Previous Article | Next Article ![]()
Journal of Bacteriology, May 2009, p. 3059-3067, Vol. 191, No. 9
0021-9193/09/$08.00+0 doi:10.1128/JB.01650-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

John Innes Centre, Colney, Norwich NR4 7UH, United Kingdom,1 Université Lyon 1, CNRS UMR 5557 Ecologie Microbienne, 69622 Villeurbanne, France,2 Fundación Instituto Leloir, IIBBA-CONICET, FCEyN, University of Buenos Aires, Patricias Argentinas 435, Buenos Aires, Argentina3
Received 20 November 2008/ Accepted 23 February 2009
|
|
|---|
|
|
|---|
There are other quorum-sensing loci in different strains of rhizobia. In Sinorhizobium meliloti strain Rm1021, AHLs produced by SinI activate SinR and ExpR, LuxR-type regulators, to induce several genes, including those determining the production of an exopolysaccharide, exopolysaccharide II (EPS-II) (17, 23, 24, 35), that plays an important role in the symbiosis. In S. meliloti, two LuxR-type regulators, VisN and VisR, are involved in chemotaxis and motility (24, 44). Rhizobium etli has multiple AHL synthase genes (9, 39), but the functions of many of the regulated genes remain to be established. The cinR and cinI genes are required for normal symbiotic nitrogen fixation and swarming in R. etli (5, 9, 11) and for normal levels of expression of raiI, which encodes another AHL synthase. The expression of raiI in R. etli is regulated by RaiR (39).
Analysis of AHLs produced by strain A34 of Rhizobium leguminosarum bv. viciae led to the characterization of four LuxI-type AHL synthases (RhiI, CinI, RaiI, and TraI) and five LuxR-type regulators (RhiR, CinR, RaiR, TraR, and BisR) (8, 31, 50, 53). In this strain, the cinI and cinR genes are chromosomally located; CinI produces N-(3-hydroxy-7-cis-tetradecenoyl)-L-homoserine lactone (3-OH-C14:1-HSL) (20, 31), CinR induces cinI expression in response to this AHL (31), and this appears to be associated with adaptation to starvation and salt stress (47). Mutation of cinI or cinR affects the expression of the other three AHL synthase genes in R. leguminosarum bv. viciae strain A34. Thus, in a cinI mutant, the expression of raiI is reduced, resulting in very low levels of 3-OH-C8-HSL, the major AHL made by RaiI (53). Similarly, the expression levels of the traI and rhiI genes on the symbiotic plasmid pRL1JI are reduced in cinI and cinR mutants (31). RhiI-made AHLs activate RhiR to induce the expression of the rhiABC operon in R. leguminosarum bv. viciae (38), enhancing the interaction with the legume host (8).
The cinI and cinR quorum-sensing genes control induction of the traI and traR quorum-sensing regulons via CinI-made 3-OH-C14:1-HSL, which activates BisR (another LuxR-type regulator) to induce traR and hence traI (12). However, the mechanism by which cinI and/or cinR control raiI and raiR expression has not been established. In this work we demonstrate that raiI and raiR expression requires both expR and a small gene (cinS) cotranscribed with cinI. CinS also regulates the expression of plyB encoding an extracellular glycanase and is required for swarming of R. etli.
|
|
|---|
Bacterial strains.
