Previous Article | Next Article ![]()
Journal of Bacteriology, March 2009, p. 1498-1508, Vol. 191, No. 5
0021-9193/09/$08.00+0 doi:10.1128/JB.01177-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
,
Changhan Lee,1 and
Kelly T. Hughes2*
Department of Microbiology, University of Washington, Seattle, Washington 98195,1 Department of Biology, University of Utah, Salt Lake City, Utah 841122
Received 20 August 2008/ Accepted 15 December 2008
|
|
|---|
28 factor gene flgM. When expressed from the chromosomal ParaBAD promoter, EcnR, FimZ, PefI-SrgD, and RcsB inhibited the transcription of the flagellar class 1 flhDC operon. YdiV, which is weakly homologous to EAL domain proteins involved in cyclic-di-GMP regulation, appears to act at a step after class 1 transcription. By using a series of deletions of the regulatory genes to try to disrupt each pathway, these regulators were found to act largely independently of one another. These results identify EcnR and PefI-SrgD as additional components of the complex regulatory network controlling flagellar expression. |
|
|---|
The approximately five dozen genes involved in flagellar synthesis and chemotaxis in Salmonella enterica serovar Typhimurium are organized into a transcriptional hierarchy of three classes. At the top of the hierarchy is the class 1 promoter. The class 1 promoter is thought to integrate many different signals in the decision on when to express flagellar genes. In Salmonella, the class 1 promoter contains at least six transcriptional start sites (61) and expresses the flhDC genes, which encode the FlhD4C2 activator complex (34, 58). The FlhD4C2 activator complex directs
70 and RNA polymerase to initiate transcription at class 2 promoters. Gene products expressed from the class 2 promoters are used to build the basal body, which is the motor structure that spans the membranes and peptidoglycan and consists of the rotor, the rod, bushings, and the flagellar secretion system. Class 2 gene products are also used to assemble the flexible, extracellular rod-filament linker called the hook. A class 2 promoter transcribes the gene for the flagellar sigma factor
28, which activates transcription from class 3 promoters. Class 3 promoters transcribe the genes for the filament subunits, motor force generators, and chemosensory system (6).
In Salmonella, a number of nonflagellar proteins are known to affect flagellar synthesis. These regulators include eight proteins that contain DNA-binding domains. One is the cyclic AMP-catabolite gene activator protein (CAP) complex that activates flhDC transcription (27, 28, 30, 62). CAP binds DNA when cyclic AMP levels are high during growth under nutrient-limiting conditions. In Escherichia coli, DNA footprinting demonstrated previously that CAP binds to a specific site within the flhDC promoter region (49). A second regulator of flagellar transcription is RcsB, which is the response regulator component of the phosphotransfer relay system that controls capsule synthesis (5, 11). The RcsCDB system responds to multiple external stimuli, including high osmolarity, desiccation, and low temperature with high zinc concentrations (36). RcsB binds to a specific site termed the RcsAB box within the class 1 promoter region to inhibit motility (57). A third DNA-binding protein that affects motility is FimZ. FimZ is a response regulator that activates type 1 fimbrial genes. Type 1 fimbriae are utilized for surface adhesion, but it is not known to what signals FimZ responds. FimZ inhibits motility at the level of class 1 transcription (7). The iron-regulatory protein Fur and the nucleoid proteins Fis and H-NS activate flagellar transcription (4, 25, 28). It has been demonstrated previously for Fis in Salmonella and for Fur and H-NS in E. coli that these regulators can bind directly to the flhDC promoter (25, 49, 51). Finally, SlyA and RtsB are pathogenesis-related DNA-binding proteins that affect motility or flagellar expression (13, 50). SlyA promotes the expression of the filament subunits (50), and RtsB binds to and inhibits the class 1 flagellar promoter (13).
