to the anti-HrdB antibody may represent nonessential homologs of HrdB in S. coelicolor, HrdA, HrdC, and HrdD (12, 13).

To test the archetypal telomere from another species, biotin-labeled END167 DNA was prepared from the corresponding 167-bp terminal sequence of the S. coelicolor chromosome (92% identity; designated END167Sco). Binding using END167Sco DNA produced a similar binding protein profile from a crude extract of S. coelicolor. The major subunits of RNA polymerase (β, β', and {alpha}) were likewise detected. The availability of the genomic sequence of S. coelicolor allowed the identification of some of the TBPs by mass spectroscopy, such as Pol I (98.1 kDa, encoded by the gene SCO2003), BldD (18.1 kDa; SCO1489) and two hypothetical proteins, a 31-kDa AP endonuclease homolog encoded by SCO2111 and a 29-kDa exonuclease III homolog encoded by SCO6341. The possible biological roles of these proteins are being investigated.

The ca. 100-kDa protein bound to END167Sli corresponds to the 98.1-kDa Pol I bound to END167Sco. This protein, unlike the RNA polymerase, binds only to the double-stranded form and not the single-stranded forms (Fig. 2, left).

To confirm binding of RNA polymerase to the terminal DNA, gel electrophoresis mobility shift assays were performed with purified S. coelicolor RNA polymerase holoenzyme and END167Sli DNA in the presence of excess poly(dI/dC). The results (Fig. 3, left) showed a shift of mobility of the DNA on binding of RNA polymerase in the form of holoenzyme, core enzyme, or reconstituted holoenzyme (core plus HrdB; not shown). Similar molecular shifts were observed when the promoter of an rRNA operon was used (Fig. 3, right). These results confirmed the strong affinity of the RNA polymerase of Streptomyces to the telomere DNA in vitro.


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 3. Binding of RNA polymerase to telomere DNA. (Left) The gel mobility shift assay was performed between RNA polymerase holoenzyme (Holo) or core enzyme (Core) and 32P-labeled telomere DNA (205-bp EcoRI fragment containing END167Sli) in the presence of excess poly(dI/dC). (Right) For a comparison, the 245-bp 32P- labeled AccI-EcoRI fragment containing the rrnD promoter of S. coelicolor was used in place of the telomere DNA. The amount of enzyme added is shown above (in nanomoles). The asterisk indicates an addition of 10-fold nonradioactive DNA probe.

The telomere DNA exhibits strong promoter activity in vitro. The strong binding of RNA polymerase holoenzyme to END167Sli suggested that END167Sli might contain promoter activity. In an in vitro transcription assay using the DS167 DNA and purified RNA polymerase holoenzyme, two major transcripts (~100 and ~130 nt) were produced (Fig. 4, left). Interestingly, these in vitro promoter activities of the telomere DNA appeared to be significantly stronger than the three Streptomyces rRNA promoters (p2, p3, and p4) (Fig. 4, right). Multiple transcripts were detected from END167Sli, probably resulting from different start sites and/or different directions of transcription.


Figure 4
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 4. Promoter activity of END167Sli in vitro. Transcription assays were performed in vitro with 3 or 6 pmol (number of purified RNA polymerase holoenzyme from S. coelicolor). DNA fragments containing the END167Sli and rrnD promoters were used as templates. The transcripts were analyzed by autoradiography after separation on a 7 M urea-5% polyacrylamide gel. Lane M, RNA size markers; lane 3, 3-pmol RNA polymerase; lane 6, 6-pmol RNA polymerase. The numbers on the side depict the size of the RNA (in nucleotides). Transcripts from the rrnD p2, p3, and p4 promoters are indicated.

