Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Bacteriology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
    • JB Special Collection
    • JB Classic Spotlights
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JB
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
GENETICS AND MOLECULAR BIOLOGY

Redundant In Vivo Proteolytic Activities ofEscherichia coli Lon and the ClpYQ (HslUV) Protease

Whi-Fin Wu, YanNing Zhou, Susan Gottesman
Whi-Fin Wu
Laboratory of Molecular Biology, National Cancer Institute, Bethesda, Maryland 20892-4255
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
YanNing Zhou
Laboratory of Molecular Biology, National Cancer Institute, Bethesda, Maryland 20892-4255
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Susan Gottesman
Laboratory of Molecular Biology, National Cancer Institute, Bethesda, Maryland 20892-4255
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JB.181.12.3681-3687.1999
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

The ClpYQ (HslUV) ATP-dependent protease of Escherichia coli consists of an ATPase subunit closely related to the Clp ATPases and a protease component related to those found in the eukaryotic proteasome. We found that this protease has a substrate specificity overlapping that of the Lon protease, another ATP-dependent protease in which a single subunit contains both the proteolytic active site and the ATPase. Lon is responsible for the degradation of the cell division inhibitor SulA; lon mutants are UV sensitive, due to the stabilization of SulA. lon mutants are also mucoid, due to the stabilization of another Lon substrate, the positive regulator of capsule transcription, RcsA. The overproduction of ClpYQ suppresses both of these phenotypes, and the suppression of UV sensitivity is accompanied by a restoration of the rapid degradation of SulA. Inactivation of the chromosomal copy of clpY orclpQ leads to further stabilization of SulA in alon mutant but not in lon+ cells. While either lon, lon clpY, or lon clpQ mutants are UV sensitive at low temperatures, at elevated temperatures the lon mutant loses its UV sensitivity, while the double mutants do not. Therefore, the degradation of SulA by ClpYQ at elevated temperatures is sufficient to lead to UV resistance. Thus, a protease with a structure and an active site different from those of Lon is capable of recognizing and degrading two different Lon substrates and appears to act as a backup for Lon under certain conditions.

Energy-dependent degradation inEscherichia coli is carried out by a few different ATP-dependent proteases, each with mostly unique substrate specificities. These include Lon, FtsH, and a number of different Clp proteases (reviewed in reference 10). The Clp proteases are composed of two different multimeric components. The smaller subunit (about 19 kDa) is a peptidase, either ClpP (34) or ClpQ (HslV) (38, 43). The larger subunit is an ATPase, ClpA (84 kDa) (24), ClpX (46 kDa) (13), or ClpY (also called HslU) (49 kDa) (38, 43). Either ClpA or ClpX can associate with ClpP to form an ATP-dependent protease (ClpAP or ClpXP); ClpY associates with ClpQ to form an active, energy-dependent protease. While ClpY and ClpX show significant sequence similarity to each other and to ClpA, ClpP and ClpQ/HslV are not related at the sequence level. ClpP is a serine protease, found in many prokaryotes and in the organelles of many eukaryotes; ClpQ has a catalytic amino-terminal threonine residue and shows significant sequence similarity to the eukaryotic proteasome β subunit (46).

The genes encoding ClpQ and ClpY, hslVU, initially were identified as heat shock genes by Chuang et al. (5) and subsequently were selected in searches for multicopy plasmids that perturb heat shock regulation by sigma E and suppress the effects of a mutation in htrC in causing sensitivity to amino acid analogs (38). However, the function of the ClpYQ protease when the genes are present in single copy has remained unknown. One possible function was suggested by work indicating that mutations inhslU (clpY) suppressed a dnaA46mutation at a high temperature and resulted in smaller cells under some growth conditions (23).

We began the work described here as part of a project to understand whether ClpY differs significantly from ClpA and ClpX in substrate recognition in vivo. While we found some preliminary evidence of overlap in function between the Clp proteases, we uncovered a significant overlap between ClpYQ and the single-component energy-dependent protease, Lon. Our results suggest that one function of ClpYQ is to serve as a secondary protease for some Lon substrates.

MATERIALS AND METHODS

Bacteria and plasmids.The relevant bacterial strains and plasmids used are listed in Table 1. plac-sulA2 is in the same vector as p21 (49) but contains a missense mutation in sulA. The mutant protein is degraded in a Lon-dependent fashion. The plac-sulA+ plasmid (p21) could not be transformed into the Δlon strains used here, presumably because the basal level of SulA expression was sufficient to kill cells in the absence of Lon. pUC4K (52) was used as the kanamycin-resistant plasmid in our Alp tester strain, in place of those described previously (27). Cells were grown in Luria broth (LB) (47) unless otherwise indicated. Antibiotics were added at the following concentrations, in micrograms per milliliter: ampicillin, 100; tetracycline, 10; and chloramphenicol, 100.

View this table:
  • View inline
  • View popup
Table 1.

Bacterial strains and plasmids

Plasmid constructions.The procedures used for cloning and restriction enzyme digestion were those described by Sambrook et al. (45). To clone the clpQclpY operon into a plasmid, a 6.5-kb EcoRI DNA fragment containing theclpQ+clpY+ operon and the adjoining genes was first isolated from the DNA of Kohara phage miniset 539 (phage 4H12) (28) and then ligated into the uniqueEcoRI site of pACYC184; the resulting plasmid was designated pWPC80. A 2.1-kb PCR-generated DNA fragment containingclpQclpY with EcoRI (forward primer, 5′CCGGAATTCCCGGGGGTTGAAACCC3′) and blunt ends (reverse primer, 5′AGCCACGCCTGAGTTCGG3′) was isolated from pWPC80 DNA and subcloned into the EcoRI and ScaI sites of plasmid pACYC184; the resulting plasmid was designated pWF1 (pACYC184clpQ+ clpY+). PCR amplification was performed with a Gene Amp kit as recommended by the manufacturer (Perkin-Elmer Cetus). Oligonucleotides were purchased from Bioserve Biotechnologies (Laurel, Md.).