Proteins that do not contain DNA-binding domains also regulate motility in Salmonella and tend to affect steps after class 1 transcription. CsrA is an RNA-binding protein involved in carbon storage regulation that stabilizes the flhDC transcript in E. coli (59) and is important for motility in Salmonella (32). DnaK is a heat shock response chaperone that directly interacts with FlhD4C2 to promote the formation of active FlhD4C2 complexes (52). ClpXP is a protease that is also induced by the heat shock response but inhibits motility by degrading FlhD4C2 (9, 54, 55). Proteins that adjust the levels of or respond to the global signaling molecule cyclic-di-GMP (c-di-GMP) also affect motility. The GGDEF domain protein AdrA increases c-di-GMP levels, reduces motility, and promotes biofilm formation (47). The EAL domain proteins YhjH and STM1827 decrease c-di-GMP levels, increase motility, and inhibit biofilm formation (45-47). The YcgR protein inhibits motility and contains a PilZ domain that binds c-di-GMP (46). In E. coli, these c-di-GMP-related proteins have been shown to promote the assembly of the motor force generator proteins and alter the directional bias of flagellar rotation (19, 26).
Because flagella can be an advantage or a handicap depending on the situation, it is not surprising that flagellar synthesis is regulated in response to many different signals. However, the more than a dozen proteins described above may not constitute the entire regulatory network in Salmonella. A genetic approach was utilized in this study to search for additional regulators of flagellar synthesis. The T-POP transposon, which contains an inducible promoter, was allowed to transpose to random locations throughout the Salmonella genome. Depending on the orientation of the transposon, the inducible promoter could initiate the transcription of adjacent genes or produce antisense RNA to inhibit translation. This transposon was used to screen for genes that either inducibly activated or inhibited the transcription of the filament subunit gene fliC. In addition to insertions that directly controlled known regulators of flagellar transcription, two new loci were found to inhibit flagellar synthesis when overexpressed. Deletions in and lac fusions to these negative regulator genes were used to organize the corresponding proteins into pathways. These additional regulators provide further insight into when and how flagellar synthesis is controlled.
|
|
|---|
red recombination were performed using plasmid pKD46 as described previously (60). MES (morpholineethanesulfonic acid) buffer (100 mM) was used in acidic motility plates to maintain the pH near 5.1 (39). A position-specific score matrix algorithm was used to search intergenic regions with the consensus sequences for
28 and FlhD4C2, as described in an earlier study (60). |
View this table: [in a new window] |
TABLE 1. Salmonella strains used in this study
|
25] transposon inserted downstream from a Mud-P22 insertion in an F plasmid. Because an induced Mud-P22 packages primarily adjacent chromosomal DNA, 10 to 50% of the phage particles should carry the T-POP DNA sequence (33). The screen was undertaken by undergraduate students, graduate students, and postdoctoral fellows in a number of genetics classes. We roughly estimate that a half million transposon insertions were screened for inducible expression of the fliC-lac transcriptional fusion. Arbitrary PCR and sequencing were used to identify individual T-POP insertions (33). Many of the insertions that showed linkage to markers near fimZ, rcsB, and ydiV by P22 transduction were not considered further.
Isolation of MudJ insertions. Transposon insertions of the MudJ transcriptional reporter were isolated near the PecnR::T-POP insertion in strain TH9291, the feoB::T-POP insertion in strain TH9293, the PpefI::T-POP insertion in strain TH8774, and the rcsD::T-POP insertion in strain TH8758. Random MudJ insertions were generated (22), and between 24,000 and 90,000 colonies were pooled for each strain. Phage stocks were prepared on the pooled colonies. A wild-type strain (TH437) was transduced with these pools of random insertions, and the cells were spread onto LB-Tet-kanamycin (Kan)-EGTA plates to select for transductions that had brought in the T-POP insertion (by selecting for Tetr) and nearby MudJ insertions (by selecting for MudJ-encoded Kanr). To screen for MudJ lac fusions under the control of the tetA promoter in the T-POP, transductants were patched onto lactose indicator medium (LB-X-Gal [5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside], MacConkey agar-lactose [Mac-Lac], or triphenyl tetrazolium chloride-lactose) containing either chlortetracycline or no inducer. To screen for MudJ insertions that blocked the inhibition of motility, transductants were poked into Tet-Kan-EGTA motility plates. The locations of insertions linked to ecnR, pefI-srgD, and rcsB were determined by PCR and sequencing.