The telomere DNA acts as a promoter in Streptomyces. S. coelicolor and S. lividans are very closely related. Their telomere sequences are more than 90% identical, and their capping TPs (TpgSco and TpgSli) are 100% identical (4, 45). Subsequent in vivo studies were performed primarily using the telomere DNA (END167Sco) of the S. coelicolor chromosome, the complete sequence of which is available (8). To test the promoter activity in vivo, the END167Sco DNA was inserted upstream of a neo (kanamycin resistance) reporter gene on pIJ487 (43) in two orientations (Fig. 5A). The resulting recombinant plasmids were introduced into S. coelicolor M145 and 3456 (44). Regardless of the orientation of the inserts, all the transformants exhibited elevated resistance to kanamycin compared to the control transformants containing pIJ487 (Fig. 5B). These results indicated that the telomere promoter was active in vivo on the circular plasmids. Identical results were obtained in S. lividans (wild-type 1326 containing linear plasmid SLP2 and a plasmidless derivative, TK64) (Fig. 5B).


Figure 5
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 5. Promoter activity of END167Sco on a circular plasmid in Streptomyces. (A) The expression vector. pIJ487-END167(+) and pIJ487-END167(–) contain the END167Sco DNA inserted at the EcoRI (RI) site of pIJ487, upstream of the promoterless neo gene in two orientations (+ and –). The arrows indicate the orientation of END167Sco from nt 1 to 167. ter, phage fd transcription terminator. (B) Detection of promoter activity. Spores of S. lividans and S. coelicolor harboring pIJ487 (V), pIJ487-END167(+) (+) and pIJ487-END167(–) (–) were streaked and cultured on LB medium containing a kanamycin gradient.

To test possible promoter activity of the END167Sco DNA as a telomere of a linear replicon, a recombinant linear plasmid, pLUS358L, was constructed, in which END167Sco served as a telomere and a promoterless luciferase operon (luxAB) (1) was inserted 55 bp downstream from END167Sco (Fig. 6A). S. coelicolor M600 harboring pLUS358L was cultured in liquid medium containing thiostrepton, and the expression of luciferase was monitored during growth (Fig. 6B). Luciferase activity was detected during the exponential phase and diminished toward the stationary phase. This indicated that the END167Sco sequence acting as a telomere of a linear replicon could also function as a promoter in vivo during active growth.

The telomere DNA acts as a promoter in E. coli. END167Sli was also tested for in vivo promoter activity in E. coli. END167Sli was placed upstream in both orientations from the promoterless EGFP gene on pEGFP plasmid to give rise to pLUS888 and pLUS889, respectively (Fig. 7). Ampicillin-resistant E. coli transformants of the two plasmids were selected and inspected under a fluorescence microscope. Both groups of transformants emitted bright green fluorescence (Fig. 7), indicating that END167Sli also acted as a promoter in E. coli in either orientation.

The telomere DNA enhances transcription in yeast. In a separate attempt to isolate TBP, we set up a yeast one-hybrid system to screen a Streptomyces genomic library. END167Sli DNA was inserted upstream of the basal promoter pCyc1 of the lacZ reporter gene on pLacZi (Fig. 8). The resulting plasmid, pLacZi-END167, was introduced into S. cerevisiae YM4271 by transformation. Positive transformants were isolated, and integration of the plasmid into the chromosome was confirmed by PCR analysis (data not shown). Surprisingly, the transformants exhibited strong β-galactosidase activity by themselves (Fig. 8). In contrast, YM4271 containing pLacZi expressed only a low level of background β-galactosidase activity.


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 8. Enhancer activity of END167Sli in yeast. pLacZi, pLacZi-END167 (with END167Sli inserted upstream of the pCyc1 promoter), and pLacZi-END167{Delta}pCyc1 (with pCyc1 replaced by a linker sequence) were introduced into S. cerevisiae YM4271, and the expression of lacZ in the transformants was assayed by colony lift assay (right). The N terminus of lacZ and its upstream elements on these plasmids are illustrated. The arrows indicate the orientations of END167Sli (from nt 1 to 167) and lacZ (direction of transcription). MCS, multiple cloning site. Restriction sites are abbreviated as follows: Sa, SalI; Xh, XhoI; and Ba, BamHI.