The strains and plasmids used are listed in Table 1 or in the text. R. leguminosarum strain 8400 lacks a symbiotic plasmid, and all R. leguminosarum strains were derived from strain 8400 or its streptomycin-resistant derivative, strain 8401. A34 is a derivative of strain 8401 carrying the symbiotic plasmid pRL1JI. Plasmids were mobilized into Rhizobium by triparental matings using a helper plasmid. Strain 8401 was mutagenized with Tn5-gus by using Escherichia coli strain MM294/pRK600::Tn5-gus as a donor of the suicide plasmid pRK600::Tn5-gus essentially as described previously (41). A population of about 8,000 colonies was screened for impaired AHL production by picking colonies onto a lawn of the AHL biosensor strain Chromobacterium violaceum CV026 (33) to identify mutants that did not induce the purple pigment violacein. One of these mutants (A702; expR) was severely affected for production of RaiI-made AHLs, and small-bacteriocin tests revealed that strain A702 retained the ability to produce 3-OH-C14:1-HSL. Strain A1085 was made by plating bacteriophage RL38 (6) on strain A702 and using the phage lysate to transduce strain 8400, selecting for kanamycin resistance. To make strain A1102 (cinS::Spcr), cinS with 1-kb flanking regions was first amplified by PCR using primers CTGAAGAGCGGCCGCTTCAAGCTC and GAGAAACTTAGCGGCCGCTATTGATTTC containing introduced NotI sites (bold face). The product was digested with NotI and cloned into pJQ254 (37). The cinS1::Spcr allele was then created by cloning a spectinomycin resistance cassette on a BamHI fragment from pHP45
(36) into the unique BamHI site in cinS. The 4-kb NotI fragment containing cinS1::Spcr was then subcloned into pJQ200 (37), and the cinS1::Spcr allele was recombined into strain 8401 by selecting for spectinomycin-resistant, sucrose-resistant transconjugants (37).
|
View this table: [in a new window] |
TABLE 1. Strains and plasmids used in this study
|
DNA sequencing of the region containing expR (accession no. FM992852) was carried out on both strands using primer walking on pIJ9229. The location of Tn5-gus in expR was determined by sequencing pIJ9115 using a Tn5-specific primer. Database searches of the predicted protein sequences were carried out by using the BLAST and FASTA (1) programs to find related sequences in the EMBL and SwissProt protein sequence databases.
AHL assays. R. leguminosarum cultures were grown for 48 h in TY medium to an OD600 of about 1.0, and cells were removed by centrifugation. AHLs were extracted from culture supernatants and analyzed by thin-layer chromatography (31) using Agrobacterium tumefaciens NT1/pZLR4 (7, 42). The amount loaded corresponds to the extract from 1 ml of culture supernatant. CinI-made 3-OH-C14:1-HSL was bioassayed on TY medium (50).
|
|
|---|
![]() View larger version (52K): [in a new window] |
FIG. 1. Effects of cloned expR, raiR, and cinS on production of AHLs by R. leguminosarum quorum-sensing mutants. AHLs were extracted from cell-free culture supernatants, separated by thin-layer chromatography, and detected using an overlay of agar seeded with the biosensor A. tumefaciens NT1/pZLR4. Each lane was loaded with a volume of extract equivalent to 1 ml of culture. (A) Lane 1, C7-HSL standard (std) (14 pmol); lane 2, strain 8401 (WT); lane 3, strain A702 (expR); lane 4, strain A802 (raiR); lane 5, strain A702 (expR) carrying pIJ9493 (expR); lane 6, A702 (expR) carrying pIJ9276 (raiR); lane 7, A802 (raiR) carrying pIJ9276 (raiR); lane 8, A802 (raiR) carrying pIJ9493 (expR); lane 9, standards, i.e., C8-HSL (100 pmol) and C7-HSL (14 pmol). (B) Lane 1, strain 8401 (WT); lane 2, strain A1102 (cinS); lane 3, A1102 (cinS) carrying pIJ9692 (cinS); lane 4, A1102 (cinS) carrying pIJ9493 (expR); lane 5, standards, i.e., C8-HSL (100 pmol), C7-HSL (14 pmol), and C6-HSL (5 pmol). (C) Lane 1, strain 8401 (WT), lane 2, strain A740 (cinI); lane 3, strain A740 (cinI) carrying pIJ9692 (cinS); lane 4, A1085 (expR); lane 5, A1085 (expR) carrying pIJ9692 (cinS); lane 6, standards, i.e., C8-HSL (100 pmol), C7-HSL (14 pmol), and C6-HSL (5 pmol).