For feoB, transposons were checked for linkage to the feoB::T-POP insertion regardless of the strains' motility or their Lac phenotypes. The left ends of linked MudJ insertions were identified using arbitrary PCR and sequencing as described previously (33), except that primer Mud-R3 (AGCAATTTTTTACTATCTTTCGCG) was used for the primary reaction and primer Mud-R4 (TTTGCACTACAGGCTTGCAAGCCC) was used for the secondary reaction and for sequencing. The isolation of MudJ transposons in E. coli F plasmid genes ybiB and ycbB indicated that F plasmid DNA had transferred into the feoB gene. Through PCR and sequencing, the F plasmid junctions were located. The left end (tetA side) of the T-POP was inserted 82 bp downstream from the start of ybjA, with PtetA transcribing toward the start codon. The right end (tetR side) of the T-POP was inserted 73 bp downstream from the start of ybjA, with PtetR transcribing toward the stop codon. A junction that fused F plasmid DNA 3,149 bp after the start of ycbB to F plasmid DNA 11 bp after the end of ybhB was also sequenced. Altogether, 6,016 bp of F plasmid DNA flanked by T-POPs had transposed into feoB.
A transposon insertion of the MudJ transcriptional reporter into a fimbrial gene was also isolated. Random MudJ insertions were generated in strain TH8757. Strain TH13235 (PfimZ::T-POP
araBAD::fimZ) was transduced with a phage stock prepared on 180,000 pooled colonies. Tet-sensitive plates containing Kan were used to select for MudJ insertions that had replaced PfimZ::T-POP. Insertions in fimbrial genes could be distinguished on lactose indicator media by looking for an increase in lac expression when fimZ was induced from the arabinose promoter. Arbitrary PCR and sequencing were used to locate the left end of a MudJ insertion in fimH.
Expression of genes at the ara locus.
Genes were placed under the control of the arabinose promoter at the ara locus by amplifying the coding sequence and then using
red recombination to replace
araBAD::tetRA in TH6706 with the amplified DNA. Primers were designed with about 40 bp of homology to the arabinose locus (for recombination) and about 20 bp of homology to the cloned gene (for amplification). These constructs replaced the sequence spanning the araB start codon through the araD stop codon with that spanning the start codon through the stop codon of the cloned gene. Tet-sensitive plates were used to select for recombinants following
red recombination. In the case of pefI-srgD, a 250-bp sequence of DNA starting upstream of pefI and continuing through 14 bp after the stop codon of srgD was used to replace the ribosome-binding site from 13 bp upstream of the araB start codon through the stop codon of araD (resulting in strain TH12196). To delete pefI from this construct, a tetRA cassette was inserted (generating strain TH14897) and then replaced with a clean deletion of pefI (producing strain TH14945). Other Para::pefI-srgD variants that began with the pefI start codon or ended 193 bp after srgD were constructed.
Construction of deletions. Genes were deleted using the FLP recombination target (FRT)-Kan-FRT cassette (FKF) or the FRT-chloramphenicol-FRT cassette (FCF) as described by Datsenko and Wanner (10). FKF and FCF insertion-deletion alleles were constructed in strain TH4702 and designed to leave 10 codons at the beginning and end of each gene intact. Kanr or chloramphenicol-resistant colonies were selected, and the location of each insertion was confirmed by PCR.
Motility plates. Motility plates were prepared as described previously (18). Single colonies were poked into the plates using toothpicks, and the plates were incubated for 6 or 24 h. For motility assays requiring the induction of a T-POP or Para construct, colonies were picked from plates that contained Tet or arabinose, respectively. At least six independent colonies were checked for each strain assayed. Adobe Photoshop was used to adjust the levels for pictures of motility plates in order to increase the contrast between the swarms and the background.