To construct a plasmid which would have an interrupted clpQor clpY sequence, a cassette encoding chloramphenicol acetyltransferase (cat) with its own promoter was isolated by PstI digestion of pCat19 (9), ligated with either NsiI (interrupts clpQ)- or PstI (two sites within clpY)-digested pWF1 DNA (Fig.1). Chloramphenicol-resistant colonies were selected after transformation of JM101, resulting in pWF2 (pACYC184 clpQ::cat clpY+) and pWF3 (pACYC184 clpQ+clpY::cat). Either pACYC184 or pWF4 was used as a negative control. pWF4 was constructed by cutting with bothNsiI and PstI and ligating in the presence of thecat cassette used above. Therefore, this plasmid has deletions of both clpQ and clpY. The structures of pWF2, pWF3, and pWF4 were confirmed by restriction enzyme analysis. The cat gene is inserted such that the promoter faces in the same direction as clpQclpY operon transcription. Therefore, the clpQ::cat insertion is not polar for clpY, as confirmed by examination of the production of ClpY with anti-ClpY antibody (25) in strains carrying the plasmid (data not shown).

Fig. 1.
  • Open in new tab
  • Download powerpoint
Fig. 1.

Structure of the clpQY operon. The 3,683-bpBglI fragment that contains clpQY is drawn to scale. Restriction enzyme sites referred to in the text are indicated. Arrows show the direction of transcription. The inverted triangle represents the position of insertion of the cat gene, encoding chloramphenicol acetyltransferase, in the clpQ orclpY gene as described in Materials and Methods. The black bar shows the region deleted in the clpY::cat mutant.

Construction and characterization ofclpQ::cat andclpY::cat chromosomal mutants.The cat insertion mutations in clpQ orclpY were transferred to the chromosome by linear transformation into DB1255 with pWF2 (to create SG1186) or pWF3 (to create SG1185) cut with SacII and HindIII as previously described (3). Chloramphenicol-resistant colonies were purified, and the mutations were transduced to the wild-type host SG22119.

The positions of the insertions in the transductants were confirmed in a number of ways. Linkage of chloramphenicol resistance withargE::Tn10 was shown in P1 transductions by selecting for either Arg+ or chloramphenicol resistance and screening for the other marker, to confirm the expected location of clpY and clpQnear minute 89. Linkage was 25% when Arg+ recombinants were selected after transduction with aclpQ::cat arg+ donor and 29% when chloramphenicol-resistant recombinants were selected; therefore, there is no discrimination againstclpQ::cat recombinants. Isolates that demonstrated linkage to argE::Tn10 were subjected to Southern blot analysis.

Chromosomal DNA was extracted from wild-type strain SG22119 and insertion derivatives SG22192 (clpQ::cat) and SG22193 (clpY::cat) (47), digested with BglI, and subjected to gel electrophoresis through 1% agarose gels. The resolved DNA fragments in the gels were blotted to N+-bond membranes (Amersham) and subsequently probed separately with biotin-labelled clpQ-, clpY-, andcat-specific DNA probes. After overnight hybridization at 42°C, the membranes were washed with washing buffer several times at 42°C as described in the Amersham Photo-Gene nucleic acid detection system instructions and developed with the Amersham ECL system as described by the manufacturer. As expected (see restriction map in Fig.1), a single BglI fragment detected in the wild-type DNA was missing from the clpQ::cat andclpY::cat strains and a new fragment that hybridized with the cat marker was detected in these strains (data not shown).

To further confirm that the ClpQ and ClpY proteins were not being produced from the clpQ::cat andclpY::cat strains, respectively, a Western blot assay with anti-ClpQ or anti-ClpY serum was performed. The antibodies used were raised to proteins purified after the expression of ClpQ and ClpY from T7 promoters (25). As expected, theclpQ::cat strain made ClpY but not ClpQ, and the clpY::cat strain expressed ClpQ but not ClpY (data not shown).

Cell growth and temperature sensitivity.Overnight cultures of the wild type and both single and double mutants grown at 32°C were diluted into medium, regrown to the mid-exponential phase, serially diluted, and spotted on LB agar plates; efficiencies of plating (EOP) were determined as a function of temperature.

MMS sensitivity.Cells were grown overnight at 30°C in LB, serial dilutions were made in LB or TMG buffer (0.01 M Tris [pH 7.4], 0.01 M MgSO4, 0.01% gelatin), and 10 μl of each dilution was spotted onto LB agar plates with and without 0.025% methyl methanesulfonate (MMS). EOP were determined by dividing the titer of cells forming colonies on the MMS plate by the titer of those on the LB agar plate after overnight incubation at various temperatures. Precise EOP of lon mutant derivatives at higher temperatures varied with the age of the MMS plate, but the general pattern remained the same in all cases.

SulA turnover in vivo.Cells were grown at 32°C in LB to an optical density at 600 nm of 0.2, collected by centrifugation, and redissolved in a 1/10 volume of 0.01 M Mg2SO4. Cells were exposed to UV irradiation at 20 J/m2 and diluted to the original volume in LB, and growth was continued in the dark. For the measurement of SulA decay at 32°C, growth was continued for 25 min before the addition of spectinomycin (150 μg/ml) to inhibit further protein synthesis; for the measurement of SulA decay at 41.5°C, cells were shifted to 41.5°C immediately after UV treatment and incubated for 10 min before spectinomycin addition. Samples were removed at intervals, and the protein was precipitated with 5% trichloroacetic acid in the cold. Pellets were washed with 80% acetone and resuspended in sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) loading buffer (29). Equal amounts of samples normalized for the original optical density were loaded, electrophoresed by SDS-PAGE (14 or 15% polyacrylamide), blotted to 0.2-μm-pore-size nitrocellulose, and probed with anti-SulA antibody (49). Western blots were developed with the ECL system and quantitated by scanning with an Eagle Eye II (Strategene, La Jolla, Calif.).