|
![]() View larger version (12K): [in a new window] |
FIG. 2. (A) Model of quorum-sensing regulation in R. leguminosarum strain 8401. The cinS gene is cotranscribed with cinI and is predicted to be translationally coupled to cinI and so is induced by CinR in response to CinI-made AHL. Both cinS and expR are required for full induction of raiR and plyB; RaiR regulates raiI in response to RaiI-made AHL. (B) Predicted sequence of CinS from strain 8401 (top line) and the differences in the conserved homologues in R. leguminosarum bv. viciae 3841 (GenBank nucleotide accession no. AM236080) and R. leguminosarum bv. trifolii strain WSM1325 (GenBank protein accession no. EDR73518) (line a), R. leguminosarum bv. trifolii strain WSM2304 (GenBank protein accession no. ACI55940) (line b), R. etli strains CNPAF512 (GenBank nucleotide accession no. AF393621) and CIAT652 (GenBank protein accession no. ACE92023) (line c), R. etli strain CFN42 (GenBank nucleotide accession no. CP000133) (line d), and Mesorhizobium tianshanense (GenBank nucleotide accession no. DQ123807) (line e). The residues different from those in CinS in strain 8401 are shown below the sequence; deletions are shown by dashes.
|
|
View this table: [in a new window] |
TABLE 2. Effect of an expR mutation on raiR'-lacZ and raiI'-lacZ expressiona
|
A cinS mutant (strain A1102) produced normal levels of CinI-made 3-OH-C14:1-HSL (data not shown), and A1102/pIJ7910 (cinI'-lacZ) had normal levels of β-galactosidase expression (20,628 ± 2,694 units compared with 24,692 ± 1,940 units seen with the control 8401/pIJ7910). This contrasts with the relatively low expression (986 ± 75 units) in the cinI mutant A740 carrying pIJ7910. Strain A1102 (cinS) lacked RaiI-made AHLs (Fig. 1B, lane 2); like the expR mutant (and cinI and cinR mutants), it did not induce raiI'-lacZ, apparently due to a lack of raiR expression (Table 2). Cloned cinS behind a vector promoter (pIJ9692) restored the expression of raiR'-lacZ in the cinI, cinR, and cinS mutants (Fig. 3A) and restored formation of the RaiI-made AHLs in the cinS and cinI mutants A1102 and A740 (Fig. 1B, lane 3, and Fig. 1C, lane 3), and in the cinR mutant A552 (data not shown). In contrast, pIJ9655 carrying cloned cinI and part of cinS (encoding the N-terminal 36 residues) did not complement raiR-lacZ expression in the cinI mutant (A740/pIJ9272 had 278 ± 23 units compared with over 1,000 units in the WT; Table 2); pIJ9655 (cinI) also did not restore formation of RaiI-made AHLs to the cinI mutant, although as expected, it restored production of CinI-made AHLs (data not shown). The complementation of raiR expression in the cinI mutant by cinS, but not by cinI, confirms the prediction that the cinI mutation in A740 is polar on cinS and that cinI and cinS are cotranscribed (Fig. 2A).
![]() View larger version (25K): [in a new window] |
FIG. 3. Effects of cloned cinS and expR on raiR'-lacZ and plyB'-lacZ expression in quorum-sensing mutants of R. leguminosarum. Strains were grown in Y-mannitol medium, and β-galactosidase activity was assayed after 48 h (for raiR'-lacZ) or 72 h (for plyB'-lacZ) of growth. The WT strain (strain 8401) and mutant strains were used. The mutant strains used were cinI (strain A740), cinR (A552), cinS (A1102), and raiI (A789) single mutants, the raiI cinI double mutant (A797), and expR mutant (A1085) (in this experiment A1085 was used instead of A702 to facilitate plasmid selection). (A) raiR'-lacZ activities of WT and mutants with cloned cinS on pIJ9692 (black bars) or cloned expR on pIJ9769 (hatched bars) or the strains containing the appropriate vector controls pKT230 or pBBR1-MCS2 (white bars). (B) plyB'-lacZ activities of WT and mutants with cloned cinS on pIJ9692 (black bars) or cloned expR on pIJ9769 (hatched bars) or the strains containing the appropriate vector control, pKT230 or pBBR1-MCS2 (white bars).
|
Cloned cinS (pIJ9692) restored both raiR expression (Fig. 3A) and the production of RaiI-made AHLs to the expR mutant A702 (Fig. 1C, lane 5), but in the cinS mutant A1102, cloned expR (pIJ9769) only very slightly increased both AHL production (Fig. 1B, lane 4) and raiR'-lacZ (pIJ9272) expression (Fig. 3A). This shows that CinS acts downstream of ExpR (the expR gene on pIJ9769 is functional because it complemented the expR mutant; Fig. 3A).