β-Galactosidase assays. Ten microliters of an overnight culture (in LB, LB-Ara, LB-Ara-Tet, or LB-chlortetracycline) was subcultured into 3 ml of fresh medium (LB, LB-Ara, LB-Ara-Tet, or LB-chlortetracycline). Tubes were incubated with shaking at 37°C until the contents reached a mid-log-phase density of 60 Klett units, which corresponds to an optical density at 600 nm of about 0.6. Cultures were put on ice, spun down, and resuspended in 3 ml of cold buffered saline. Culture samples of between 50 µl and 0.5 ml were added to 0.55 ml of complete Z-buffer (Z-buffer plus 5 µl of 10% sodium dodecyl sulfate and 100 µl of chloroform) (37) and adjusted to give a total aqueous volume of 1.05 ml with buffered saline. The assay was continued as described previously (37). For each strain, assays were performed for three independent biological replicates.
|
|
|---|
25], which is a derivative of Tn10. The T-POP contains the tetA and tetR genes needed for resistance to Tet and forms stable insertions because it lacks the transposase gene. In the T-POP transposon Tn10dTc[
25], the transcription terminator region of the tetA transcript is deleted. Insertions of this T-POP element into the chromosome result in Tet-inducible transcription from the tetA promoter into adjacent chromosomal DNA (44). A transcriptional fusion of the lac operon to the
28-dependent fliC gene (fliC5050::MudJ) was present in the recipient strain as a reporter to screen for Tet-dependent changes in flagellar transcription. Strains expressing the fliC-lac fusions grew as Lac+ (red) colonies on Mac-Lac indicator medium. Following transposition, four classes of T-POP insertion mutants were obtained based on their phenotypes on Mac-Lac and Mac-Lac-Tet media. (i) The majority of T-POP insertion mutants displayed a Lac+ phenotype on both Mac-Lac and Mac-Lac-Tet plates, indicating that the transposon insertion had no significant effect on fliC-lac transcription. (ii) A small percentage of the T-POP insertion mutants had a Lac– (white) phenotype on both Mac-Lac and Mac-Lac-Tet plates. These mutants carried insertions that themselves resulted in the inhibition of fliC-lac transcription. For example, insertions in flagellar genes required for the formation of the hook-basal body (HBB) accumulate the anti-
28 factor FlgM, resulting in the inhibition of fliC-lac transcription (21, 29, 30). (iii) About 0.5% of the T-POP insertion mutants showed normal fliC-lac transcription on Mac-Lac plates but had a Lac– phenotype on Mac-Lac-Tet plates. This phenotype indicated that fliC-lac expression was inhibited by the transcription of chromosomal DNA near the T-POP. (iv) About 0.1% of the insertion mutations resulted in a Lac– phenotype on Mac-Lac plates and a Lac+ phenotype on Mac-Lac-Tet plates. In this case, the act of T-POP insertion resulted in the inhibition of the fliC-lac reporter but expression was restored by the transcription of genes adjacent to the site of insertion. Mutations in the third and fourth classes, which yielded inducible Lac phenotypes, were analyzed further.
Characterization of T-POP insertions resulting in Tet-induced Lac phenotypes.
The fourth class of T-POP insertion mutants that had a Tet-induced Lac+ phenotype was characterized by DNA sequence analysis. In three cases, the T-POP had inserted upstream of the fliAZY operon, upstream of the fliE operon, or 785 bp into the 996-bp fliG gene. These insertion mutations were polar: the flagellar promoters did not transcribe through the T-POP insertion elements. The inhibition of transcription of the fliAZY operon, which includes the
28 structural gene (fliA), would prevent all class 3 flagellar gene transcription. The inhibition of transcription of fliE or the genes downstream of fliG that are needed for the completion of the HBB would result in the accumulation of FlgM in the cell and the inhibition of
28-dependent class 3 flagellar gene transcription. The fliG gene containing the T-POP insertion is likely still functional in its role in HBB assembly. It is known that the first 245 amino acids of FliG are enough to interact with FliM and FliN in order to build the C-ring rotor complex and full-length flagella, but these flagella do not rotate due to a defective interaction with the stator complex (53). For the fliA, fliE, and fliG mutants, the addition of Tet would induce the transcription of flagellar structural or regulatory genes from the tetA promoter and restore fliC-lac expression.