Visualization of SulA2 (a mutant form of SulA) from plasmid plac-SulA2 was carried out with cells grown in LB-ampicillin and induced for 30 min with isopropyl-β-d-thiogalactopyranoside (IPTG) before samples were collected and processed as described above.

Enzyme assays.β-Galactosidase assays were performed as described by Miller (37) with an SDS lysis method. Cells were grown in LB and assayed by the addition ofo-nitrophenyl-β-d-galactoside. Assays were performed at least twice with samples from independent cultures.

RESULTS

clpQ+ clpY +-dependent suppression of lon mutant phenotypes. lonmutants are sensitive to DNA damage and die after exposure to MMS or UV light, due to the accumulation of the unstable Lon substrate SulA, a cell division inhibitor (19, 40). In addition,lon mutations lead to the stabilization and accumulation of RcsA, a positive regulator for the transcription of genes involved in capsule production, resulting in high levels of transcription of thecps genes (capsule synthesis genes) (11, 35, 48; for a review, see reference 12). The clpY+ clpQ+ plasmid pWF1 and the two mutant derivatives, pWF2 (clpQ::cat clpY+) and pWF3 (clpQ+clpY::cat) were introduced into either SG22186, a Δlon strain, to measure MMS sensitivity or SG20780, a Δlon strain carrying acpsB10::lac transcriptional fusion. In the latter strain, the levels of β-galactosidase expression reflect RcsA levels, and cells can also be tested for MMS sensitivity.

The results of these tests are shown in Table2. Both the MMS sensitivity and the capsule overproduction of lon mutants were suppressed by theclpQ+ clpY+ plasmid (lines two and three) but not by clpY or clpQ mutant plasmids (lines four and five). The clpQ+clpY+ plasmid but not a mutant plasmid also suppressed the mucoidy of a cps+ Δlon strain, JT4000 (49), consistent with an effect of ClpYQ on capsule synthesis and not simply an effect on thecpsB::lacZ transcriptional fusion (data not shown). Therefore, it appears that ClpYQ is capable of recognizing two different Lon substrates, SulA and RcsA. Suppression of the DNA damage sensitivity of lon mutants by plasmids overproducing ClpQ and ClpY (HslV-HslU) was independently demonstrated by Khattar in a search for multicopy plasmids that could render lonmutants resistant to nitrofurantoin, an SOS-inducing agent (26).

View this table:
  • View inline
  • View popup
Table 2.

Overproduction of ClpYQ suppresses two lonmutant phenotypes

To confirm that the MMS-resistant phenotype of Δlon mutant cells carrying the clpQ+ clpY+plasmid is due to increased degradation of SulA, we measured the accumulation of a mutant form of SulA, SulA2, made from a compatible multicopy plasmid. Western blot analysis with SulA-specific antiserum demonstrated that, while SulA2 could be detected in the lonmutant host (Fig. 2, lane 3), it did not accumulate sufficiently to be detected in either thelon+ host (lane 2) or the lon mutant host carrying the multicopy clpQ+clpY+ plasmid (lane 4). However, Δlonmutant cells with plasmid pWF2 (clpQ::cat clpY+) or pWF3 (clpQ+clpY::cat) showed a significant accumulation of SulA2 (Fig. 2, lanes 5 and 6). Therefore, SulA2 accumulates only in cells which are MMS sensitive, supporting a model for the recognition and rapid degradation of both chromosomally encoded SulA (based on the MMS sensitivity test results shown in Table 2) and mutant SulA2 (Fig.2) in lon+ cells and in Δlon cells overexpressing ClpYQ protease.

Fig. 2.
  • Open in new tab
  • Download powerpoint
Fig. 2.

Accumulation of SulA2 in cells overproducing ClpYQ. Cells transformed with either pACYC184 (lanes 2 and 3) or pWF1 (clpQ+ clpY+), pWF2 (clpQ::cat clpY+), or pWF3 (clpQ+ clpY::cat) were grown at 30°C in LB to an optical density at 595 nm of 0.5 and induced with IPTG at a final concentration of 5 mM for 30 min. Samples were subjected to electrophoresis and Western blotting for SulA as described in Materials and Methods. The lon+host was SG22163, and the Δlon host was SG22186; both of these strains carry lacIq integrated at themal locus and the plac::SulA2 plasmid. Lane 1 was a control loaded with purified SulA.

Phenotypes of clpY and clpQ mutants.The clpQ::cat and clpY::cat insertion mutations were transferred from the plasmid to the chromosome by linear transformation. The structure of the gene carrying the insertion was confirmed by Southern blotting and by Western blotting to demonstrate the absence of the appropriate protein. Linkage to a nearby marker in P1 transduction confirmed that neither clpQ norclpY is essential for E. coli growth (see Materials and Methods for details). Strains carryingclpQ::cat orclpY::cat either alone or in combination with single mutations in clpA, clpB,clpX, clpP, or lon did not show impaired cell growth at temperatures up to 42°C. It has been reported that hslVU (clpYQ) mutant cells show temperature sensitivity at a very high temperature (44°C) (23, 38). Kanemori et al. have also found that triple mutants (hsl clpP lon) are both cold and temperature sensitive (22). While we did not test our double mutations at temperatures higher than 42°C, one general conclusion from all studies is that ClpYQ is not essential for E. coli growth in the normal temperature range for this organism, except under special circumstances.