On pLacZi-END167, END167Sli could have acted as either a promoter or an enhancer. To distinguish these two possibilities, a 20-bp adapter sequence was used to replace the pCyc1 promoter. Transformants of this construct, pLacZi-END167{Delta}pCyc1, lost the ability to express β-galactosidase (Fig. 6). These results indicated that the pCyc1 promoter is required for transcription of the lacZ gene on pLacZi-END167 in yeast, and END167Sli probably serves as a cis-acting element that activates transcription in the absence of activator proteins.

The telomere DNA does not enhance transcription in human cells. To explore whether END167Sli could also function as a transcription promoter or enhancer in mammalian cells, END167Sli was inserted in both orientations upstream of a promoterless cat (chloramphenicol acetyltransferase) reporter gene on pBLCAT6 (10) to produce pEND(F)CAT and pEND(R)CAT. These two plasmids were used to transfect HuH-7, a well-differentiated human hepatoma cell line established from a primary hepatocellular carcinoma (36). Transient expression of chloramphenicol acetyltransferase activity in the transfected cells was as low as that in cells transfected by pBLCAT6. To increase the sensitivity, an activator-binding DNA consisting of five copies of the GAL4 binding consensus sequence was placed upstream of END167Sli on pEND(F)CAT and pEND(R)CAT to give pG5END(F)CAT and pG5END(R)CAT, respectively. Cotransfection of HuH-7 with these plasmids and pM3-VP16 (BD Biosciences Clontech) expressing a GALBDVP16 activator (a fusion protein of the GAL4 DNA binding domain and the VP16 activation domain) increased the expression level of CAT, but not to a level significantly higher than that after cotransfection with pBLCAT6 containing the activator-binding DNA, i.e., pG5BLCAT6 and pM3-VP16.

To explore whether END167Sli might function as an enhancer, END167Sli DNA was inserted in both orientations upstream of the TK promoter of pBLCAT5 (10), and the resulting plasmids, pEND(F)tkCAT and pEND(R)tkCAT, were introduced into HuH-7 and HeLa cell lines. No increase in CAT activity was observed in the transfected cells compared to those transfected by pBLCAT5. Thus, the Streptomyces telomere sequence could not function as a promoter or enhancer in human cells.


arrow
DISCUSSION
 
The discovery of RNA polymerase-binding and promoter activities of the S. lividans and S. coelicolor telomeres was unexpected. These two telomeres are more than 92% identical to each other in the END167 sequences that span the first seven palindromes. In fact, these seven palindromic sequences are also highly conserved among the telomeres of most Streptomyces chromosomes and many linear plasmids (27). Thus, it is likely that these archetypal telomere sequences possess a promoter function.

The END167 sequences contain high G+C contents (approximately 70%) and lack typical –35 and –10 RNA polymerase binding sequences or sequences similar to other known Streptomyces promoters. It is possible that, under negative superhelicity, the palindromic sequences in this stretch of DNA undergo a transition to form hairpin loops, which provide a ready access for RNA polymerase. While negative superhelicity is intrinsic to circular plasmids in vivo, it may also be found in TP-capped linear plasmids with interacting telomeres (H.-H. Tsai et al., unpublished data). The hairpins formed by the END167 sequences contain mainly GCA (3' strands) and TGC (5' strands) loops. The GCA loops are proposed to be closed by highly stable G·A sheared pairing, resulting in a single nucleotide (C) loop that is resistant to single-strand-specific nucleases (18, 27).

Promoter activity of hairpinned DNA has been previously documented. For example, Glucksmann et al. (21) and Glucksmann-Kuis et al. ( 22) described novel promoters of N4 phage that function efficiently in the single-stranded but not double-stranded form. These promoter sequences contain a palindrome, which extrudes from the double helix at physiological superhelical densities (19) and forms hairpins with a PyGGAPu or PyGAAPu loop (Fig. 1A, inset). The PyGGAPu loop has been found to be closed by G·A sheared pairing (25). The hairpin extrusion is necessary for promoter activity. Both the 3-base loop and a 5- to 7-bp stem are required for recognition by the phage RNA polymerase.