These data are not consistent with a model in which ExpR directly regulates raiR or raiI expression. The observations point toward both CinS and ExpR having an effect on the levels of raiR transcript (Fig. 2A), although high-level expression of CinS can compensate for the absence of ExpR.
expR expression and cinIS expression are not interdependent. The expR mutant A702 carrying cinI'-lacZ (pIJ7910) expressed cinI'-lacZ normally (23,114 ± 1,753 units compared with 24,692 ± 1,940 units in strain 8401/pIJ7910) and produced normal levels of CinI-made 3-OH-C14:1-HSL (data not shown), showing that expR is not required for expression of the cinIS operon. These observations are different from those made in S. meliloti, in which expR and SinI-made AHLs are required for full induction of sinI (23, 34).
We tested whether expR expression is regulated by CinR or by CinI-made AHLs. An expR'-lacZ fusion (pIJ9263) was expressed similarly in the control strain 8401 and the cinR mutant A552 (856 ± 45 units compared with 902 ± 23 units, respectively). Therefore, expR expression is not regulated by CinR. Similar levels of expR'-lacZ expression were seen with pIJ9263 in strain A740 (cinI) (911 ± 56 units), A789 (raiI) (813 ± 119 units), A797 (raiI cinI) (865 ± 86 units), and A802 (raiR) (732 ± 164 units), showing that expR expression is independent of the Cin and Rai AHL-based regulatory systems.
cinS influences colony morphology and formation of biofilm rings. Mutation of cinS, cinR, cinI, or expR had no obvious effect on the growth rate of R. leguminosarum in minimal or complex media or on the symbiosis (nodulation and nitrogen fixation) of peas (data not shown), although the colonies on TY medium appeared slightly more mucoid than normal. Plated cultures of strain 8401 (WT) carrying cloned cinS (on pIJ9692) had an unusual phenotype, because the primary inoculum on TY plates appeared to age prematurely. Normally the primary inoculum region is quite mucoid after about 2 days of growth but appears to "collapse" or dry up after about 7 days of incubation. However, cloned cinS (pIJ9692) caused this collapse to occur in the control, strain 8401, after about 3 days (Fig. 4A). This effect of cloned cinS was independent of AHL-dependent quorum-sensing regulation, because the collapse phenotype was induced by pIJ9692 in the cinR mutant (Fig. 4B), and similar results (data not shown) were seen with the cinI, cinS, raiR, and raiI mutants as well as the raiI cinI double mutant. However, the expR mutation in strain A702 blocked the cinS-induced collapse at 3 days (Fig. 4C). This suggests that, like raiR induction, both expR and cinS are required to induce the colony collapse, but since the effect occurred in the raiI and raiR mutants, the collapse cannot be induced via an effect of ExpR and CinS on the raiI-raiR regulatory system.
![]() View larger version (91K): [in a new window] |
FIG. 4. Cloned cinS induced a colony collapse phenotype. The photographs show cultures of strains grown for 3 days on TY agar medium. For each strain, the photograph on the left shows the strain grown with the vector (pKT230) control and the photograph on the right shows the strain with cinS on pIJ9692. Strains 8401 (WT) (A), A552 (cinR) (B), A702 (expR) (C), and A616 (plyB) (D) are shown. After 2 days, the appearance of R. leguminosarum 8401/pIJ9692 and A552/pIJ9692 cultures looked normal (not shown) but collapsed, forming a dry appearance after 3 days. Cloned cinS had no effect on strain A616 (plyB) even after prolonged culture, but with strain A702 (expR), a delayed colony collapse was observed (not shown). pIJ9692 (cinS) induced a similar collapse to that seen in panels A and B in strains A740 (cinI), A1102 (cinS), A789 (raiI) A802 (raiR), and A797 (raiI cinI) (not shown).