The third class of T-POP insertion mutants exhibited a Tet-inducible Lac– phenotype. The insertions in these mutants potentially inhibited flagellar transcription by inducing the expression of an adjacent gene on the chromosome. These T-POP insertions were moved into a wild-type background by P22-mediated transduction and characterized for the effect of Tet on motility. The transductants exhibited either a Tet-induced Mot– phenotype or a Mot– phenotype with or without Tet. As confirmed by DNA sequence analysis or linkage tests and complementation analysis, all of the T-POP mutations that produced a Mot– phenotype with or without Tet were inserted in the HBB assembly gene flgA. While insertions in genes required for HBB assembly normally accumulate high levels of the anti-
28 factor FlgM inside the cell, insertions in flgA have a polar effect on the downstream flgM gene and do not accumulate as much FlgM (30). The remaining T-POP insertions generating Tet-inducible Mot– phenotypes were located in six other regions of the chromosome that are not associated with the flagellar regulon (Fig. 1). The motility of one representative T-POP insertion mutant for each of these six regions is shown in Fig. 2A. For three of these regions, T-POP insertions were isolated upstream of the fimZ, rcsB, and ydiV genes (Fig. 1A, B, and C), which have been identified previously as regulators of flagellar transcription (5, 7, 11, 48, 57). RcsB and FimZ are response regulators with C-terminal DNA-binding domains. YdiV shows weak homology to EAL domain proteins, which break down the signaling molecule c-di-GMP (20). However, YdiV inhibits motility while other EAL domain proteins like YhjH and STM1827 stimulate motility (45-48). To confirm that FimZ, RcsB, and YdiV were responsible for inhibiting flagellar transcription, each corresponding gene was cloned after the arabinose promoter at the araBAD locus on the chromosome. All three constructs inhibited motility when arabinose was added (Fig. 2B).
![]() View larger version (18K): [in a new window] |
FIG. 1. T-POP insertions at six different loci inhibited flagellar transcription when induced with Tet. Each T-POP insertion is represented by a triangle containing an arrow. The arrow indicates the direction in which transcripts initiated from the tetA promoter proceed into the adjacent chromosomal DNA. The smaller, solid triangles represent polar MudJ insertions which either disrupt the inhibition of flagellar transcription or have no effect on inhibition by the T-POP insertions. As depicted in panel F, the only isolated insertion in feoB consisted of 6 kb of E. coli F plasmid DNA (wavy line) flanked by T-POP insertions.
|
![]() View larger version (58K): [in a new window] |
FIG. 2. Motility of T-POP insertion strains with or without induction by autoclaved chlortetracycline (A) or Para constructs with or without arabinose induction (B). For the colonies poked into motility plates containing chlortetracycline or arabinose, the expression of negative regulators had already been induced by growth on LB-Tet or LB-Ara plates. Pictures were taken after 6 h. Strains are indicated by the affected gene. wt, wild type.
|
-helical lipoproteins that act as a toxin-antitoxin system. Entericidins may induce apoptosis in stationary-phase E. coli cells (3). Other T-POP insertions were isolated in front of the pefI and srgD genes on the virulence plasmid of Salmonella (Fig. 1E). The pefI and srgD genes are a part of the pef locus, whose genes encode a second set of fimbriae (the plasmid-encoded fimbriae). Although the fim locus encodes the major type of fimbriae expressed in Salmonella enterica serovar Typhimurium, there are 12 additional fimbrial operons in the genome. Some expression of pef fimbriae and other minor fimbriae during growth at low pH or after the infection of intestinal cells can be detected (14, 23, 39). PefI is a DNA-binding protein that affects DNA methylation patterns and inhibits the pefA fimbrial promoter. PefI is homologous to the E. coli fimbrial regulatory proteins FaeA and PapI (39). Through a Pfam search (15), SrgD appears to be a single-domain protein that contains a helix-turn-helix motif. When pefI, srgD, or pefI-srgD was cloned at the ara locus, no significant inhibition of motility was observed (data not shown). In order to further map the genes responsible, insertions of a large, polar transposon (MudJ) were isolated near one of the T-POP insertions. A MudJ element inside srgD no longer inhibited motility, and a MudJ element located about 200 bp after srgD continued to inhibit motility (Fig. 1E). This genetic analysis suggested that DNA between the T-POP upstream of pefI and the MudJ insertion downstream of srgD was important for the efficient expression of PefI-SrgD or for the inhibition of motility. When 250 bp of DNA upstream of pefI was included in the Para::pefI+-srgD+ construct, inhibition of motility was observed (Fig. 2B). This 250 bp of upstream DNA fused only to srgD was not sufficient to inhibit motility (data not shown). This finding suggests that both pefI and srgD are needed to inhibit motility. Adding the 200 bp of DNA downstream of srgD had no effect on inhibition by the ara constructs (data not shown).
