Article Figures & Data
Figures
- Fig. 1.
virB1 and virB1 deletion constructs in pBP2N, a BHR vector with the nopaline virBpromoter. pSW213:virB1 is also a BHR vector that containsvirB1 under the control of the IPTG-inducible lactose promoter. N, coding sequences from nopaline virB1; O, coding sequences from octopine virB1; I, II, and III, the three conserved motifs in the superfamily of glycosidases that includes VirB1 and chicken egg white lysozyme (39); AA, amino acid; SP, signal peptide.
- Fig. 2.
Complementation of virB1 deletion strain A348ΔB1 assessed by testing virulence on K. diagremontiana. (A) Complementation with full-length VirB1, either octopine (pMTX124) or nopaline (pMTX106), restored tumorigenicity completely. (B) Complementation of virB1 deletion strain A348ΔB1 by constructs expressing either the VirB1 region of lysozyme homology (pMTX110) or VirB1* (pMTX107) partially restored tumorigenicity. Wound sites are labeled with the strain used for inoculation. Plasmids and encoded VirB1 fragments (Fig. 1) are indicated below the strain names.
- Fig. 3.
Processing of VirB1 and secretion of VirB1*. Samples from vir-induced cultures of the indicated strains were taken 18 to 20 h after induction. Cell lysates (A) and supernatants (B) were subjected to SDS-PAGE and blotted onto polyvinylidene difluoride membranes (Millipore Corp.), followed by detection with VirB1-specific antiserum. pMTX, the plasmid used for complementation; VirB1, the VirB1 fragment expressed (Fig. 1); WT, wild type. The arrow indicates the position of VirB1; the arrowheads indicate the positions of VirB1*. Numbers to the left are molecular mass markers, in kilodaltons.
- Fig. 4.
Synthesis and secretion of VirB1 are virindependent. Expression of VirB1 was regulated by the placpromoter in CB1001 (pSW213:virB1). Numbers above lanes indicate that samples from IPTG-induced cultures were taken 0, 3, 5, and 18 h after induction. CB1001 carrying vector alone (pSW213) was the negative control. Endogenous vir genes were not acetosyringone induced. Supernatants were subjected to SDS-PAGE and blotted onto polyvinylidene difluoride membranes, followed by detection with VirB1-specific antiserum.
- Fig. 5.
The signal peptide is required for processing and secretion of VirB1*. CB1001, a virB1 deletion strain of C58, was transformed with pMTX128, in which the coding sequence for the signal peptide was deleted. Samples from vir-induced cultures were taken 18 to 20 h after induction. Cell lysates (A) and supernatants (B) were subjected to SDS-PAGE and blotted onto polyvinylidene difluoride membranes, followed by detection with VirB1-specific antiserum. pMTX, the plasmid used fortrans-complementation; VirB, the VirB1 fragment expressed by that plasmid (Fig. 1); WT, wild type. The arrow indicates the position of VirB1; the arrowhead indicates VirB1*; the circle indicates VirB1SP−. Numbers are molecular mass markers, in kilodaltons. In panel B, the supernatant fraction from CB1001(pMTX128) was applied at two concentrations: equivalent to that of other lanes (1×) and 10 times that of other lanes (10×).
- Fig. 6.
The signal peptide is required for full complementation of the virB1 deletion by VirB1 or partial complementation by VirB1*. Complementation of A348ΔB1 with pMTX128 (VirB1SP−) and pMTX129 (VirB1*SP−) were assessed by testing virulence on K. diagremontiana. Wound sites are labeled with the strain used for inoculation. Plasmids and encoded VirB1 fragments (Fig. 1) are indicated below the strain names.
Tables
- Table 1.