The ability of the ClpYQ protease to degrade Lon substrates when overproduced suggested that it might be responsible for the residual degradation of Lon substrates in lon mutants. SulA, RcsA, and lambda N protein are all degraded at significant rates in alon mutant (21). Isogenic strains carrying either the single clpY, clpQ, or lon mutation or combinations of lon and clp mutations were examined for Lon phenotypes and turnover of SulA. Inlon+ hosts, neither the EOP on MMS (a measure of SulA stability) nor the expression ofcps::lac fusions (a measure of RcsA stability) was affected by clpQ and clpYmutations (data not shown). Therefore, Lon does not require ClpY or ClpQ to function normally.

lon mutant cells were, as expected, MMS sensitive (EOP at 32°C, 10−5 (Table 3). At elevated temperatures, however, lon mutants were relatively MMS resistant (Table 3). This reduced sensitivity to DNA damage at elevated temperatures is consistent with the results of previous work by Canceill and coworkers (4). However, double mutants containing lon and either clpY or clpQmutations remained significantly MMS sensitive even at 41°C (Table3). This finding is consistent with a contribution of physiological levels of ClpYQ to the degradation of SulA at elevated temperatures. The MMS sensitivity of strains was dependent upon SulA inhibition of FtsZ. lon clpY or lon clpQ mutant cells carrying the ftsZ(SfiB*) mutation, an allele of ftsZ that blocks SulA interaction with FtsZ, were fully resistant to MMS at all temperatures (data not shown).

View this table:
  • View inline
  • View popup
Table 3.

ClpY and ClpQ contribute to the MMS sensitivity oflon mutants

Contribution of ClpYQ to the turnover of SulA, a Lon substrate.To examine directly the contribution of ClpYQ to the degradation of SulA, we measured the turnover of SulA inlon+, Δlon, Δlon clpQ::cat, and Δlon clpY::cat cells at 32 and 41.5°C. Chromosomally encoded SulA was induced by UV treatment, and decay was measured by Western blotting during a chase period after treatment with spectinomycin to inhibit further protein synthesis. In initial experiments, the turnover of a plasmid-encoded mutant form of SulA, SulA2, was studied. Because the degradation of this protein in lon mutants was more rapid than expected (data not shown), we repeated the experiments with chromosomally encoded SulA either in strains in which SulA was active (ftsZ+) or in strains in which SulA was unable to act due to a mutation [ftsZ(SfiB*)] in the target of SulA inhibition (4).

The results of the experiments examining SulA decay at 32°C are shown in Fig. 3A and C; those obtained at 41.5°C are shown in Fig. 3B and D. In separate experiments, no SulA was detected in Western blots of lon+ hosts with or without clpYQ; therefore, the half-life could not be calculated directly in these experiments. From previous experiments from various laboratories, we expected a half-life of less than 2 min for SulA in the presence of Lon (21, 40). Kanemori et al. have reported a half-life of 1 to 2 min for SulA inlon+ hosts carrying a deletion ofhslVU (clpQY) (22).

Fig. 3.
  • Open in new tab
  • Download powerpoint
Fig. 3.

Turnover of SulA in lon clpQY mutants. Strains were grown at 32°C in LB and exposed to UV light as described in Materials and Methods. After dilution to the original volume in LB, growth was continued in the dark for 25 min at 32°C (A and C) or for 10 min at 41.5°C (B and D). Spectinomycin (150 μg/ml) was added to inhibit further protein synthesis, and samples were removed and processed for Western blotting with anti-SulA antibody as described in Materials and Methods. (A) ftsZ+ strains SG22186, SG22207, and SG22208 (panels from left to right) at 32°C. (B) ftsZ+ strains at 41.5°C. (C)ftsZ(SfiB*) strains SG22224, SG22225, and SG22226 (panels from left to right) at 32°C. (D) ftsZ(SfiB*) strains at 41.5°C. Lanes U contained lon mutant hosts sampled before UV induction (uninduced) to indicate the position of the UV-inducible SulA band. Half-lives (t1/2) were determined by scanning of the Western blots. Because many of the 5-min spots showed more protein than 0-min samples, presumably due to the delayed action of spectinomycin, the half-lives were calculated with the 5-min samples as time-zero samples.

At 32°C, SulA was relatively stable in a lon host (half-life, 30 min, comparable to that reported previously); however, it became more stable in the lon clpQ and lon clpY double mutants (half-lives, 95 to 120 min; Fig. 3A). When the degradation of SulA was measured at 41.5°C, SulA was significantly more unstable (half-life, 15 min); here, too, the lon clpQand lon clpY double mutants showed greater SulA stability (half-life, 45 min; Fig. 3B). In initial experiments done with a SulA mutant expressed from a plasmid (data not shown) and in other work (51), we noted that SulA is significantly more unstable when the interaction of SulA with FtsZ is absent. To assess the effect of the ClpYQ protease in that situation, we repeated the SulA turnover experiments with a host carrying a mutation in ftsZ that blocks the SulA interaction, called SfiB* (Fig. 3C and D). As expected, SulA turnover increased in the Δlon host (9-min half-life at 32°C and 3.5-min half-life at 41.5°C). However, this increased instability was primarily due to ClpYQ; in lon clpY andlon clpQ mutants, SulA was once more reasonably stable (48- to 60-min half-life at 32°C and 32- to 37-min half-life at 41.5°C). Therefore, at both low and high temperatures, ClpY and ClpQ are primarily responsible for the Lon-independent degradation of SulA, although at least one other protease must also be able to degrade SulA, particularly at high temperatures.

ClpYQ is not associated with Alp+ function.We previously reported an activity, called the Alp protease, capable of suppressing Lon (27, 49, 50). Under conditions in which Alp activity is high, both the UV sensitivity and the capsule overproduction of lon mutants are suppressed. Because these results parallel those seen with ClpYQ overproduction, we were interested in determining whether ClpYQ is responsible for Alp activity. Mutations in clpY or clpQ were transduced into the Alp indicator strain JK6214/pUC4K, and the capsule synthesis phenotype of the cells (an indirect assay for RcsA degradation and therefore Alp activity) was compared to that of the parental clpY+ clpQ+ host. If the ClpYQ protease is the only protease degrading RcsA in cells expressing Alp activity, we would expect to abolish suppression of lonin the clpY or clpQ mutant. However, no such change was observed; when cells were scored on MacConkey agar plates, strains with or without ClpYQ showed a Lac− phenotype, consistent with the degradation of RcsA and therefore an Alp+ phenotype.