A different type of single-stranded DNA promoter (designated Frpo) was described by Masai and Arai (35) in the leading region of the F plasmid. This promoter is formed as a 329-bp secondary structure containing mispaired regions and a loop and is transcribed by the major RNA polymerase (containing {sigma}70) of E. coli. Similar promoters are also found in the leading region of plasmid ColIb-P9 (5). Interestingly, the predicted secondary structures of these promoters (5, 21) contain many G·A "mismatches" in the "bulges," which may potentially form sheared pairing (as in the Streptomyces telomeres) (Fig. 1B), thereby significantly reducing the numbers and sizes of single-stranded bulges and loops.

It is likely that the Streptomyces telomere promoters are active in the form of hairpin loops (Fig. 1A). The predominant hairpins with the PyGNAPu (N mostly C) loops closed by the G·A sheared pairing found in S. lividans and S. coelicolor are similar to those in the phage N4 genome. On the other hand, the complexity of the secondary structures formed by the Streptomyces promoters is more similar to that of Frpo. Both contain bulges formed by mispaired purines, which have been shown in nuclear magnetic resonance studies to form a stable duplex structure through purine-purine sheared pairings (18).

Frpo is transcribed by the major RNA polymerase in E. coli. Our in vitro results show that END167 is efficiently transcribed by the major RNA polymerase of Streptomyces containing the HrdB ({sigma}70 ortholog) sigma factor (12). It is likely that it is also transcribed by the same holoenzyme in vivo.

Fpro is located in the leading region of conjugal transfer on the F plasmid, and the RNA chain transcribed from this promoter serves for priming DNA replication during conjugation (35). In this regard, the telomeres of Streptomyces have been proposed to be the origins of conjugal transfer (17). It is tempting to speculate that the promoter activity at the telomeres is also involved in priming conjugal transfer. In this case, the plasmid would not be transferred in total, and the missing leading telomere sequence would have to be restored using the other (trailing) telomere of the plasmid (or the chromosome) as a template for recombination and synthesis. Such restoration of damaged telomeres on linear Streptomyces plasmids has been described by Qin and Cohen (37).

Alternatively, the telomere promoter may be involved in synthesis of the primer for the terminal Okazaki fragment during replication. The single-stranded gaps at the 3' ends resulting from bidirectional replication from an internal origin were about 280 nt long for the plasmid pSLA2 (16) and from 250 to 300 nt long for three other linear replicons of Streptomyces spp. (C.-H. Huang, unpublished). Thus, the terminal Okazaki fragment is expected to be primed by an RNA transcribed within the telomere region. The promoter in END167 may be involved in synthesizing this primer.

A third possibility is that the telomere promoter may be involved in transcription of a downstream gene. A unique helicase gene, ttrA, involved in conjugal transfer of linear chromosomes and plasmids (28), is located in the terminal regions of the following four Streptomyces chromosomes: 1.6 kb from both ends in S. lividans (9), 1.7 kb from both ends in Streptomyces scabies (sequence data produced by the Sanger Institute and obtained from ftp://ftp.sanger.ac.uk/pub/pathogens/ssc/), 1.3 kb from both ends in S. coelicolor (8), and 4.9 and 1.9 kb from the left and right ends, respectively, in S. avermitilis (29). These ttrA orthologs are highly conserved in sequence, size, and direction of transcription (inward from the telomere), in sharp contrast to the surrounding nonconserved open reading frames in the terminal regions. It is possible that the telomere promoter controls the transcription of this strategically located ttrA gene. In this regard, the three Frpo-homologous promoters in the leading region of plasmid ColIb-P9 are supposed to be involved in the transcription of several genes downstream, including an antirestriction gene (ardA) during conjugal transfer (5). The transcription of ardA from a single-stranded promoter is of great strategic importance so as to inactivate the host restriction system before the incoming DNA strand is converted to a sensitive double-stranded form. In this regard, the TtrA sequences contain, in addition to helicase motifs, a short region of homology to some type I restriction enzymes and a long region of homology to some type III restriction enzymes.