|
![]() View larger version (24K): [in a new window] |
FIG. 5. Decrease of plyB-lacZ expression in cinI, cinR, cinS, and expR mutants. Expression of plyB was assayed throughout growth in Y-mannitol medium using pIJ9252 (plyB'-lacZ) in the WT strain 8401 (solid squares), the cinI mutant A740 (solid triangles), the cinR mutant A552 (solid diamonds), the cinS mutant A1102 (open squares), and the expR mutant A702 (solid circles). The growth of strain 8401 measured at OD600 is shown as open circles and was very similar for all strains.
|
After 3 to 4 days in shaken flask cultures in Y-mannitol medium, the cinS mutant produced a biofilm ring that was enhanced compared with that of the control strain 8401 (Fig. 6A), and this was restored to normal by cloned cinS on pIJ9692 (Fig. 6B). Similar results were seen with the cinI and cinR mutants (Fig. 6). Biofilm rings produced by strain 8401 and the cinS, cinI, cinR, expR, raiI, and raiR mutants were quantified, confirming that the cinS, cinI, and cinR mutations enhanced the formation of biofilm rings (Fig. 6C). These enhanced biofilm rings were suppressed by cloned cinS (Fig. 6B, C), demonstrating that the enhanced biofilm rings in the cinI and cinR mutants are due to a lack of cinS expression, rather than a lack of CinI-made AHLs. The enhanced biofilm ring phenotype is independent of the raiIR quorum-sensing system, because raiI or raiR mutants did not produce an enhanced biofilm ring (Fig. 6C). The expR mutant A702 also produced an enhanced biofilm ring (Fig. 6), but it was less stable than that seen in the other mutants, resulting in high variation in the levels quantified (Fig. 6C); the enhanced biofilm in strain A702 (expR) was not suppressed by cloned cinS (Fig. 6C).
![]() View larger version (65K): [in a new window] |
FIG. 6. Effects of cloned cinS on biofilm rings produced by quorum-sensing mutants. (A) Biofilm rings formed at the air-liquid interface of shaking flask cultures of strains grown for 5 days in Y-mannitol medium are shown. Strains A552 (cinR), A740 (cinI), A1102 (cinS), and A702 (expR) produced enhanced biofilm rings compared to that seen with 8401 (WT), although the biofilm formed by strain A702 was less stable and tended to be shed into the growth medium. (B) Cloned cinS (on pIJ9692) suppressed the formation of the enhanced biofilm rings in the cin mutants. (C) Biofilm rings similar to those illustrated above were quantified by staining with crystal violet following growth of strain 8401 (WT), A552 (cinR), A740 (cinI), A1102 (cinS), A702 (expR), and A802 (raiR) carrying the pKT230 vector (absence of cinS [– cinS]) (open bars) or cinS on pIJ9692 (cinS present [+ cinS]) (black bars). Standard deviations (n = 3) are indicated by the error bars.
|
![]() View larger version (35K): [in a new window] |
FIG. 7. Swarming by an R. etli cinI mutant was complemented by cinS, but not cinI. R. etli CNPAF512 (WT), FAJ4006 (cinI), and FAJ4006 containing cloned cinS on pIJ9692 (cinI + cinS) or cloned cinI on pIJ9655 (cinI + cinI) were spot inoculated onto the surfaces of YEM swarm plates, revealing that cinS, but not cinI, restored swarming to FAJ4006.
|
|
|
|---|
The effect of the hierarchical regulation is to induce the expression of raiR in a population density-dependent manner, and a consequence of this is the increased expression of raiI and of AHLs produced by RaiI. The observations that cloned cinS can restore the decreased raiR expression in an expR mutant but that cloned expR cannot restore raiR expression in the cinS mutant indicate that CinS acts downstream of ExpR. ExpR is not required for the expression of cinS, because mutation of expR did not affect the expression of the promoter of the cinIS operon.