DISCUSSION

The overproduction of the ClpYQ protease leads to the suppression of two lon mutant phenotypes, MMS sensitivity and capsule overproduction, dependent on two different Lon substrates, SulA and RcsA. Furthermore, MMS resistance correlates with a failure to accumulate SulA, consistent with the rapid degradation of SulA when ClpYQ is overproduced. Both subunits of the ClpYQ protease are necessary for SulA degradation. In vitro, both subunits are required for the ATP-dependent degradation of casein (25). Khattar independently identified ClpYQ in a search for multicopy suppressors of the sensitivity of lon mutants to the SOS inducer nitrofurantoin (26).

The overlap in substrate specificity between Lon and ClpYQ is observed not only for overproduced ClpYQ but also for the protease produced at normal physiological levels. SulA is more stable in lon clpQand lon clpY double mutants than in the lonsingle mutant. At elevated temperatures, this additional stability correlates with increased MMS sensitivity. Therefore, SulA is a natural substrate for ClpYQ under physiological conditions but is normally degraded much more rapidly by Lon, so that no MMS sensitivity phenotype is detected for clpY or clpQ mutants unless Lon is also absent. The existence of secondary, energy-dependent proteases that can degrade SulA in the absence of Lon had been noted before (4, 21), but the responsible protease had not been identified. More recently, Kanemori and coworkers found that cells devoid of Lon, ClpP, and HslUV (ClpYQ) become sensitive to both low and high temperatures because of the stabilization of SulA; they found, as we have, that ClpYQ contributes significantly to the degradation of SulA in a lon mutant host (22). They also demonstrated that HslUV can degrade SulA in vitro (22). From the results of both groups, we can conclude that the degradation by ClpYQ is critical both for maintaining a low basal level of SulA in the absence of induction and for returning SulA to the basal level after transient induction.

SulA acts as a cell division inhibitor by interacting with and inhibiting the activity of FtsZ, an essential GTPase necessary for septum formation (6, 7, 41, 42). The synthesis of SulA is dependent upon the induction of the SOS response (18, 39). Under normal (Lon+) conditions, SulA synthesis increases transiently after DNA damage and the accumulating SulA inhibits cell division. After the damage is repaired, new SulA synthesis ceases and SulA is rapidly degraded, allowing cell division to resume. There is evidence that SulA and FtsZ directly interact and that this interaction can modulate the sensitivity of SulA to degradation. The in vivo stability of SulA is increased in the presence of excess FtsZ (1, 20), and specific mutations in FtsZ are resistant to SulA inhibition (19, 31, 32). Recent experiments have demonstrated a direct interaction between SulA and FtsZ (16, 17).

For SulA to inhibit cell division in a fashion that can be reversed once DNA damage is repaired and new SulA synthesis ceases (33), the interaction of SulA and FtsZ must be reversible. This reversal may involve either dissociation of SulA from FtsZ sufficiently to allow protease degradation or degradation of SulA directly from the SulA-FtsZ complex by the protease (or both). Because the half-life of SulA is so short (<2 min) in alon+ host (21, 40, 49) and no SulA accumulates in lon+ hosts even when SulA is overproduced from a plasmid (Fig. 2), Lon appears able to degrade SulA rapidly whether or not FtsZ interacts with SulA.

For the degradation of SulA by secondary proteases, in particular, ClpYQ, the data suggest that an interaction with FtsZ has a profound effect on the ability of the protease to act. Thus, the half-life of SulA is 30 min in the ftsZ+ host at 32°C but only 9 min in the SfiB* host (Fig. 3A and C). At higher temperatures, there is a similar significant increase in SulA turnover in the absence of FtsZ (Fig. 3B and D). We can imagine a number of explanations. Possibly, ClpYQ recognizes motifs within SulA that are shielded by FtsZ, while Lon recognizes an unshielded motif. Given the overlap of Lon and ClpYQ activities for both SulA and RcsA, it seems to us more likely that both proteases recognize similar motifs. A second possibility is that SulA and FtsZ dissociate transiently during the SulA-dependent inhibition of cell division and that this dissociation is necessary for degradation by any of the proteases. In this case, the affinity of Lon for SulA may be sufficiently high to allow capture and degradation of the released SulA, while the dissociation is too brief for ClpYQ to capture the dissociated SulA before it reassociates with FtsZ. A final explanation is that while similar motifs are recognized by both proteases, Lon is able to actively dissociate SulA from FtsZ, a necessary step for degradation, while ClpYQ cannot remove SulA from the SulA-FtsZ complex. This model predicts a chaperone-like activity for Lon.

The role of ClpYQ in degrading SulA becomes physiologically important in lon mutants at high temperatures. It had been observed by others that lon mutants are relatively resistant to DNA damage at high temperatures (4), and we have confirmed that finding (Table 3). We found a shorter half-life for SulA at high temperatures (15 min rather than 30 min). When the ClpYQ protease is inactivated by a mutation, the SulA half-life increases to 45 min and cells once again become MMS sensitive. Therefore, there is a correlation between a longer SulA half-life and MMS sensitivity. These data suggest that, given that a certain amount of SulA is made during a transient induction period, a half-life of 15 min or less is long enough for the level of SulA to fall below the active threshold in an acceptable period of time; when the half-life is 30 min (as it is at 32°C) or longer (as it is in the lon clpQ double mutant at 41.5°C), SulA is present long enough to be lethal. While Canceill et al. (4) found more rapid degradation of SulA at 42°C than at 30°C, as we did, they found very similar half-lives for SulA overproduced from a lac promoter at 30 and 42°C in an SfiB* host and therefore concluded that protection by FtsZ was at least partially lost at higher temperatures. It is possible that under their conditions, the ClpYQ protease is limiting for SulA degradation.