In all, there are three plausible roles for the telomere promoter: (i) priming of the terminal Okazaki fragment, (ii) priming of DNA replication during conjugation, and (iii) transcription of the downstream gene(s). These functions may not be mutually exclusive, and it is possible that the promoter is activated when the telomere enters the single-stranded state during each round of replication in a cell cycle-dependent manner or during conjugal transfer. This may account for the observed sharp increase of the telomere promoter activity on a linear plasmid (Fig. 6) during the log phase of the liquid growth. Further investigation is required for clarification.

The observed in vivo promoter activity of END167Sli in E. coli may also involve the formation of hairpin structures (under the negative superhelicity of the circular plasmid) in view of the approximately equal activities in both orientations and the absence from ENDSli (and END167Sco) of –35 or –10 motifs typical of E. coli promoters (24, 34). This raises the possibility that the telomere promoters of Streptomyces may also function in many other bacteria and consequently may be useful for construction of universal genetic markers on shuttle vehicles for these bacteria.

In contrast, the END167Sli sequence does not function as a promoter in yeast. It merely eliminates the need of an activator for initiation at the pCyc-1 promoter. It is possible that the palindromes in this sequence also form hairpin structures under a negative superhelical strain, thus facilitating the opening up of the downstream promoter. The inability of the same DNA sequence to provide an activating function in mammalian cells is probably because of the more complex regulation of gene transcription in higher eukaryotes. Transcription initiation is directed by various types of core promoters and their interaction with specific activators and enhancers (11, 42), and the END167Sli sequence, even if it contains a promoter or an activation or enhancer element, must be present in the appropriate genetic as well as epigenetic contexts to direct transcription of the reporter genes.


arrow
ACKNOWLEDGMENTS
 
We thank David A. Hopwood for critical reading of the manuscript and suggestions for improvement and Paul R. Herron for the gift of plasmid pQM5065.

This study was funded by research grants from National Science Council (ROC) to C.W.C. (NSC94-2321-B010-005 and NSC95-2321-B010-002) and to T.-S.S. (NSC95-2320-B-075-010).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Shih-Pai, Taipei 112, Taiwan. Phone: 886-2-2826-7040. Fax: 886-2-2826-4930. E-mail: cwchen{at}ym.edu.tw Back

{triangledown} Published ahead of print on 5 December 2008. Back

§ Present address: Department of Molecular Biology and Biochemistry, Waksman Institute of Microbiology, Rutgers, The State University of New Jersey, Piscataway, NJ 08854. Back

# Present address: Genome Research Center for Respiratory Pathogens, Yonsei University College of Medicine, Seoul 120-752, South Korea. Back


