Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Bacteriology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
CELL SURFACES

Characterization of the Gene Cassette Required for Biosynthesis of the (α1→6)-LinkedN-Acetyl-d-Mannosamine-1-Phosphate Capsule of Serogroup A Neisseria meningitidis

John S. Swartley, Li-Jun Liu, Yoon K. Miller, Larry E. Martin, Srilatha Edupuganti, David S. Stephens
John S. Swartley
Departments of Medicine and
Microbiology and Immunology,
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Li-Jun Liu
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
Departments of Medicine and
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yoon K. Miller
Departments of Medicine and
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Larry E. Martin
Departments of Medicine and
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Srilatha Edupuganti
Departments of Medicine and
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
David S. Stephens
Departments of Medicine and
Microbiology and Immunology,
Emory University School of Medicine, and Department of Veterans Affairs Medical Center, Atlanta, Georgia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JB.180.6.1533-1539.1998
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    Genetic organization of the ∼4.7-kb region separatingctrA and galE in serogroup A meningococcal strain F8229. Open arrows, drawn to scale, represent the locations and orientations of ORF1 to -4. Dotted open arrows indicate the flanking genes ctrA and galE only, portions of which are shown. Open triangles point to the locations of insertion mutations created in ORF1 to ORF4 (see text). Locations of primers (Table 1) are shown by solid arrows.

  • Fig. 2.
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    RT-PCR of mRNA prepared from wild-type serogroup A strain F8229 to detect an ORF1 to ORF4 polycistronic transcript. Primer SE56 (Table 1; Fig. 1), which is complementary to the 3′ end of ORF4, was used as the RT extension primer to generate cDNA in the RT reaction [RT (+)]. A control without RT added [RT (−)] was included under otherwise identical conditions. Primers SE46 and SE61 were used for PCR amplification of an approximately 2.8-kb ORF1-to-ORF4 product. Lane 1, 1-kb ladder (Gibco-BRL); lane 2, positive control using F8229 chromosomal DNA as the template; lane 3, PCR result using the RT (+) template; lane 4, negative control using the RT (−) template. DNA size standards (in base pairs) are indicated.

  • Fig. 3.
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    Autoradiographs showing primer extension products for the serogroup A meningococcal genes ctrA and ORF1. Primer extension reactions were loaded alongside standard double-stranded DNA-sequencing reactions (load orientation of G, A, T, C) obtained by sequencing ctrA and ORF1 control DNA templates with the extension primers SE40 (ctrA) and SE41 (ORF1). The DNA sequence surrounding the primer extension bands has been expanded. The nucleotides corresponding to the putative start points of transcription are circled.

  • Fig. 4.
    • Open in new tab
    • Download powerpoint
    Fig. 4.

    Nucleotide sequence of the 218-bp intergenic region separating the start codons for the serogroup A ctrA and ORF1 loci. The start points and directions of transcription of the ORF1 and ctrA mRNAs are indicated by ti and arrows, respectively. Predicted −10 and −35 promoter binding sequences are indicated, as well as the putative Shine-Dalgarno ribosome binding sites (RBS). The predicted initiation codons for ctrA and ORF1 are shown in boxes.

  • Fig. 5.
    • Open in new tab
    • Download powerpoint
    Fig. 5.

    Colony immunoblots of wild-type serogroup A meningococcal strain FA8229, its ORF1 to -4 mutants, and unencapsulated variant F8239. Strains were grown overnight on GC base agar, transferred to nitrocellulose, and probed with anti-serogroup A monoclonal antibody 14-1-A (45). (A) Wild-type encapsulated strain F8229; (B) unencapsulated variant F8239; (C) F8229-ORF1Ω; (D) F8229-ORF2Ω; (E) F8229-ORF2aphA-3; (F) F8229-ORF3Ω; (G) F8229-ORF4Ω.

Tables

  • Figures
  • Table 1.

    Oligonucleotide primers used in this study

    Primer Nucleotide sequence (5′→3′)
    LJ4CCACCACCAAACAATACTGCCG
    SE26GCGTTTAACAAGCGTTCTAAGCC
    SE33GTCAACTCAGAAGATAAGAATTGG
    SE40GAATAGCACTACATGCACTTCCC
    SE41CAGGGCGAGTGCCAAAGACG
    SE46GAAGCTGTAGCTGCAGGAACTG
    SE56AATCATTTCAATATCTTCACAGCC
    SE57TTACCTGAATTTGAGTTGAATGGC
    SE61CAAAGGAAGTTACTGTTGTCTGC
    SE63TTCATATAACTTGCGGAAAAGATG
    JS102GAGCCTATTCGAAATCAAAGCTG
    JS103AGATACCATTAGTGCATCTATGAC
    JS104CATGAAACTCAGCACAGATAGAAC
    JS105GTTATTTAAATCTAGCCATGCTGG
    GalE1CGTGGCAGGATATTGATGCTGG
PreviousNext
Back to top
Download PDF
Citation Tools
Characterization of the Gene Cassette Required for Biosynthesis of the (α1→6)-LinkedN-Acetyl-d-Mannosamine-1-Phosphate Capsule of Serogroup A Neisseria meningitidis
John S. Swartley, Li-Jun Liu, Yoon K. Miller, Larry E. Martin, Srilatha Edupuganti, David S. Stephens
Journal of Bacteriology Mar 1998, 180 (6) 1533-1539; DOI: 10.1128/JB.180.6.1533-1539.1998

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Bacteriology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Characterization of the Gene Cassette Required for Biosynthesis of the (α1→6)-LinkedN-Acetyl-d-Mannosamine-1-Phosphate Capsule of Serogroup A Neisseria meningitidis
(Your Name) has forwarded a page to you from Journal of Bacteriology
(Your Name) thought you would be interested in this article in Journal of Bacteriology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Characterization of the Gene Cassette Required for Biosynthesis of the (α1→6)-LinkedN-Acetyl-d-Mannosamine-1-Phosphate Capsule of Serogroup A Neisseria meningitidis
John S. Swartley, Li-Jun Liu, Yoon K. Miller, Larry E. Martin, Srilatha Edupuganti, David S. Stephens
Journal of Bacteriology Mar 1998, 180 (6) 1533-1539; DOI: 10.1128/JB.180.6.1533-1539.1998
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

DNA-binding proteins
Escherichia coli Proteins
Hexosamines
Neisseria meningitidis
transcription factors
UDPglucose 4-Epimerase

Related Articles

Cited By...

About

  • About JB
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jbacteriology

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0021-9193; Online ISSN: 1098-5530