What is the basis for the shorter half-life of SulA in lonmutants at high temperatures? One obvious possibility is increased synthesis of ClpYQ, a heat shock protease, at higher temperatures (5). This notion assumes that ClpYQ is limiting for SulA degradation at lower temperatures, and it is certainly true that more ClpYQ (presence of a multicopy plasmid in the host) increases SulA degradation and MMS sensitivity even at lower temperatures. Another possibility is that suggested by Canceill et al. (4), a weakening of the SulA-FtsZ interaction. In this case, more rapid degradation might be a secondary consequence of a weaker SulA-FtsZ interaction, providing more opportunity for ClpYQ to degrade the free SulA. However, not all of the FtsZ-SulA interaction can be lost at 41.5°C. If it were, the ftsZ(SfiB*) mutation should have no effect on the half-life of SulA at higher temperatures, and it still has a significant effect (Fig. 3B and D). The expression of ClpYQ under the control of a heterologous promoter would help in sorting out whether changing levels of the protease or changing forms of the substrate are most important at high temperatures.

The multimeric structure and protein sequence of the Lon protease and ClpYQ appear to be very different, making the overlap in substrate specificity somewhat unexpected. While the Lon multimer is composed of a single subunit, containing both an ATP binding site consensus sequence and a proteolytic serine active site, ClpYQ is a composite protease, with a catalytic threonine active site in the peptidase subunit and the ATPase activity in a separate subunit (2, 13, 25, 44, 46, 54). Extrapolating from what is known about the Clp proteases, it seems likely that the amino terminus of Lon, including the ATPase domain, and the ATPase of ClpYQ, ClpY, contain the information for substrate recognition. It has been proposed that the Clp ATPases, the ATPase domain of Lon, and the AAA ATPases (named AAA for ATPases associated with a variety of activities) associated with the eukaryotic proteasome have similar general structures (30). Hopefully, more information on these predicted shared structures will provide insight into the shared substrate specificity.

Although we demonstrate that the ClpYQ protease is capable of degrading Lon targets and serves as a secondary protease for SulA degradation, it seems likely that there exist naturally unstable proteins for which the ClpYQ protease is the primary protease. These targets remain to be found.

ACKNOWLEDGMENTS

We thank William Clark for construction of the pWPC80 plasmid; M. Khattar for communicating results prior to publication; and M. Kanemori, H. Yanagi, and T. Yura for sharing results prior to publication and delaying publication of their paper to allow copublication. We thank members of the Laboratory of Molecular Biology and Michael Maurizi for ongoing discussions and comments on the manuscript.

FOOTNOTES

    • Received 19 February 1999.
    • Accepted 7 April 1999.
  • Copyright © 1999 American Society for Microbiology