arrow
REFERENCES
 
    1
  1. Ali, N., P. R. Herron, M. C. Evans, and P. J. Dyson. 2002. Osmotic regulation of the Streptomyces lividans thiostrepton-inducible promoter, ptipA. Microbiology 148:381-390.[Abstract/Free Full Text]
  2. 2
  3. Bao, K., and S. N. Cohen. 2003. Recruitment of terminal protein to the ends of Streptomyces linear plasmids and chromosomes by a novel telomere-binding protein essential for linear DNA replication. Genes Dev. 17:774-785.[Abstract/Free Full Text]
  4. 3
  5. Bao, K., and S. N. Cohen. 2004. Reverse transcriptase activity innate to DNA polymerase I and DNA topoisomerase I proteins of Streptomyces telomere complex. Proc. Natl. Acad. Sci. USA 101:14361-14366.[Abstract/Free Full Text]
  6. 4
  7. Bao, K., and S. N. Cohen. 2001. Terminal proteins essential for the replication of linear plasmids and chromosomes in Streptomyces. Genes Dev. 15:1518-1527.[Abstract/Free Full Text]
  8. 5
  9. Bates, S., R. A. Roscoe, N. J. Althorpe, W. J. Brammar, and B. M. Wilkins. 1999. Expression of leading region genes on IncI1 plasmid ColIb-P9: genetic evidence for single-stranded DNA transcription. Microbiology 145:2655-2662.[Abstract/Free Full Text]
  10. 6
  11. Baylis, H. A., and M. J. Bibb. 1988. Transcriptional analysis of the 16S rRNA gene of the rrnD gene set of Streptomyces coelicolor A3(2). Mol. Microbiol. 2:569-579.[CrossRef][Medline]
  12. 7
  13. Bentley, S. D., S. Brown, L. D. Murphy, D. E. Harris, M. A. Quail, J. Parkhill, B. G. Barrell, J. R. McCormick, R. I. Santamaria, R. Losick, M. Yamasaki, H. Kinashi, C. W. Chen, G. Chandra, D. Jakimowicz, H. M. Kieser, T. Kieser, and K. F. Chater. 2004. SCP1, a 356,023 base pair linear plasmid adapted to the ecology and developmental biology of its host, Streptomyces coelicolor A3(2). Mol. Microbiol. 51:1615-1628.[CrossRef][Medline]
  14. 8
  15. Bentley, S. D., K. F. Chater, A.-M. Cerdeño-Tárraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147.[CrossRef][Medline]
  16. 9
  17. Bey, S. J., M. F. Tsou, C. H. Huang, C. C. Yang, and C. W. Chen. 2000. The homologous terminal sequence of the Streptomyces lividans chromosome and SLP2 plasmid. Microbiology 146:911-922.[Abstract/Free Full Text]
  18. 10
  19. Boshart, M., M. Kluppel, A. Schmidt, G. Schutz, and B. Luckow. 1992. Reporter constructs with low background activity utilizing the cat gene. Gene 110:129-130.[CrossRef][Medline]
  20. 11
  21. Butler, J. E., and J. T. Kadonaga. 2002. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16:2583-2592.[Free Full Text]
  22. 12
  23. Buttner, M. J., K. F. Chater, and M. J. Bibb. 1990. Cloning, disruption, and transcriptional analysis of three RNA polymerase sigma factor genes of Streptomyces coelicolor A3(2). J. Bacteriol. 172:3367-3378.[Abstract/Free Full Text]
  24. 13
  25. Buttner, M. J., and C. G. Lewis. 1992. Construction and characterization of Streptomyces coelicolor A3(2) mutants that are multiply deficient in the nonessential hrd-encoded RNA polymerase sigma factors. J. Bacteriol. 174:5165-5167.[Abstract/Free Full Text]
  26. 14
  27. Buttner, M. J., A. M. Smith, and M. J. Bibb. 1988. At least three different RNA polymerase holoenzymes direct transcription of the agarase gene (dagA) of Streptomyces coelicolor A3(2). Cell 52:599-607.[CrossRef][Medline]
  28. 15
  29. Chaconas, G., and C. W. Chen. 2005. Linear chromosomes in bacteria: no longer going around in circles, p. 525-539. In N. P. Higgins (ed.), The bacterial chromosome. American Society for Microbiology, Washington, DC.
  30. 16