One T-POP insertion was isolated inside the iron transport gene feoB (Fig. 1F). MudJ insertions linked to the T-POP were isolated, and DNA sequence analysis revealed that several MudJ insertions were located near feoB and several were inserted in the E. coli F plasmid sequence. PCR amplification and DNA sequence analysis of this region revealed that a 6-kb section of F plasmid DNA flanked by two T-POPs had transposed into feoB. This F plasmid DNA originated from the donor strain and was somehow coinherited along with the T-POP element during transposition. The junctions between the T-POP insertions and the F plasmid DNA on the chromosome were identical to the original insertion of the T-POP in the F plasmid in the donor strain. It is unclear whether the transfer of F plasmid DNA was a result of a duplication of the T-POP and a chromosomal rearrangement of F plasmid DNA that occurred before transposition or was due to the T-POP uncharacteristically undergoing a replicative transposition event. When this F plasmid DNA was recombined out, the T-POP did not significantly inhibit motility and only a small, 17% decrease in class 3 transcription was observed. The feoB::T-POP insertion was not analyzed further.
Effects on motility of deleting negative regulators. Deletions of ecnR, fimZ, pefI-srgD, rcsDBC, and ydiV were examined for their effects on motility and flagellar transcription. Deletions of ecnR, rcsDBC, and ydiV significantly increased motility and generated a corresponding increase in class 3 transcription (Fig. 3). Increases in motility for rcsB and ydiV mutants have been observed before (48, 57). A deletion of pefI-srgD did not significantly increase motility or class 3 transcription. If pefI-srgD is not highly expressed during growth in LB, this regulator may not have a large effect on motility when deleted. In particular, genes in the pef regulon are better expressed in cells grown in acidic media (23, 39). When the pefI-srgD deletion strain was inoculated into pH 5.1 motility plates, the deletion strain was not more motile than the wild type (data not shown). Therefore, the levels of PefI-SrgD in wild-type cells in motility plates containing a mixture of tryptone, salt, and agar were not enough to inhibit motility. Finally, the strain with fimZ deleted showed a small but significant decrease in motility, which was an unexpected result for the deletion of a negative regulator of motility. If there is coordination among the different fimbrial systems, perhaps a decrease in fimZ levels would upregulate another fimbrial inhibitor of motility like pefI-srgD.
![]() View larger version (32K): [in a new window] |
FIG. 3. Motility and class 3 flagellar transcription of strains with deletions of the negative regulators. Motility was determined by measuring the diameters in motility plates after 6 h. Each reported diameter is an average for six replicates and is normalized with respect to the diameter for the wild type (wt). A representative photo of each strain is shown beneath the bar graph. Class 3 transcription from the motA::MudJ transcriptional reporter was quantified through β-galactosidase assays.
|
![]() View larger version (38K): [in a new window] |
FIG. 4. Epistatic analysis of negative regulators of motility. A deletion of each regulator was introduced into strains in which one of the five negative regulators could be induced. Colonies picked from LB-Ara plates were poked into motility plates containing arabinose using toothpicks. Pictures were taken after 6 h. wt, wild type.
|
Effect of regulators on flagellar transcription. Transcriptional fusions to the class 1 promoter (flhC::MudJ), a class 2 promoter (fliL::MudJ), and a class 3 promoter (motA::MudJ) were utilized to determine which levels of the flagellar transcriptional hierarchy are affected by the negative regulators. PefI-SrgD, RcsB, EcnR, and FimZ inhibited all three classes of flagellar promoters (Fig. 5A). This result indicates that these four regulators act at the top of the hierarchy at the class 1 promoter. In the case of YdiV, only the class 2 and class 3 flagellar promoters were inhibited. These data suggest that some step after class 1 transcription is being affected by YdiV.