Bacterial strains, plasmids, and oligonucleotides
Bacterial strain, plasmid, or oligonucleotide Relevant characteristics Reference Strains E. coli DH5α λ−φ80d/lacZΔM15 Δ(lacZYA-argF)U169 recA endA1 hsdR17(rK −mK +) Laboratory stock CJ236 Camr(pCJ105) dut ung thi relA; used for site-directed mutagenesis Laboratory stock A. tumefaciens A136 Strain C58 heat cured of its Ti plasmid 28 A348 A136 containing octopine pTiA6NC 28 A348ΔB1 A348 with a precise, nonpolar deletion ofvirB1 from pTiA6NC 7 C58 A136 containing the nopaline Ti plasmid pTiC58 Laboratory stock CB1001 C58 with a precise, nonpolar deletion of virB1 from pTiC58 45 Plasmids pBCSK+.NdeI Camr; source of polylinker for pBP21 7 pBP2N Strr Spcr; BHR vector carrying the nopaline virB promoter followed by a uniqueNcoI site containing the ATG start codon This study pBP21 Strr Spcr; BHR vector carrying the nopaline virB promoter followed by the polylinker from pBCSK+.NdeI This study pGV0310 Crbr; carries three consecutiveHindIII fragments of pTiC58 that include the entirevirB operon in pBR322; template for PCR amplification of thevirB promoter 19. pMTX100 Crbr; pUC119 carrying a 1.9-kbpHindIII fragment of the virB operon that includes virB1, virB2, virB3 and part of virB4 This study pMTX106 StrrSpcr; vir-regulated expression of full-length nopaline virB1, in pBP2N This study pMTX107 Strr Spcr,vir-regulated expression of nopaline virB1 * fused to the coding sequence for the signal peptide, in pBP2N This study pMTX110 Strr Spcr;vir-regulated expression of the signal peptide N-terminal segment of nopaline virB1 with a six-His tag, in pBP2N This study pMTX122 Strr Spcr; similar to pMTX107, with a smaller deletion in the lysozyme-homologous region in pBP2N This study pMTX124 StrrSpcr; vir-regulated expression of full-length octopine virB1, in pBP21 This study pMTX128 Strr Spcr;vir-regulated expression of nopaline VirB1 without the signal peptide in pBP2N This study pMTX129 Spcr; vir-regulated expression of nopaline virB1 * without the signal peptide in pBP2N This study pPZP200 Strr Spcr; binary vector, source of E. coli and pVS1 BHR origins of replication for pBP2 and pBP21 30 pSW213 Tetr; IncP BHR plasmid containinglacI q and plac with downstream polylinker sequence 11 pSW213:virB1 Tetr; full-length VirB1 cloned behind the plac promoter using HindIII and PstI sites This study Oligonucleotides BP5 5′-GGCCTGATCATCGCTGAGCTCGGACATAGG-3′; 5′ primer for PCR amplification of the virB promoter from pGV0310 BP3Nco 5′-GGCCAGTACTCCATGGCCCATCTCCCCAAGCTCATAA-3′; 3′ primer for PCR amplification of the virB promoter from pGV0310 C-His5′ 5′-GCATCATCATCATCATCATTAGAGATCT-3′; 5′ primer for introducing a six-His tag at the C terminus of VirB1 followed by a stop codon and a BglII site C-His3′ 5′-AGATCTCTAATGATGATGATGATGATGC-3′; 3′ primer complementary to C-His3′ MTX4 5′-CCACTTTCATTTGCTGCTCAACAGCTCGTC-3′; used in site-directed mutagenesis of pMTX100 to delete coding sequence for amino acids 29 to 172 of VirB1 to produce VirB1* translationally fused to the signal peptide for pMTX107 MTX5 5′-GGACAACATGTTGAAGGCAACAG-3′; 5′ primer for amplification of nopaline virB1, Met codon is within anAflIII site MTX6 5′-GGACAAGTACTATTGCGGACCTCCT-3′; 3′ primer for amplification of nopaline virB1 with aScaI site MTX19 5′-GGAAGCTTGAGCTAAGGAGATAAGG-3′; 5′ primer for PCR amplification of octopine virB1, includesHindIII site and ribosomal binding site upstream of the start codon MTX20 5′-GAACTGCAGCTCCTTAGTATAAGTCGA-3′; 3′ primer for PCR amplification of octopine virB1, includesPstI site after the stop codon MTX21 5′-CTTCCCATGGCTCAACAGCTCGTC-3′; 5′ primer for PCR amplification of virB1 * lacking signal peptide coding sequence, ATG within an NcoI site is inserted in front of amino acid 173 MTX22 5′-CCTTCCATGGCTCCATCCGTTGCTC-3′; 5′ primer for PCR amplification of virB1 lacking the signal peptide coding sequence, ATG within an NcoI site is inserted in front of amino acid 29 VirB1-5′ TGACAAGCTTGGGGAGATGGGGA; 5′ primer for PCR amplification of virB1 with aHindIII site upstream of the coding sequence VirB1-3′ GCGCGAATTCATTGCGGACCTCCTTGATT; 3′ primer for PCR amplification of virB1 with an EcoRI site at the 3′ end of the coding sequence - Table 2.
Effect of virB1 deletion on virulence ofA. tumefaciens on K. diagremontiana and complementation with the N and C termini of VirB1
Strain (plasmid; VirB1 fragmenta) Tumor frequencyb Relative tumor sizec A348 15/15 1.00 A136 0/10 0.00 A348ΔB1 2/15 0.15 A348ΔB1 (pMTX124; OctB1) 10/10 1.00 A348ΔB1 (pMTX106; NopB1) 15/15 1.00 A348ΔB1 (pMTX110; NopB1-N) 12/15 0.60 A348ΔB1 (pMTX107; NopB1*) 12/15 0.40