  31. Chang, P. C., and S. N. Cohen. 1994. Bidirectional replication from an internal origin in a linear Streptomyces plasmid. Science 265:952-954.[Abstract/Free Full Text]
  32. 17
  33. Chen, C. W. 1996. Complications and implications of linear bacterial chromosomes. Trends Genet. 12:192-196.[CrossRef][Medline]
  34. 18
  35. Chou, S.-H., L. Zhu, and B. R. Reid. 1997. Sheared purine-purine pairing in biology. J. Mol. Biol. 267:1055-1067.[CrossRef][Medline]
  36. 19
  37. Dai, X., M. B. Greizerstein, K. Nadas-Chinni, and L. B. Rothman-Denes. 1997. Supercoil-induced extrusion of a regulatory DNA hairpin. Proc. Natl. Acad. Sci. USA 94:2174-2179.[Abstract/Free Full Text]
  38. 20
  39. Fujita, N., T. Nomura, and A. Ishihama. 1987. Promoter selectivity of Escherichia coli RNA polymerase. Purification and properties of holoenzyme containing the heat-shock sigma subunit. J. Biol. Chem. 262:1855-1859.[Abstract/Free Full Text]
  40. 21
  41. Glucksmann, M. A., C. Malone, P. Markiewicz, and L. B. Rothman-Denes. 1992. Specific sequences and a hairpin structure in the template strand are required for N4 virion RNA polymerase promoter recognition. Cell 70:491-500.[CrossRef][Medline]
  42. 22
  43. Glucksmann-Kuis, M. A., X. Dai, P. Markiewicz, and L. B. Rothman-Denes. 1996. E. coli SSB activates N4 virion RNA polymerase promoters by stabilizing a DNA hairpin required for promoter recognition. Cell 84:147-154.[CrossRef][Medline]
  44. 23
  45. Goshi, K., T. Uchida, A. Lezhava, M. Yamasaki, K. Hiratsu, H. Shinkawa, and H. Kinashi. 2002. Cloning and analysis of the telomere and terminal inverted repeat of the linear chromosome of Streptomyces griseus. J. Bacteriol. 184:3411-3415.[Abstract/Free Full Text]
  46. 24
  47. Hawley, D., and W. McClure. 1983. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255.[Abstract/Free Full Text]
  48. 25
  49. Hirao, I., G. Kawai, S. Oshizawa, Y. Nishimura, Y. Ishido, K. Watanabe, and K.-I. Miura. 1994. Most compact hairpin-turn structure exerted by a short DNA fragment, d(GCGAAGC), in solution: an extraordinarily stable structure resistant to nucleases and heat. Nucleic Acids Res. 22:576-582.[Abstract/Free Full Text]
  50. 26
  51. Hopwood, D. A., T. Kieser, H. M. Wright, and M. J. Bibb. 1983. Plasmids, recombination, and chromosomal mapping in Streptomyces lividans 66. J. Gen. Microbiol. 129:2257-2269.[Abstract/Free Full Text]
  52. 27
  53. Huang, C.-H., Y.-S. Lin, Y.-L. Yang, S.-W. Huang, and C. W. Chen. 1998. The telomeres of Streptomyces chromosomes contain conserved palindromic sequences with potential to form complex secondary structures. Mol. Microbiol. 28:905-926.[CrossRef][Medline]
  54. 28
  55. Huang, C.-H., C.-Y. Chen, H.-H. Tsai, C. Chen, Y.-S. Lin, and C. W. Chen. 2003. Linear plasmid SLP2 of Streptomyces lividans is a composite replicon. Mol. Microbiol. 47:1563-1576.[CrossRef][Medline]
  56. 29
  57. Ikeda, H., J. Ishikawa, A. Hanamoto, M. Shinose, H. Kikuchi, T. Shiba, Y. Sakaki, M. Hattori, and S. Omura. 2003. Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Nat. Biotechnol. 21:526-531.[CrossRef][Medline]
  58. 30
  59. Kang, J. G., M. Y. Hahn, A. Ishihama, and J. H. Roe. 1997. Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerases from Streptomyces coelicolor A3(2). Nucleic Acids Res. 25:2566-2573.[Abstract/Free Full Text]
  60. 31
  61. Kieser, T., M. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich, United Kingdom.
  62. 32
  63. Kinashi, H., M. Shimaji-Murayama, and T. Hanafusa. 1991. Nucleotide sequence analysis of the unusually long terminal inverted repeats of a giant linear plasmid, SCP1. Plasmid 26:123-130.[CrossRef][Medline]
