Article Figures & Data
Figures
- Fig. 1.
Experimental strategy to examine conjugal transfer in the absence of plasmid vegetative replication.
- Fig. 2.
Map of R1162 (top) and fragments of R1162 DNA in the different plasmids used in this study. The horizontal bar, interrupted at the site of a deletion, indicates the R1162 DNA present in each plasmid. The filled regions of the bar designate the locations of the origin of replication (oriV) and the origin of transfer (oriT). The locations and direction of transcription of the genes for replication (rep), mobilization (mob), resistance to streptomycin (Sm1 and Sm2), and resistance to sulfonamides (Su) are shown by the arrows on the map of R1162. Those genes retained in the other plasmids are indicated in each case. The inverted triangles indicate the locations of cloned DNA containing either attP, a gene for chloramphenicol resistance (Cm), or a 14-bp oligonucleotide insertion. Construction of these plasmids is outlined in Table 1.
- Fig. 3.
Plasmid DNA in MV12 Nalr(pUT459) (lane a) and in derivatives containing pUT1557, constructed by transformation (lane b) or by conjugal mating with the donor strain containing helper plasmid pUT1543 (lane c) or helper plasmid pUT1559 (lanes d to h). Each transconjugant for the plasmid DNA in lanes d to h was the result of an independent mating. The DNA was digested withEcoRI before being applied to an 0.8% agarose gel. In lanes c to h, faint, slowly migrating bands were observed. These are derived from the mobilizing vector R751. Lane i containsHindIII-digested λ DNA as marker.
Tables
- Table 1.
Plasmids used in this study
Plasmid Source, construction, and or reference Plasmids mobilized during conjugation pUT1557 Digestion of pUT1385 DNA (3) with FspI andBst1107I and ligation pUT1613 Insertion of a 493-bpHindIII-BamHI λ DNA fragment containing theattP gene (1) into pUT1557 at the HpaI site containing oligonucleotide GGAAGCTTCGCGGATCCCC for cloning Helper plasmids for replication in donor pUT1543 HincII-EcoO109 R1162 DNA fragment, containing a 48-bp oriT deletion (22), cloned at the EcoRV site of pBR3227 pUT1559 ScaI-EcoO109 R1162 DNA fragment, containing a 48-bp oriT deletion (22), cloned at the EcoRV site of pBR322 7 pUT1582 Similar to pUT1543, but containing a 14-bp oligonucleotide (CTCGAGGCCTCGAG) inserted at the AflIII site pUT1548 Similar to pUT1559 but containing the same oligonucleotide insertion as pUT1582 pUT1581 Oligonucleotide-directed mutagenesis to create a 12-bp deletion removing the initiation codon and ribosome binding site for RepB′ synthesis and to create the AflIII site; the oligonucleotide TTAACGTGATAATATCTTATCACG was inserted at this site (flush-ended with Klenow fragment) pUT1592 and pUT1593 Introduction of 9 (pUT1592)- and 10 (pUT1593)-bpmobB deletions (14) byAflII-PflMI fragment exchange pUT1385 (3) pUT1601 Inactivation of chloramphenicol resistance gene of pACYC184 (10) by filling-in at the EcoRI site. pUT1584 Replacement of small HindIII-SalI fragment of pWSK12931 with HindIII-SalI fragment, containing R1162 DNA, from pUT221 (8) pUT459 (8) pUT1612 Replacement of smallHindIII-SalI fragment of pBR322 withHindIII-SalI fragment from pTAC3422 (1), containing a 1,386-bp λ DNA fragment carrying theint gene. - Table 2.
Mobilization frequencies from donor strains lacking R1162 replication genes
Test plasmid Relevant properties of test plasmid Transconjugants/100 μl of resuspended mated cellsa Transconjugants/potential donor (mean ± SD) Transferred plasmid pUT1557; recipient strain MV12 NalR(pUT459) pUT1543 Rep+ 3,300, 12,000, 8,100, 7,300, 7,000 (6.0 ± 1.4) × 10−3 pUT1543b Rep+ 0, 0, 0, 0, 0 <8.3 × 10−7 pUT1559 Δ(repAC) 154, 222, 282, 321, 371 (2.3 ± 0.7) × 10−4 pUT1548 Δ(repAC), no primase 0, 3, 1, 0, 1 ∼1.2 × 10−6 pUT1581 Δ(repAC) RepB′− 212, 264, 298, 129, 137 (1.7 ± 0.7) × 10−4 pUT1582 No primase 0, 0, 0, 0, 0 <8.3 × 10−7 pUT1592 Δ(repAC) Δ9bp mobB 248, 358, 192, 230, 369 (2.3 ± 0.7) × 10−4 pUT1593 Δ(repAC) Δ10bp mobB 0, 0, 0, 0, 0 <8.3 × 10−7 Transferred plasmid pUT1613; recipient strain MV12 NalR(pUT1612) pUT1543 Rep+ 2,228, 2,386, 2,045, 2,501, 2,260 (4.4 ± 4.8) × 10−2 pUT1559 Δ(repAC) 73, 54, 53, 61, 60 (2.4 ± 0.3) × 10−4 pUT1581 Δ(repAC) RepB′− 94, 80, 103, 87, 78 (3.5 ± 0.04) × 10−4 pUT1582 No primase 2, 3, 4, 3, 1 (1.0 ± 0.5) × 10−6