REFERENCES

  1. 1.↵
    1. Bi E.,
    2. Lutkenhaus J.
    Analysis of ftsZ mutations that confer resistance to the cell division inhibitor SulA (SfiA).J. Bacteriol.172199056025609
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Bochtler M.,
    2. Ditzel L.,
    3. Groll M.,
    4. Huber R.
    Crystal structure of heat shock locus V (HslV) from Escherichia coli.Proc. Natl. Acad. Sci. USA94199760706074
    OpenUrlAbstract/FREE Full Text
  3. 3.↵
    1. Brill J. A.,
    2. Quinlan-Walshe C.,
    3. Gottesman S.
    Fine-structure mapping and identification of two regulators of capsule synthesis in Escherichia coli K-12.J. Bacteriol.170198825992611
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Canceill D.,
    2. Dervyn E.,
    3. Huisman O.
    Proteolysis and modulation of the activity of the cell division inhibitor SulA in Escherichia coli lon mutants.J. Bacteriol.172199072977300
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Chuang S.-E.,
    2. Burland I. G. P. B.,
    3. Daniels D. L.,
    4. Blattner F. R.
    Sequence analysis of four new heat-shock genes constituting the hslTS/ibpAB and hslVU operons in Escherichia coli.Gene134199316
    OpenUrlCrossRefPubMedWeb of Science
  6. 6.↵
    1. Dai K.,
    2. Lutkenhaus J.
    ftsZ is an essential cell division gene in Escherichia coli.J. Bacteriol.173199135003506
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. de Boer P. A. J.,
    2. Crossley R.,
    3. Rothfield L.
    The essential bacterial cell-division protein FtsZ is a GTPase.Nature3591992254256
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.
    1. Dervyn E.,
    2. Canceill D.,
    3. Huisman O.
    Saturation and specificity of the Lon protease of Escherichia coli.J. Bacteriol.172199070987103
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Fuqua W. C.
    An improved chloramphenicol resistance gene cassette for site-directed marker replacement mutagenesis.BioTechniques121992223225
    OpenUrlPubMed
  10. 10.↵
    1. Gottesman S.
    Proteases and their targets in Escherichia coli.Annu. Rev. Genet.301996465506
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    1. Gottesman S.
    Regulation by proteolysis Escherichia coli and Salmonella typhimurium: cellular and molecular biology. Neidhardt F. C., Ingraham J. L., Low K. B., Magasanik B., Schaechter M., Umbarger H. E. 1987 1308 1312 American Society for Microbiology Washington, D.C
  12. 12.↵
    1. Gottesman S.
    Roles for energy-dependent proteases in regulatory cascades Regulation of gene expression in Escherichia coli. R. G. Lin E. C. C., Lynch A. S. 1996 503 519 Landes Co. Austin, Tex
  13. 13.↵
    1. Gottesman S.,
    2. Clark W. P.,
    3. de Crecy-Lagard V.,
    4. Maurizi M. R.
    ClpX, an alternative subunit for the ATP-dependent Clp protease of Escherichia coli.J. Biol. Chem.26819932261822626
    OpenUrlAbstract/FREE Full Text
  14. 14.
    1. Gottesman S.,
    2. Roche E.,
    3. Zhou Y.-N.,
    4. Sauer R. T.
    The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system.Genes Dev.12199813381347
    OpenUrlAbstract/FREE Full Text
  15. 15.
    1. Gottesman S.,
    2. Trisler P.,
    3. Torres-Cabassa A. S.
    Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes.J. Bacteriol.162198511111119
    OpenUrlAbstract/FREE Full Text
  16. 16.↵
    1. Higashitani A.,
    2. Ishii Y.,
    3. Kato Y.,
    4. Horiuchi K.
    Functional dissection of a cell-division inhibitor, SulA, of Escherichia coli and its negative regulation by Lon.Mol. Gen. Genet.2541997351357
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    1. Huang J.,
    2. Cao C.,
    3. Lutkenhaus J.
    Interaction between FtsZ and inhibitors of cell division.J. Bacteriol.178199650805085
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Huisman O.,
    2. D’Ari R.
    An inducible DNA-replication-cell division coupling mechanism in E. coli.Nature2901981797799
    OpenUrlCrossRefPubMedWeb of Science
  19. 19.↵
    1. Huisman O.,
    2. D’Ari R.,
    3. Gottesman S.
    Cell division control in Escherichia coli: specific induction of the SOS SfiA protein is sufficient to block septation.Proc. Natl. Acad. Sci. USA81198444904494
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Jones C.,
    2. Holland I. B.
    Role of the SulB (FtsZ) protein in division inhibition during the SOS response in Escherichia coli: FtsZ stabilizes the inhibitor SulA in maxicells.Proc. Natl. Acad. Sci. USA82198560456049
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Jubete Y.,
    2. Maurizi M. R.,
    3. Gottesman S.
    Role of the heat shock protein DnaJ in the Lon-dependent degradation of naturally unstable proteins.J. Biol. Chem.27119963079830803
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Kanemori M.,
    2. Yanagi H.,
    3. Yura T.
    The ATP-dependent HslVU/ClpQY protease participates in turnover of cell division inhibitor SulA in Escherichia coli.J. Bacteriol.181199936743680
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Katayama T.,
    2. Kubota T.,
    3. Takata M.,
    4. Akimitsu N.,
    5. Sekimizu K.
    Disruption of the hslU gene, which encodes an ATPase subunit of the eukaryotic 26S proteasome homolog in Escherichia coli, suppresses the temperature-sensitive dnaA46 mutation.Biochem. Biophys. Res. Commun.2291996219224
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Katayama-Fujimura Y.,
    2. Gottesman S.,
    3. Maurizi M. R.
    A multiple-component ATP-dependent protease from Escherichia coli.J. Biol. Chem.262198744774485
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Kessel M.,
    2. Wu W.-F.,
    3. Gottesman S.,
    4. Kocsis E.,
    5. Steven A. C.,
    6. Maurizi M. R.
    Six-fold rotational symmetry of ClpQ, the E. coli homolog of the 20S proteasome, and its ATP-dependent activator, ClpY.FEBS Lett.3981996274278
    OpenUrlCrossRefPubMedWeb of Science
  26. 26.↵
    1. Khattar M. M.
    Overexpression of the hslVU operon suppresses SOS-mediated inhibition of cell division in Escherichia coli.FEBS Lett.4141997402404
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Kirby J. E.,
    2. Trempy J. E.,
    3. Gottesman S.
    Excision of a P4-like cryptic prophage leads to Alp protease expression in Escherichia coli.J. Bacteriol.176199420682081
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Kohara Y.,
    2. Akiyama K.,
    3. Isono K.
    The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library.Cell501987495508
    OpenUrlCrossRefPubMedWeb of Science
  29. 29.↵
    1. Laemmli U. K.
    Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature (London)2271970680685
    OpenUrlCrossRefPubMedWeb of Science
  30. 30.↵
    1. Lupas A.,
    2. Flanagan J. M.,
    3. Tamura T.,
    4. Baumeister W.
    Self-compartmentalizing proteases.Trends Biochem. Sci.221997399404