![]() View larger version (26K): [in a new window] |
FIG. 5. Flagellar transcription and motility in strains expressing the negative regulators from the arabinose promoter. For both panels, the activities of MudJ transcriptional fusions to the flhC class 1 promoter, the fliL class 2 promoter, and the motA class 3 promoter were quantified through the β-galactosidase assay. Transcription activities and swimming-area diameters were normalized with respect to the wild-type levels. In the strains analyzed in panel A, the flhDC operon was expressed from its wild-type promoter. In those analyzed in panel B, the flhDC operon was expressed from a T-POP induced with Tet. The key in panel A also applies to panel B.
|
The assembly of fimbriae was disrupted using insertions in the genes for the filament subunit (fimA), the outer membrane usher (fimD), and the tip adhesin (fimH) (40). For each of the three insertion strains, the loss of fimbriae increased motility in the Para-fimZ T-POP-flhDC background to about 74% of the wild-type level (data not shown). While these insertions did not relieve all of the inhibition, the data indicate that fimbrial structures are themselves inhibitory to motility.
Capsule production was prevented by using a deletion of the promoter and first gene (wza) of the capsule synthesis operon. This wza deletion did not increase motility (data not shown). This result suggests that the capsule itself is not interfering with flagellar synthesis or function and that some other RcsB-regulated gene is responsible. In another study, however, this wza deletion did restore full motility in a strain exhibiting high RcsB activity and containing a mutated RcsAB box that prevented RcsB binding (57). The discrepancy between the findings of our studies regarding the effect of the wza deletion on motility may result from different approaches for generating increased RcsB activity. In the study by Wang et al. (57), an igaA mutation was used to induce RcsB activity, whereas we overexpressed RcsB directly from the arabinose promoter. Our different approaches may have induced different gene sets and inhibited motility through different mechanisms.
Spontaneous mutations that disrupt inhibition by EcnR and PefI-SrgD.
To further map the pathways by which the novel regulators (EcnR and PefI-SrgD) inhibit motility, spontaneous Mot+ mutants were isolated and characterized. Colonies of the T-POP-pefI-srgD strain (TH8774) or the Para-ecnR+ strain (TH9386) were poked into motility plates containing tetracycline or arabinose, respectively, to inhibit motility, and the plates were incubated overnight at 30°C. Mot+ mutants were then picked. Only one motile flare from each inoculated colony was chosen to ensure that each mutation originated independently. Of 46 spontaneous Mot+ mutations isolated in the T-POP-pefI-srgD strain, 36 were linked to the T-POP and 10 were linked to flhDC. Of 45 spontaneous Mot+ mutations isolated in the Para-ecnR+ strain, 13 were linked to the ara locus, 6 were linked to rcsB, and 26 were linked to flhDC. This spontaneous-mutation analysis suggests that no other nonessential genes are involved in these pathways. The flhDC promoter was sequenced for mutations linked to flhDC (Fig. 6). Similar flhDC promoter mutations were observed for EcnR and PefI-SrgD: mutations in the first 15 bp of the untranslated region for the P1 transcript and mutations that increased the match to the consensus sequence in the –10 hexamers for
70. Since EcnR and PefI-SrgD probably do not inhibit the flhDC promoter in the same way, these mutations are likely to be suppressors that generally increase flhDC transcription. It may be that single mutations do not disrupt EcnR and PefI-SrgD binding sites enough to restore motility.