The expR gene identified here is homologous to expR from S. meliloti. The two predicted proteins are about 58% identical, and both are LuxR-type regulators encoded by genes located between the ndvA and pyc genes. In S. meliloti strain 1021, which is the most widely used strain for genetic studies, expR is interrupted by an endogenous IS element, a mutation which prevents the formation of an exopolysaccharide called EPS-II (35). ExpR induces the expression of EPS biosynthetic genes in response to C16:1-HSL, produced by SinI (32, 34). Mutation of expR or sinI, both of which are required for the production of EPS-II, alter the colony morphology of strains, and expR is required for full sinI induction, which also requires the LuxR-type regulator SinR- and SinI-made AHLs (32, 34). Whereas expR in S. meliloti is required for full sinI expression, expR in R. leguminosarum is not required for full cinI expression. Furthermore, it appears likely that, although it appears to have an AHL-binding domain, ExpR in R. leguminosarum can act independently of AHLs because, in a cinI raiI double mutant lacking detectable AHLs, cloned cinS restored full expression of plyB, which is ExpR regulated.
R. leguminosarum produces no polysaccharide equivalent to ExpR-regulated EPS-II made by S. meliloti, and the colony morphology of the R. leguminosarum expR mutant was very similar to the WT. In addition, CinI and CinR from R. leguminosarum show only about 30% identity to SinI and SinR from S. meliloti, as might be expected from nonorthologous AHL synthases and LuxR-type regulators. R. leguminosarum produces an acidic EPS structurally very different from the succinoglycan or EPS-II produced by S. meliloti (3), so there is not a clearly homologous target that ExpR is likely to regulate. The expR and cinS genes are needed for normal induction of plyB, which encodes a secreted glycanase (15, 16) that cleaves the acidic EPS (56). Since mutations in raiI and raiR had no effect on plyB expression, the raiR and plyB genes must be regulated in parallel, rather than plyB being regulated via raiR. There is a difference between raiR and plyB regulation, because although cloned cinS can restore raiR expression in an expR mutant, it cannot restore plyB expression in the expR mutant. The lack of cinS restoration of plyB expression in the expR mutant is consistent with the observation that the colony collapse phenotype induced by cloned cinS is absent or delayed in the plyB or expR mutants, possibly implying a more direct role for ExpR in plyB expression compared with raiR expression.
Clearly, cinS can influence raiR expression and presumably other genes regulated by RaiR and surface EPS via its effects on plyB induction. Mutation of plyB or cinI in R. etli abolished swarming (5, 10) and since we have shown (Fig. 7) that the cinI mutation in R. etli is polar on cinS, this would be consistent with our proposed model of CinS playing a role in levels of plyB expression. Our data are not consistent with the proposal (10) that CinI-made AHLs have a direct effect on the extent of swarming by acting as a surfactant to reduce surface tension. It does appear that CinI-made AHLs may directly affect the characteristics of the swarm rather than its extent, because the swarming pattern in the cinI mutant carrying cloned cinS looked qualitatively different from that of the WT. It remains to be seen how many genes are regulated by CinS; in S. meliloti, ExpR and the sinIR quorum-sensing system regulate genes involved in motility and production of surface polysaccharides (24, 34).
We have not identified how CinS exerts its function. It is clear that, once expressed, CinS enhances plyB and raiR expression in the absence of CinI or RaiI-made AHLs, because cloned cinS restored plyB and raiR expression in a raiI cinI double mutant. Therefore, although CinI-made AHLs are normally required for cinS induction, they are not required for its activity, even though cinI and cinS are predicted to be translationally coupled in all strains in which they have been identified. There are no clear homologues of cinS outside the rhizobia, so it is difficult to predict how it acts. The most likely options are that CinS acts as a DNA- or RNA-binding protein that can enhance gene expression or RNA levels. There are several RNA-binding proteins that can influence quorum-sensing regulation in other bacteria (18, 22, 46, 48), sometimes circumventing the quorum-sensing regulatory system (21). However, there is also evidence for small DNA-binding proteins playing a role in quorum-sensing regulation (30) and a small quorum-sensing-induced protein (DegQ) that stimulates phosphotransfer to a transcriptional regulator that affects motility and biofilm formation (26). At this stage, we cannot easily determine whether any of these possibilities is likely, because CinS shows no similarity to any of these known regulators.
This work was supported in part by the Biotechnology and Biological Sciences Research Council via a grant-in-aid, a studentship (to J.J.), a grant (208/BRE13665) under the BIRE initiative, an award from CERES, and a contract (QLK3-CT-2000-31795) and a Marie Curie EST training award (019727) from the European Union.
Published ahead of print on 6 March 2009. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»