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    1. Lutkenhaus J.,
    2. Sanjanwala B.,
    3. Lowe M.
    Overproduction of FtsZ suppresses sensitivity of lon mutants to division inhibition.J. Bacteriol.1661986756762
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Lutkenhaus J. F.
    Coupling of DNA replication and cell division: sulB is an allele of ftsZ.J. Bacteriol.154198313391346
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Maguin E.,
    2. Lutkenhaus J.,
    3. D’Ari R.
    Reversibility of SOS-associated division inhibition in Escherichia coli.J. Bacteriol.1661986733738
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    1. Maurizi M. R.,
    2. Clark W. P.,
    3. Katayama Y.,
    4. Rudikoff S.,
    5. Pumphrey J.,
    6. Bowers B.,
    7. Gottesman S.
    Sequence and structure of ClpP, the proteolytic component of the ATP-dependent Clp protease of Escherichia coli.J. Biol. Chem.26519901253612545
    OpenUrlAbstract/FREE Full Text
  35. 35.↵
    1. Maurizi M. R.,
    2. Trisler P.,
    3. Gottesman S.
    Insertional mutagenesis of the lon gene in Escherichia coli: lon is dispensable.J. Bacteriol.164198511241135
    OpenUrlAbstract/FREE Full Text
  36. 36.
    1. Messing J.,
    2. Crea R.,
    3. Seeburg P. H.
    A system for shotgun DNA sequencing.Nucleic Acids Res.91981309321
    OpenUrlCrossRefPubMedWeb of Science
  37. 37.↵
    1. Miller J. H.
    Experiments in bacterial genetics. 1972 Cold Spring Harbor Laboratory Cold Spring Harbor, N.Y
  38. 38.↵
    1. Missiakas D.,
    2. Schwager F.,
    3. Betton J. M.,
    4. Georgopoulos C.,
    5. Raina S.
    Identification and characterization of HslV HslU (ClpQ ClpY) proteins involved in overall proteolysis of misfolded proteins in Escherichia coli.EMBO J.15199668996909
    OpenUrlPubMedWeb of Science
  39. 39.↵
    1. Mizusawa S.,
    2. Court D.,
    3. Gottesman S.
    Transcription of the sulA gene and repression by LexA.J. Mol. Biol.1711983337343
    OpenUrlCrossRefPubMedWeb of Science
  40. 40.↵
    1. Mizusawa S.,
    2. Gottesman S.
    Protein degradation in Escherichia coli: the lon gene controls the stability of the SulA protein.Proc. Natl. Acad. Sci. USA801983358362
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    1. Mukherjee A.,
    2. Dai K.,
    3. Lutkenhaus J.
    Escherichia coli cell division protein FtsZ is a guanine nucleotide binding protein.Proc. Natl. Acad. Sci. USA90199310531057
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. RayChaudhuri D.,
    2. Park J. T.
    Escherichia coli cell-division gene ftsZ encodes a novel GTP-binding protein.Nature3591992251254
    OpenUrlCrossRefPubMedWeb of Science
  43. 43.↵
    1. Rohrwild M.,
    2. Coux O.,
    3. Huang H.-C.,
    4. Moerschell R. P.,
    5. Yoo S. J.,
    6. Seol J. H.,
    7. Chung C. H.,
    8. Goldberg A. L.
    HslV-HslU: a novel ATP-dependent protease complex in Escherichia coli related to the eukaryotic proteasome.Proc. Natl. Acad. Sci. USA93199658085813
    OpenUrlAbstract/FREE Full Text
  44. 44.↵
    1. Rohrwild M.,
    2. Pfeifer G.,
    3. Santarius U.,
    4. Muller S. A.,
    5. Huang H.-C.,
    6. Engel A.,
    7. Baumeister W.,
    8. Goldberg A. L.
    The ATP-dependent HslVU protease from Escherichia coli is a four-ring structure resembling the proteasome.Nat. Struct. Biol.41997133139
    OpenUrlCrossRefPubMedWeb of Science
  45. 45.↵
    1. Sambrook J.,
    2. Fritsch E. F.,
    3. Maniatis T.
    Molecular cloning: a laboratory manual 2nd ed. 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y
  46. 46.↵
    1. Seemuller E.,
    2. Lupas A.,
    3. Stock D.,
    4. Lowe J.,
    5. Huber R.,
    6. Baumeister W.
    Proteasome from Thermoplasma acidophilum: a threonine protease.Science2681995579582
    OpenUrlAbstract/FREE Full Text
  47. 47.↵
    1. Silhavy T. J.,
    2. Berman M. L.,
    3. Enquist L. W.
    Experiments with gene fusions. 1984 Cold Spring Harbor Laboratory Cold Spring Harbor, N.Y
  48. 48.↵
    1. Torres-Cabassa A. S.,
    2. Gottesman S.
    Capsule synthesis in Escherichia coli K-12 is regulated by proteolysis.J. Bacteriol.1691987981989
    OpenUrlAbstract/FREE Full Text
  49. 49.↵
    1. Trempy J. E.,
    2. Gottesman S.
    Alp, a suppressor of lon protease mutants in Escherichia coli.J. Bacteriol.171198933483353
    OpenUrlAbstract/FREE Full Text
  50. 50.↵
    1. Trempy J. E.,
    2. Kirby J. E.,
    3. Gottesman S.
    Alp suppression of Lon: dependence on the slpA gene.J. Bacteriol.176199420612067
    OpenUrlAbstract/FREE Full Text
  51. 51.↵
    Van Melderen, L., and S. Gottesman. Substrate sequestration by a proteolytically inactive Lon mutant. Proc. Natl. Acad. Sci. USA, in press.
  52. 52.↵
    1. Vieira J.,
    2. Messing J.
    An M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.Gene191982259268
    OpenUrlCrossRefPubMedWeb of Science
  53. 53.
    1. Wyman A. R.,
    2. Wolfe L. B.,
    3. Botstein D.
    Propagation of some human DNA sequences in bacteriophage λ vectors requires mutant Escherichia coli hosts.Proc. Natl. Acad. Sci. USA82198528802884
    OpenUrlAbstract/FREE Full Text
  54. 54.↵
    1. Yoo S. J.,
    2. Him Y. K.,
    3. Seong I. S.,
    4. Seol J. H.,
    5. Kang M. S.,
    6. Chung C. H.
    Mutagenesis of two N-terminal Thr and five Ser residues in HslV, the proteolytic component of the ATP-dependent HslVU protease.FEBS Lett.41219975760
    OpenUrlCrossRefPubMed
PreviousNext
Back to top
Download PDF
Citation Tools
Redundant In Vivo Proteolytic Activities ofEscherichia coli Lon and the ClpYQ (HslUV) Protease
Whi-Fin Wu, YanNing Zhou, Susan Gottesman
Journal of Bacteriology Jun 1999, 181 (12) 3681-3687; DOI: 10.1128/JB.181.12.3681-3687.1999

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Bacteriology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Redundant In Vivo Proteolytic Activities ofEscherichia coli Lon and the ClpYQ (HslUV) Protease
(Your Name) has forwarded a page to you from Journal of Bacteriology
(Your Name) thought you would be interested in this article in Journal of Bacteriology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Redundant In Vivo Proteolytic Activities ofEscherichia coli Lon and the ClpYQ (HslUV) Protease
Whi-Fin Wu, YanNing Zhou, Susan Gottesman
Journal of Bacteriology Jun 1999, 181 (12) 3681-3687; DOI: 10.1128/JB.181.12.3681-3687.1999
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Adenosine Triphosphatases
Endopeptidase Clp
Endopeptidases
Escherichia coli
Escherichia coli Proteins
Heat-Shock Proteins
operon
Protease La
Serine Endopeptidases

Related Articles

Cited By...

About

  • About JB
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jbacteriology

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0021-9193; Online ISSN: 1098-5530