![]() View larger version (15K): [in a new window] |
FIG. 6. Locations of spontaneous mutations in the flhDC promoter region that suppress the inhibition of motility by EcnR and PefI-SrgD overexpression. Transcription start sites (P1, P2, P3, P4, and P6) as determined by Yanagihara et al. (61) are marked with bent arrows, and –10 hexamers are underlined. The sequence that matches the consensus for the RcsAB box is identified by a wavy line (17, 36). The start codon of flhD is boxed. One double mutation was isolated and is indicated by a line connecting the two changes (G–211A and G–213A). The A–198G mutation was found in 6 of the 10 flhDC promoter mutants that suppressed PefI-SrgD inhibition and 20 of the 26 flhDC promoter mutants that suppressed EcnR inhibition.
|
28 binding sites revealed a weak match to the FlhD4C2 consensus sequence 80 bp upstream of the ecnR start codon. Transcription of the ydiV gene, on the other hand, increased in the absence of flagellar gene expression. Since EAL domain proteins like YdiV are involved in the switch between swimming and sticking to surfaces, this competition between ydiV and flagellar genes for transcription may contribute to tighter regulation. The lac fusions to fimH, rcsB, and srgD were not affected by the induction of the flagellar regulon.
![]() View larger version (22K): [in a new window] |
FIG. 7. Effect of the flagellar system on the transcription of the negative regulator genes. The fusion of lac to each negative regulator gene was used to quantify changes in transcription. The flhDC operon was expressed from its wild-type promoter or from the tetA promoter in the T-POP. When under the control of the T-POP, the flhDC operon is not expressed without the inducer chlortetracycline (chlortet.).
|
|
|
|---|
![]() View larger version (11K): [in a new window] |
FIG. 8. Diagram of interactions for the five negative regulators identified in this study. While arrows show interactions between the regulators and the flagellar system, it is not known whether the majority of the interactions are direct or are mediated by regulators other than the five that were studied. A binding site in the class 1 promoter has been identified only for RcsB (57). It is also not clear how RcsB helps EcnR to inhibit class 1 transcription, and this interaction is labeled with a question mark. Since part of RcsB's inhibition of motility occurs after class 1 transcription, EcnR may not inhibit flagellar transcription by directly activating RcsB.
|
The function of EcnR is less clear. Because the ecnR gene is located next to the entericidin genes, EcnR may be involved in their regulation. It has been proposed previously that the entericidins in E. coli are produced in stationary phase to kill some cells in order to feed the rest of the population (3). If this hypothesis is correct, entericidins and flagella would represent two different strategies for survival. Flagella are used to find more nutrients, and entericidins would enable survival without nutrients. EcnR may help coordinate these two strategies. Moreover, the activation of ecnR transcription by flagellar genes may provide the entericidin system with a readout on the metabolic state of the cell.
Part of the flagellar inhibition by FimZ was determined to occur at a step after class 1 transcription. Mutations in the structural genes for fimbriae removed some of this secondary inhibition of motility by FimZ. These data suggest that the fimbrial structure can be inhibitory to flagellar synthesis or function, as has been observed before in E. coli (19, 31, 48). The inhibition of flagellar synthesis may occur through fimbrial proteins acting as a physical barrier to the assembly of the flagellum past the outer membrane. An example of this sort of inhibition may exist in Salmonella enterica serovar Typhi, in which the Vi capsular antigen is able to inhibit flagellar secretion (1). Alternatively, inhibition may occur through the proton motive force (PMF). If excess fimbrial production depletes the PMF, the result will be the inhibition of flagellar assembly since flagellar secretion utilizes the PMF (41). Finally, the inhibition may occur through competition for secretion systems or other resources to build the extracellular structures. The presence of fewer functional flagella may provide feedback to reduce flagellar transcription through flagellar regulatory proteins like FlgM and FliT.
While two new regulators of flagellar transcription were identified in this study, our screen probably did not saturate the genome. Insertions in front of the genes for known regulators like AdrA, CAP, ClpXP, CsrA, Fur, H-NS, and RtsB were not isolated. Regulators that have a more subtle effect on flagellar transcription might not have been detected on the Mac-Lac indicator medium for the fliC-lac reporter fusion that was used. Since we did not saturate our screen for low-level effects, there are likely to be other parts of the flagellar regulatory network that have not been identified. Further characterization of these pathways should improve our understanding of the complex regulatory mechanisms involved in adapting to different environments.
This work was supported by Public Health Service grant GM56141 from the National Institutes of Health (to K.T.H.).
Published ahead of print on 29 December 2008. ![]()
Supplemental material for this article may be found at http://jb.asm.org/. ![]()
Present address: Department of Biology, University of Utah, Salt Lake City, UT 84112. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»