  64. 33
  65. Lin, Y.-S., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The chromosomal DNA of Streptomyces lividans 66 is linear. Mol. Microbiol. 10:923-933.[Medline]
  66. 34
  67. Lisser, S., and H. Margalit. 1993. Compilation of E. coli mRNA promoter sequences. Nucleic Acids Res. 21:1507-1516.[Abstract/Free Full Text]
  68. 35
  69. Masai, H., and K. Arai. 1997. Frpo: a novel single-stranded DNA promoter for transcription and for primer RNA synthesis of DNA replication. Cell 89:897-907.[CrossRef][Medline]
  70. 36
  71. Nakabayashi, H., K. Taketa, K. Miyano, T. Yamane, and J. Sato. 1982. Growth of human hepatoma cells lines with differentiated functions in chemically defined medium. Cancer Res. 42:3858-3863.[Abstract/Free Full Text]
  72. 37
  73. Qin, Z., and S. N. Cohen. 2002. Survival mechanisms for Streptomyces linear replicons after telomere damage. Mol. Microbiol. 45:785-794.[CrossRef][Medline]
  74. 38
  75. Sakaguchi, K. 1990. Invertrons, a class of structurally and functionally related genetic elements that include linear plasmids, transposable elements, and genomes of adeno-type viruses. Microbiol. Rev. 54:66-74.[Abstract/Free Full Text]
  76. 39
  77. Salas, M. 1991. Protein-primed DNA replication. Annu. Rev. Biochem. 60:37-91.
  78. 40
  79. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  80. 41
  81. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  82. 42
  83. Smale, S. T. 2001. Core promoters: active contributors to combinatorial gene regulation. Genes Dev. 15:2503-2508.[Free Full Text]
  84. 43
  85. Ward, J. M., G. R. Janssen, T. Kieser, M. J. Bibb, M. J. Buttner, and M. J. Bibb. 1986. Construction and characterization of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase gene from Tn5 as indicator. Mol. Gen. Genet. 203:468-478.[CrossRef][Medline]
  86. 44
  87. Weaver, D., N. Karoonuthaisiri, H. H. Tsai, C. H. Huang, M. L. Ho, S. Gai, K. G. Patel, J. Huang, S. N. Cohen, D. A. Hopwood, C. W. Chen, and C. M. Kao. 2004. Genome plasticity in Streptomyces: identification of 1 Mb TIRs in the S. coelicolor A3(2) chromosome. Mol. Microbiol. 51:1530-1550.
  88. 45
  89. Yang, C.-C., C.-H. Huang, C.-Y. Li, Y.-G. Tsay, S.-C. Lee, and C. W. Chen. 2002. The terminal proteins of linear Streptomyces chromosomes and plasmids: a novel class of replication priming proteins. Mol. Microbiol. 43:297-305.[CrossRef][Medline]
  90. 46
  91. Yang, C.-C., Y.-H. Chen, H.-H. Tsai, C.-H. Huang, T.-W. Huang, and C. W. Chen. 2006. In vitro deoxynucleotidylation of the terminal protein of Streptomyces linear chromosomes. Appl. Environ. Microbiol. 72:7959-7961.[Abstract/Free Full Text]
  92. 47
  93. Zhang, R., Y. Yang, P. Fang, C. Jiang, L. Xu, Y. Zhu, M. Shen, H. Xia, J. Zhao, T. Chen, and Z. Qin. 2006. Diversity of telomere palindromic sequences and replication genes among Streptomyces linear plasmids. Appl. Environ. Microbiol. 72:5728-5733.[Abstract/Free Full Text]
  94. 48
  95. Zhou, X., Z. Deng, J. L. Firmin, D. A. Hopwood, and T. Kieser. 1988. Site-specific degradation of Streptomyces lividans DNA during electrophoresis in buffers contaminated with ferrous iron. Nucleic Acids Res. 16:4341-4354.[Abstract/Free Full Text]


Journal of Bacteriology, February 2009, p. 773-781, Vol. 191, No. 3
0021-9193/09/$08.00+0     doi:10.1128/JB.01299-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, Y.-r.
Right arrow Articles by Chen, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, Y.-r.
Right arrow Articles by Chen, C. W.